Modulation of the Innate Immune Response by Targeting Toll-like Receptors: A Perspective on Their Agonists and Antagonists
- Stefano FedericoStefano FedericoDepartment of Biotechnology, Chemistry and Pharmacy, Department of Excellence 2018−2022, University of Siena, via Aldo Moro 2, 53100, Siena, ItalyMore by Stefano Federico,
- Luca PozzettiLuca PozzettiDepartment of Biotechnology, Chemistry and Pharmacy, Department of Excellence 2018−2022, University of Siena, via Aldo Moro 2, 53100, Siena, ItalyMore by Luca Pozzetti,
- Alessandro PapaAlessandro PapaDepartment of Biotechnology, Chemistry and Pharmacy, Department of Excellence 2018−2022, University of Siena, via Aldo Moro 2, 53100, Siena, ItalyMore by Alessandro Papa,
- Gabriele CarulloGabriele CarulloDepartment of Biotechnology, Chemistry and Pharmacy, Department of Excellence 2018−2022, University of Siena, via Aldo Moro 2, 53100, Siena, ItalyMore by Gabriele Carullo,
- Sandra GemmaSandra GemmaDepartment of Biotechnology, Chemistry and Pharmacy, Department of Excellence 2018−2022, University of Siena, via Aldo Moro 2, 53100, Siena, ItalyMore by Sandra Gemma,
- Stefania Butini*Stefania Butini*Tel.: +39 0577234161. E-mail: [email protected] (S. Butini).Department of Biotechnology, Chemistry and Pharmacy, Department of Excellence 2018−2022, University of Siena, via Aldo Moro 2, 53100, Siena, ItalyMore by Stefania Butini,
- Giuseppe Campiani*Giuseppe Campiani*Tel.: +39 0577 232239. Fax: +39 0577 234333. E-mail: [email protected] (G. Campiani).Department of Biotechnology, Chemistry and Pharmacy, Department of Excellence 2018−2022, University of Siena, via Aldo Moro 2, 53100, Siena, ItalyMore by Giuseppe Campiani, and
- Nicola RelittiNicola RelittiDepartment of Biotechnology, Chemistry and Pharmacy, Department of Excellence 2018−2022, University of Siena, via Aldo Moro 2, 53100, Siena, ItalyMore by Nicola Relitti
Copyright © 2020 American Chemical Society
Abstract
Toll-like receptors (TLRs) are a class of proteins that recognize pathogen-associated molecular patterns (PAMPs) and damaged-associated molecular patterns (DAMPs), and they are involved in the regulation of innate immune system. These transmembrane receptors, localized at the cellular or endosomal membrane, trigger inflammatory processes through either myeloid differentiation primary response 88 (MyD88) or TIR-domain-containing adapter-inducing interferon-β (TRIF) signaling pathways. In the last decades, extensive research has been performed on TLR modulators and their therapeutic implication under several pathological conditions, spanning from infections to cancer, from metabolic disorders to neurodegeneration and autoimmune diseases. This Perspective will highlight the recent discoveries in this field, emphasizing the role of TLRs in different diseases and the therapeutic effect of their natural and synthetic modulators, and it will discuss insights for the future exploitation of TLR modulators in human health.
Introduction
ARTICLE SECTIONS
Innate immune cells, such as dendritic cells (DCs), natural killer (NK) cells, macrophages, and neutrophils, take advantage of pattern recognition receptors (PRRs) to identify damaged-associated molecular patterns (DAMPs) and pathogen-associated molecular patterns (PAMPs).(1) PRRs have a crucial role in the defense against pathogenic insults and they are associated with the release of pro-inflammatory cytokines, interferons (IFNs), chemokines, and B and T cells activation (all components of the adaptive immunity). To date, many PRRs have been discovered, including, among others, nucleotide-binding oligomerization domain-like receptors (NODs), C-type lectin receptors (CLRs), and toll-like receptors (TLRs), with these latter being the most deeply investigated and characterized.(2) The structure of TLRs consists of three distinct domains: an extracellular domain (ECD) that directly interacts with the ligands, a Toll/interleukin-1 receptor (TIR) domain necessary for the interaction with other TIR-containing systems and the subsequent downstream signaling, and a transmembrane domain that anchors TLRs to the membrane (see Figure 1, with the following PDB IDs: ectodomain, 2Z7X; transmembrane domain, 2MK9; and TIR domain, 4OM7). In humans, 10 TLR family members have been identified and classified, according to their cellular localization: TLR1, TLR2, TLR5, TLR6, and TLR10 are located on the cell membrane, while TLR3, TLR7, TLR8, and TLR9 are localized on the endosomal membrane. As an exception, TLR4 can be found in both cellular and endosomal membranes. In the absence of a ligand, TLRs exist as monomers or weak dimers that are incapable of triggering any signaling. After the generation of homodimers (dimerization of two TLR monomers belonging to the same receptor type, e.g., TLR4) or heterodimers (dimerization of two TLR monomers belonging to different receptor types, e.g., TLR1/2 and TLR2/6), the receptor can interact with a ligand, which confers a higher stability to the dimer and induces a conformational change that allows the initiation of the signaling.(3) TLR10 may form homodimers or heterodimers with TLR1 or TLR2 and, to date, the functions of TLR10 are still unknown, as well as its natural substrates or other ligands.(4)
Figure 1
Figure 1. General structure of a dimeric toll-like receptor (TLR).
The TLR Signaling Pathways
The signaling pathway of TLRs differs among the family members; hence, the activity of TLR1, TLR2, and TLR5–TLR9 is dependent on the myeloid differentiation primary response protein 88 (MyD88) pathway, while TLR3 functionality is dependent on the presence of the TIR-domain-containing adapter-inducing interferon-β (TRIF) pathway; TLR4 is again the only exception that can use both pathways (Figure 2).(1,5) Therefore, after the interaction with DAMPs or PAMPs, TLR dimers move the TIR domains toward MyD88 or TRIF. TLR4 uses MyD88 adapter-like protein (MAL) or TRIF-related adapter molecule (TRAM) as a bridge between MyD88 and TIR or TRIF and TIR, respectively.
Figure 2
Figure 2. Schematic representation of TLR signaling pathways.
Within the MyD88 pathway, the death domain of this protein recruits IL-1R-associated kinases (IRAKs), consisting of IRAK4 and IRAK1/2. IRAKs can be activated by cross- and self-phosphorylation, culminating in the activation and dimerization of tumor necrosis factor (TNF) receptor-associated factor 6 (TRAF6), which mediates the ubiquitination of the transforming growth factor β-activated kinase (TAK1). Once activated, TAK1 modulates the expression of nuclear factor kappa B (NF-κB) and mitogen-activated protein kinase (MAPK). NF-κB is kept inactive in the cytoplasm by the inhibitor of κB (IκB), which can be phosphorylated by IκB kinase α (IKKα) and IKKβ, resulting in IκB degradation by the proteasome and in the translocation of the activated NF-κB into the nucleus (Figure 2).
MAPK protein family activation (such as MKK7 or MKK6/3) leads to protein 38 (p38) and c-Jun N-terminal kinase (JNK) phosphorylation. These proteins are involved in the recruitment of activated protein 1 (AP1) family of transcription factors and mRNA stabilization of several genes involved in the inflammatory response. Following AP1 and NF-κB translocation into the nucleus, the expression of cytokines (TNF-α, interleukin (IL)-6, IL-1 and IFN-β), chemokines and cluster of differentiation 80 (CD80), CD86, CD40 and major histocompatibility complex (MHC) class II is increased. These factors are potentially able to promote both the inflammation and activation of T and B cells (Figure 2).
The TRIF pathway is associated with the activation of either TRAF3 or TRAF6, which is directly mediated by TRIF. TRAF6 activation triggers TAK1 by interacting with the receptor interacting protein kinase 1 (RIPK-1), favoring the nuclear release of NF-κB as previously described. In contrast, TRAF3 regulates the phosphorylation of IFN-regulatory factor 3 (IRF3) by the activity of IKK-related kinases and NF-κB essential modulator (NEMO). Once activated, IRF3 dimerizes and moves to the nucleus, inducing the production of type I IFN genes (Figure 2).(1,3)
Since TLRs are highly expressed on immune cells (and some nonimmune cells), they play a pivotal role in the innate immune response. The first discovered TLR ligands are represented by bacterial cell wall components, pathogen nucleic acids and other pathogens-associated elements (i.e., lipoproteins, flagellin, ssDNA, etc.; see Figure 3). Therefore, the research interest in the discovery of new TLR ligands able to modulate the immune response has increased in the last decades. Until now, TLR ligands have found application in many diseases, especially in the context of infectious diseases, inflammatory diseases, autoimmune diseases, and cancers. Inactivated vaccines (i.e., isolated nonreplicating subcellular components, killed organisms, etc.) stimulate shorter and lower levels of immunity when compared to live vaccines (i.e., replicating live organisms). Old reports showed that the use of alum or mineral oil emulsion were able to increase the immune response against an antigen and to enhance the activity of a vaccine preparation. Successively, an antibody titer increase was observed in local inflammation determined by bacterial components. From this observation, Ramon coined the term “adjuvant” to describe compounds able to enhance the antibody response against an antigen. Immunological adjuvants are compounds that prompt the immune system toward TH1 or TH2 immunity, thus boosting the immune response against an antigen. Inactivated vaccines require an adjuvant to become effective therapeutic tools.(6) To date, the majority of TLR agonists under clinical evaluation are studied as possible vaccine adjuvants against several infections and cancer. Indeed, two TLR4 agonists are currently in use as adjuvants against HBV infections, and a TLR9 agonist reached phase III studies against this virus.(7) Several TLR3, TLR4, TLR7, and TLR8 agonists showed promising results in enhancing the therapeutic efficacy of vaccination against cancer and chronic viral infections.(8) Furthermore, TLR agonists were able to confer protection against several bacterial pathogens. TLR antagonists are usually structurally related to agonists but fail to generate a signal after binding the receptor. These compounds have been investigated against several inflammatory-related disorders and autoimmune diseases. For example, TLR3 and TLR4 inhibition represents the main strategy to fight pathogen-associated inflammation and viral or bacterial sepsis. Overactivation of TLRs may lead to the production of high levels of IFN and other cytokines, leading to chronic inflammation. Many DAMPs have been identified for most of the TLRs and they are usually released from apoptotic cells or damaged tissues. The chronic activation of TLRs exerted by DAMPs may stimulate T- and B-cells responses and, together with the release of cytokines, contributes to the development of autoimmunity. Therefore, also the inhibition of TLRs represents a valid therapeutic strategy against inflammatory and autoimmune disorders.(8)
Figure 3
Figure 3. Multiple members of TLR family are responsible for micro-organism and viral PAMPs recognition.
This perspective reports the latest (2010–2020) findings on TLR modulators and their application against different diseases. We have systematically treated the topic considering various pathological states in which the involvement of TLRs is relevant. When available, the modulators have been reported and the targeted TLR has been highlighted.
TLRs and Viral Infections
ARTICLE SECTIONS
Antiviral immunity was related for the first time to TLR signaling by Kurt-Jones et al. in 2000,(9) when they demonstrated that an intact TLR4 pathway is needed for the induction of IL-6 releasing by respiratory syncytial virus (RSV) proteins in murine macrophages. Viral pathogens can be detected either by plasma membrane TLRs, such as TLR2 and TLR4, or by endosomal TLRs, including TLR3, TLR7, TLR8, and TLR9.(10) The formers recognize proteins in the extracellular medium, while the latter specifically sense pathogen nucleic acids within the cell.
The Role of TLR2/1 and TLR 2/6 in Viral Infections and Their Modulators
Although TLR2 is mainly involved in sensing bacterial cell wall and membrane components, recent findings showed its involvement also in the innate immune response against a wide variety of viruses. For instance, TLR2 was reported to detect human cytomegalovirus (HCMV) glycoproteins gB and gH, Herpes Simplex viruses (HSV-1 and HSV-2) glycoproteins gH/gL and gB, Epstein–Barr virus (EBV) dUTPase, hepatitis C virus (HCV) core and nonstructural protein 3 (NSP3), measles virus hemagglutinin and rotavirus NSP4.(11,12) TLR2 seems to have a role also in hepatitis E virus (HEV) infection(13) and in the detection of vaccinia virus (VV), lymphocytic choriomeningitis virus (LCMV), and human adenoviruses (HAdV) B and C.(10,14) TLR2 signaling has been related to chronic hepatitis B virus (HBV) infection, since the hepatitis B antigen (HBsAg) reduces TLR2 expression in hepatic cell lines;(15) moreover, several studies highlighted the importance of TLR2 signaling in the suppression of HBV replication within hepatocytes.(16) The heterodimer TLR2/6 is involved in RSV sensing, as demonstrated by several works reviewed in Jung et al.,(17) and in the activation of immune response in monocytes and macrophages upon Varicella Zoster virus (VZV) infection.(11)
Lipopeptides are the most common TLR2 agonists, and these compounds are derived from bacterial cell wall components. The structure of these molecules usually includes the S-[2,3-bis(palmitoyloxy)propyl] cysteine (Pam2Cys, where Pam is palmitoyl) or S-[2,3-bis(palmitoyloxy)propyl]-N-palmitoyl-cysteine (Pam3Cys) motifs, which promote the immunomodulation. From the optimization studies conducted on these structures, compounds Pam2CSK4 (1a, Figure 4) and Pam3CSK4 (1b) emerged as the most potent and soluble TLR2/TLR6 and TLR2/TLR1 agonists, respectively. In 2006, Jin and co-workers obtained for the first time the crystal structure of the heterodimer TLR2/1 in complex with the synthetic agonist 1b, which is the tripalmitoylated peptide Cys-Ser-Lys4 derived from the mycoplasmal lipopeptide macrophage activating lipopeptide-2 (MALP-2, 2).(18) Since then, extensive research developed other analogues exploring their structure–activity relationship (SAR) to selectively target the heterodimers TLR2/1 or TLR2/6. In particular, the presence of three acyl moieties, two ester-bound and one amide-bound, as in 1b or Pam3Cys, is necessary to drive the formation of the heterodimer between TLR2 and TLR1; on the other hand, only two acyl derivatives, as in 1a and Pam2Cys, lead to TLR2/6 heterodimerization. Moreover, it was found that the strongest agonist activity was associated with a C16 acyl moiety.(19−21) These molecules are under investigation for different potential therapeutic applications and, until now, Pam2Cys was shown to counteract influenza A virus (IAV) infection.(20) Moreover, recent studies demonstrated that 1b-mediated TLR2 activation not only exerts a suppressive action against HBV replication and capsid formation in the hepatoblastoma cell line HepG2 (human hepatoblastoma cell line), but it also triggers the immune response in two hepatocyte cell lines, leading to the subsequent decrease in HBV replication markers.(16,22) On the other hand, the diacylated lipopeptide FSL-1 (3) was shown to induce an antiherpetic environment in mice against HSV-2 infections through the TLR2/6 pathway.(12) More recently, Yin et al.(4) designed a selective TLR2/1 agonist, namely, CU-T12-9 (4), that exhibited an IC50 value of 54.4 nM and whose binding pocket partially overlaps that of the amide-bound lipid of the TLR2/1-1b complex. Although no therapeutic application has been suggested, the agonist activity of all these molecules may be useful to stimulate the immune response upon microbial infection or as vaccine adjuvants. A recent work identified low-molecular-weight mannogalactofucans (LMMGFs) prepared by enzymatic degradation of galactofucans from Undaria pinnatifida sporophylls as promising TLR2 agonists able to counteract HSV-1 infections of host cells.(23)
Figure 4
Figure 4. Chemical structures of the TLR2/1 and 2/6 modulators 1–6 for the treatment of viral infection.
The identification of a series of triacetylated lipopeptides related to 1b, characterized by a glycerol core and variable amino acids, namely, small-molecule immune potentiators (SMIPs), led to the development of potential tetanus and influenza vaccines adjuvants. The representative compound SMIP2.1 (5) showed an increased cross-presentation by human antigen-presenting cells (APCs).(24) More recently, SMP-105, which is a TLR2 agonist derived from the Mycobacterium bovis cell wall skeleton, approved for the treatment of bladder cancer, has been proposed as an adjuvant, because of its ability to upregulate NF-κB signaling.(25)
E567 (6), the first synthetic TLR2 antagonist discovered through a cell-based screening, was shown to strongly reduce TLR2-mediated inflammatory response upon LCMV and HSV-1 infections. Remarkably, this compound also inhibited LCMV replication in mice, but this effect was not related to its activity on TLR pathways.(20)
The Role of TLR3 in Viral Infections and the Effect of Its Modulators
Endosomal TLRs, i.e., TLR3, 7, 8 and 9, are the PRRs able to detect pathogen nucleic acids, thus constituting the first line of the innate immune response against viral infections. More specifically, TLR3 recognizes viral pathogens by binding to dsRNA sequences either derived from their genome or from the intermediates generated during their replication cycles. This feature enables this PRR to trigger innate immune response against dsRNA viruses, such as rotavirus, but also ssRNA viruses, e.g., Hantaan virus (HV), RSV, West Nile Virus (WNV), coxsackievirus B3 (CVB3), IAV, Punta Toro Virus (PTV), HCV, HEV, Dengue Virus (DENV), encephalomyocarditis virus (EMCV), and poliovirus. Moreover, even some DNA viruses, such as EBV, VV, Kaposi’s sarcoma-associated herpesvirus (KSHV), HBV, HSV-1, and HSV-2, can be recognized by TLR3.(10,20,26−28) Interestingly, TLR3 is heavily involved in several viral infections of the central nervous system (CNS), where it can play either a protective or detrimental role for the host. Indeed, TLR3 has been related to the immune response against Japanese encephalitis virus (JEV), tick-borne encephalitis virus (TBEV), enterovirus-A71 (EV-A71), and Zika virus (ZIKV); sometimes, it also plays a role in the excessive neuro-inflammation that let rabies virus (RABV) or WNV invade neurons.(29,30) Also, other viruses can take advantage of the TLR3 signaling activation, resulting either in lower host resistance to lethal infections, as it happens for PTV, or in a detrimental inflammatory response, as it happens for IAV and VV in the lungs.(10) Two TLR3 single nucleotide polymorphisms (SNPs) lead to an interesting dual effect: SNP L412F at the same time promotes HSV encephalitis and protects from human immunodeficiency virus-1 (HIV-1) by restoring immune homeostasis; on the other hand, SNP P554S, while stimulating the resistance against HIV-1 infection, also increases susceptibility to CVB3 invasion of several body districts.(31)
TLR3 recognizes viral dsRNA and stimulates IFNs production. The most studied TLR3 agonist is polyinosinic:polycytidylic acid (poly(I:C)), from which many derivatives have been developed. Poly(I:C) determined a TLR3-dependent immune response, but in vivo assays also showed several toxic effects, including shock, kidney failure, and hypersensitivity reactions. For these reasons, poly(IC:LC) (interstitial Cajal-like cell, Hiltonol), a poly(I:C) molecule stabilized with polylysine and carboxymethylcellulose, has been developed. These modifications confer to the molecule a higher stability compared to the original dsRNA. This molecule was proposed to be used in combination with heat shock protein (HSP)-E7 (a construct consisting of the human papilloma virus (HPV) Type 16 E7 protein and HSP65) as a vaccine against several cancers. Another poly(I:C) derivative in which uridylic acid is added at a molar ratio of 12:1 during polycytidylic acid production, namely, poly(I:C12U), also known as Ampligen, has been widely used in several clinical trials for the treatment of viral infections and cancer (NCT01591473, NCT04119830). The presence of uridylic acids in this structure determines a higher affinity for TLR3, thus activating genes for IFNs and protein kinase (p68).(32) Because of the complex protein-RNA interactions needed for the recognition of dsRNA by TLR3, to date, only a few small molecules able to modulate this receptor have been developed. The most important synthetic TLR3 agonist is poly(I:C), which is widely used both as an antiviral agent, vaccine adjuvant, and pharmacological tool to study the TLR3 pathway. The pivotal role of this ligand in the stimulation of the immune system and in the protection against a remarkable variety of viral pathogens, such as HIV, DENV, IAVs, severe acute respiratory syndrome-corona virus (SARS-CoV), Chikungunya virus (CHIKV), HBV, HSV-1, and HSV-2, has been widely reviewed by others.(12,20,28,33) Moreover, poly(I:C) has been investigated as potential vaccine adjuvant for HPV, HSV-2 and HIV vaccinations, since it induces the expression of IFNs, cytokines, and chemokines and it drives DCs maturation, NK cell-mediated cytotoxicity and T-cell responses to these viruses.(12,34,35) Since the poly(I:C) potent immune-stimulatory effect is also mediated by RIG-1 and melanoma differentiation-associated protein 5 (MDA5) receptors, which are cytoplasmic RIG-1-like receptors (RLRs), several efforts have been made to develop more selective and less toxic analogues.(10) Poly(I:C12U) has been extensively studied to treat HBV, IAV, HCV, HIV, and HPV infections as vaccine adjuvant. Moreover, this ligand is better tolerated than poly(I:C) and it has been demonstrated that its antiviral activity is strictly TLR3-dependent.(12,20,25,28) Poly(IC:LC) seems to provide broad spectrum protection against IAVs, RSV, and SARS-CoV.(12) Moreover, it has been shown to exert anti-HBV activity through an enhanced expression of IFNs and to induce innate immune responses in HIV-positive patients.(15,36) The stabilized dsRNA PIKA is a potent adjuvant that was demonstrated to enhance cellular and humoral immune response to HBV antigen and to reduce viral loads of influenza viruses in infected mice lungs.(20) Recently, several studies and clinical trials assessed the ability of PIKA to act as a potential rabies vaccine adjuvant: Zhang et al. showed that this ligand protected 70%–80% of mice challenged with rabies virus, compared to a survival rate of 20%–30% in the control group.(37) A synthetic 50-bp dsRNA selective for TLR3 called Riboxxol showed a dose-dependent decrease of intracellular HBV DNA, as well as extracellular HBeAg and HBsAg, thus proving to be a valuable potential candidate for the treatment of HBV infections.(22) Finally, the small molecule RO 90–7501 (7, Figure 5) developed by Guo et al. was shown to enhance the TLR3-mediated expression of IFN-β upon poly(I:C) treatment of 293TLR3HA and THP-1 cells and to promote poly(I:C) antiviral activity in 293TLR3HA cells challenged with vesicular stomatitis virus (VSV).(38)
Figure 5
Figure 5. Chemical structures of TLR3 and 4 modulators 7–14 for the treatment of viral infection.
The Role of TLR4 in Viral Infections and the Effect of Its Modulators
Among TLRs, TLR4 is in complex with the myeloid differentiation 2 (MD2), which exhibits a ligand-binding pocket for compounds such as lipopolysaccharides (LPS), lipooligosaccharides (LOS), and exogenous modulators. Lipid A represents the membrane-anchoring moiety of LPS, and it is composed by a glucosamine disaccharide substituted with two negatively charged phosphate esters and six fatty acid acyl chains. Because of the toxic properties of lipid A, several chemical modifications were performed on its structure. Peri and Calabrese reviewed the SAR studies performed on lipid A structure in order to obtain either TLR4 agonists or antagonists.(39) Briefly, underacylated analogues, i.e., molecules bearing less than six fatty acid chains, exert antagonist activity. The most known example of this strategy is Eritoran (8, Figure 5), which failed a phase III clinical trial (NCT00334828) as an antisepsis agent. On the other hand, dephosphorylated lipid A or derivatives obtained by replacement of the sugar moieties with amino acids, were characterized by nontoxic agonist effect. Monophosphoryl lipid A (MPLA, 9) and aminoalkylglucosaminide 4-phosphates (AGPs), such as RC-529 (10), are examples of TLR4 agonists approved for cancer immunotherapy and as vaccine adjuvants, thanks to their ability to trigger Th-1-mediated immune response.(12,39) TLR4 main ligand is bacterial LPS, but several studies elucidated the role of this receptor also in the detection of viral pathogens. TLR4 recognizes RSV membrane-bound F protein,(9) and it also senses the VSV glycoprotein G, the HCV NS3 and NS5A proteins, the DENV NSP1, and the Ebola virus (EBOV) glycoprotein, both in its membrane-bound and secreted forms.(40,41) Moreover, recent reports suggested an important role of TLR4 signaling in HSV-2 infection of human cervical epithelial cells and also in KSHV infection of ECs.(26) In addition to RSV, other respiratory-related viruses can activate the TLR4 signaling (i.e., HAdV-C and IAV).(40,42) This aspect was further confirmed by the TLR4 SNPs D299G and T399I, which resulted in possessing an increased susceptibility to RSV infections.(12,31) Other viral pathogens, such as EV-A71 and HBV, enhance the immune response by stimulating the maturation of DCs by inducing TLR4 pathway.(15,43) Several works elucidated a dual role of TLR4 in HPV infections and in the subsequent induction of cancers: TLR4 stimulation was proved to enhance the immune response, leading to the eradication of both HPV and related malignancies; however, at the same time, the promoted inflammatory state has also been related to the insurgence of HPV-related warts.(44) Moreover, a recent study described an association between TLR4 SNP D299G and HPV wart infection in a group of 78 Egyptian patients.(45) Not surprisingly, TLR4-mediated immune response stimulation led to the release of pro-inflammatory cytokines and chemokines; thus resulting in detrimental effects for the host also during respiratory infections and hemorrhagic fevers. Indeed, as already reviewed by Olejnik et al., TLR4 stimulation is needed to trigger an initial protective response to IAV, SARS-CoV, RSV, EBOV, and DENV; moreover, several works demonstrated a reduction in lethality and disease progression upon mice treatment with TLR4 antagonists.(40)
Bacterial LPS was shown to stimulate TLR4 during HBV infection, thus inhibiting viral replication, via the upregulation of IFN-β expression. Therefore, TLR4 agonisms can be a precious tool in the fight against viral pathogens.(16) Indeed, 9, in combination with aluminum salts, the so-called adjuvant system 04 (AS04), is currently used in two registered vaccines: for HBV, Fendrix, and for HPV, Cervarix.(46)9, alone or in association with saponin QS-21, is currently evaluated in several clinical trials as adjuvant for HSV, HBV, and HIV vaccines (NCT04066881, NCT00001042, NCT03961438, NCT00224484). It is clear that the efforts to discover novel TLR4 agonists have mainly been directed toward the development of new vaccine adjuvants with better properties, improved immune-stimulatory effects, and reduced toxicity. In the above-mentioned work, the authors also reported the discovery of the lead compound 1Z105 (11) by a cell-based high-throughput screening aimed to identify potent NF-κB stimulators.(47,48)11 belongs to the class of pyrimido[5,4-b]indoles and it has been proposed as IAV hemagglutinin vaccine adjuvant, in combination with TLR7 agonist to balance TH1- and TH2-type immune response against influenza viruses.(49) Polysaccharide peptide (PSP), extracted from the edible fungus Coriolus versicolor, is a natural compound endowed with antiviral properties mediated by the stimulation of TLR4 pathway. Indeed, it contains α- and β-glucans, as well as polypeptides that make PSP a powerful PAMP, which is promptly recognized by TLR4. For this reason, its ability to inhibit HIV replication was studied and data suggested that PSP-induced TLR4 signaling led to the expression of anti-HIV chemokines.(50) A different strategy involved the development of small peptides mimicking LPS, thus replacing the natural bacterial PAMPs in vaccines, together with proper adjuvants, in order to induce the same level of immunization while reducing detrimental side effects. For instance, the LPS-mimicking heptapeptide RS09 (12) was either conjugated or mixed with an adenovirus-derived HIV antigen complexed with DEG-PEI polymer and intranasally administered. Data showed that the addition of 12 was able to increase the mucosal immunity triggered by the antigen through a TLR4-mediated signaling.(51) Fimbriae H (FimH) protein is a known TLR4 ligand able to stimulate the innate immune system and to exert protective effects against several viral infections. Similar to LPS, FimH is a constituent of E. coli type 1 fimbriae and consists of two immunoglobulin (Ig)-like domains connected by a linker.(52) This polypeptide has been thoroughly investigated in the past and it showed an interesting immune-stimulating activity against IAV in mice lungs, thus reducing the lethality of the infection; it also resulted to be active against CVB3 induced myocarditis.(52,53) Finally, a reporter gene-based high-throughput assay to identify novel TLR modulators revealed amphotericin B (AmpB, 13) as a promising TLR4 agonist; indeed this compound displayed an adjuvant effect comparable to that of other TLR agonists, i.e., ODN 2006 for TLR9, MB-564 for TLR8, C4 for TLR7, and DBS-2–217c for TLR2, inducing similar titers of anti-CRM197 (which is a nontoxic mutant diphtheria toxin) IgG in rabbits.(54)
In mice infected with IAV, the synthetic TLR4 antagonist 8 was shown to enhance their survival via suppressing influenza-induced cytokine gene expression, thus determining a reduction of IAV-related inflammation. Following TLR4 inhibition, compound 8 reduced lung injuries when administered up to 6 days after infection. Moreover, it reduced lung pathology in cotton rats infected with the H3N2 strain of the influenza virus.(55) FP7 (14) is a diacylated diphosphorylated monosaccharide designed to mimic Lipid X, which is a precursor of lipid A. This latter is able to bind CD14 and induce its selective endocytosis in bone-marrow derived macrophages, thus preventing the TLR4/CD14 coupling and signaling activation. Like Eritoran, 14 reduced IAV-induced lethality and lung damage associated with the inflammatory response. From the recent discovery that the cyclic antimicrobial 18-residue peptides (namely, θ-defensins, ex- 498 pressed from primates) counteracted LPS-induced lethality in mice by TLR4 inhibition, further studies on these compounds were conducted.(12) Both θ-defensins and retrocyclins (bioengineered analogues of θ-defensins) showed potent antiviral properties by blocking the entrance of HIV, HSV, and IAV into the cells. Moreover, it was recently proved that RC-101, a synthetic retrocyclin, was able to block both the LPS-induced TLR4 signaling and the 1b-induced TLR2 signaling and to reduce the severity of PR8-associated disease in mice.(56)
TLR5 in Viral Infections and the Role of Its Modulators
Usually, TLR5 is not involved in the detection of viral and fungal PAMPs, because it selectively recognizes bacterial flagellin; nevertheless, flagellin itself has been proposed as an adjuvant for vaccines against IAV and murine HCMV.(57) In particular, Salmonella typhimurium FljB flagellin (STF2) fused either with hemagglutinin antigen of the HA1 Solomon Island strain of IAV, or with M2e protein of IAV, has been developed as an adjuvant for the IAV vaccines VAX125 and VAX102, respectively.(3,20)
TLR7 and TLR8 in Viral Infections and the Role of Their Modulators
The endosomal PRRs TLR7 and TLR8 recognize GU-rich and AU-rich ssRNA sequences from the genomes of different viral pathogens. Both of them can detect PAMPs derived from yellow fever virus (YFV), HCV, ZIKV, and rhinoviruses, while several studies highlighted their involvement in HIV, IAV, RSV, VSV, CVB3, HSVs, WNV, SARS-CoV, and rotavirus infections.(10,12,28,58−60) TLR7/TLR8 stimulation has also been related to the reactivation of KSHV from latency in infected B lymphocytes.(61) However, differences between these TLRs arise in their cellular expression, since TLR7 can be mainly found in pDCs, B cells, monocytes, and macrophages, while TLR8 is primarily expressed by monocytes, macrophages, and mDCs. Furthermore, some pathogens, such as measles virus, EBOV, DENV, human T-lymphotropic virus type 1 (HTLV-1), HCV and poliovirus, can be selectively recognized by TLR7.(28) It has also been demonstrated that EBV infection upregulates TLR7 expression in B cells,(26) while the IFN-β production by pDCs in mice lungs upon RSV infection is dependent on TLR7 signaling.(17) EV-A71 infection induces a pro-inflammatory response in a TLR7-dependent manner in several cell types;(43) similarly, Langerhans cells and T-cells upon WNV infection and murine DCs, following JEV injection, seem to trigger an immune response through TLR7 signaling.(62) Notably, a TLR7 SNP has also been related to the severity of both HIV and HCV infections.(31) On the other hand, ssRNA40, a TLR8 ligand, activates innate immune cells in healthy and chronic HBV or HCV infected livers, strongly suggesting a role for this PRR in the treatment of chronic hepatitis.(15) Moreover, SNPs studies in the Turkish population suggested a role of TLR8 in the clinical outcome of Crimean-Congo hemorrhagic fever, caused by the homonymous virus.(31)
TLR7 and TLR8 dimers possess two distinct binding sites: the first one recognizes and interacts with ssRNA sequences, while the second one is located at the dimerization interface and it binds free guanosine, in the case of TLR7, and free uridine, in the case of TLR8. The first attempts to identify TLR7 and TLR8 modulators were directed toward different chemical modifications of natural oligoribonucleotides (ORNs) and nucleosides to obtain more selective and more stable ligands. In fact, the recent work by Patinote et al., which extensively reviewed several TLR7 and TLR8 modulators, highlights the fact that agonists generally possess a scaffold derived from purines and pyrimidines.(2) Imiquimod (15, IMQ; see Figure 6) was first described for its immune-stimulating activity against HSV-2, Sendai virus, and HPV.(2) Later, 15 was shown to exert antiviral activities, in the case of respiratory and HBV infections, and also to enhance the T cell response toward HIV.(25,63,64) Moreover, as a vaccine adjuvant, IMQ was shown to improve the morbidity and survival in mice following influenza challenges, when administered at the time of vaccination,(65) and it is currently under investigation for an E7 peptide-based HPV vaccine.(34) Resiquimod (16), which is a dual TLR7/8 agonist developed for the treatment of HSV-2 and HCV infections, belongs to the same structural class as IMQ. Despite failing the clinical trials for its initial applications, it has recently been shown to reduce HIV replication in cultured human monocytes and ZIKV replication in myeloid cells at micromolar concentrations.(20,66)16 also showed promising results in the enhancement of the immune response upon administration of different HIV-1 and simian immunodeficiency virus (SIV) epitopes in Rhesus macaques and it was capable of inducing an antigen-specific TH1-acquired immune response against HSV-2 infection, thus displaying interesting adjuvant effects.(58,67) Increasing efforts have been made to understand the SAR of these potent TLR agonists and to develop novel imidazoquinolines with an improved safety profile and a broader spectrum of action, as described in the review by Patinote et al.(2) Other imidazoquilones derivatives have been claimed as potential vaccine adjuvants: 2- or 7-lipidated imidazoquinolines—namely, UM-3003, UM-3004, UM-3005 (17a–17c)—are potent TH1/TH17 adjuvants in influenza-challenged mice and they induce the required cytokines to generate the same TH1/TH17 response in humans;(68) 3M-012 conjugated with HIV-Gag strongly enhances TH1 response;(20) 3M-011 (18) administered either before infection or after inoculation reduces IAV titers in rats lungs; finally, the incorporation of 3M-019 into IAV vaccine promotes antibody production upon influenza challenge.(65) Several other classes of (hetero)polycyclic compounds or nucleic acids analogues with antiviral activity have been synthesized, such as pteridinones, tetrahydropyridopyrimidines, pyridopyrimidines, and guanine derivatives, and they all have been well-reviewed in the previously mentioned paper.(2) 8-Hydroxyadenine scaffold is associated with selective TLR7 stimulation and several analogues have been developed to treat HCV infection or to reverse HIV-1 latency in infected cells, when conjugated with TLR2 modulators such as Pam2Cys (CL401, 19a), 1a (CL413, 19b), or monoacyl-ethyl-cysteine (CL572, 19c).(2,69) Other 8-hydroxyadenines, such as SZU-101 (20a) and its ethacrynic acid-conjugated analogue T7-EA (20b), are promising candidates as adjuvants: the former for the inactivated H1N1 influenza vaccine, the latter for prophylactic and therapeutic HBV vaccines.(2,70) Novartis Vaccines and Diagnostic, Inc., developed the benzonaphthyridine derivative SMIP-7.7 as TLR7 agonist that protects against genital HSV-2 disease in guinea pigs.(58) In order to promote drug penetration through the skin barrier, phospholipid TLR7 agonist conjugates have been investigated as potential therapeutic tools for the treatment of viral warts. These conjugates determined a higher induction of proinflammatory cytokines, when compared to the unmodified TLR7 activator.(71) Several different compounds are currently undergoing clinical trials for the treatment of chronic hepatitis infections: the TLR7, TLR8, and dual TLR7/8 agonists RG-7854 (clinical trial identifier not disclosed), GS-9620 (21, NCT02166047, NCT01591668, NCT01590654, NCT01590641, NCT02579382, NCT02258581), RG-7795 (ANA773, NCT01211626, NCT02015715, NCT02391805), GS-9688 (22, ACTRN12617000235303), and RO7020531 (NCT02956850). Notably, 21 (NCT02858401, NCT03060447) has been extensively studied and suggested also to target latent HIV reservoirs. Recently, McGowan et al. explored the SAR of pyrimidine-based compounds and, by a high-throughput screening, dual TLR7–8 agonists were identified.(72) In particular, they varied the substituents at each position of the heterocycle and assessed their TLR activity in vitro and their inhibition of HBV replication in vivo. The best results were obtained with compound 23, which was able to target both the receptors in their homodimeric form with the same activity (lowest effective concentration (LEC) [hTLR7] = 1.6 μM, LEC [hTLR8] = 1.6 μM) and to exert anti-HBV activity.(72) Later on, the same group optimized the previously obtained lead compound and designed a series of more potent 2,4-diaminoquinazolines, which retained the dual agonist nature and the antiviral induction of IFN and cytokines. Despite not being the most potent compound of the series, 24 (LEC [hTLR7] = 0.15 μM, LEC [hTLR8] = 0.16 μM) was selected for further studies, because of its reduced off-target activity. It showed a promising in vivo pharmacokinetic and pharmacodynamic profiles, as well as good tolerability and IFN-α induction, thus promoting HBV immunity in chronically infected patients.(73) The same authors also developed a series of pyrrolo[3,2-d]pyrimidines as selective TLR7 agonists active against HBV. The best compound of the series 25 (LEC [hTLR7] = 0.4 μM) proved to be well-tolerated in vivo and induced IFN-stimulated gene response in both mice and monkeys; it also reduced HBV viral load in the serum and in the liver, thus suggesting a great potential for the treatment of viral hepatitis.(74) In addition to small molecules, several nucleic acid derivatives with antiviral activity have been developed to target TLR7 and/or TLR8. For example, synthetic dsRNA-based TLR3/7/8 agonist reduced pulmonary influenza virus, HIV and HCV levels in several animal models.(2) A phosphorothioate protected ssRNA oligonucleotide containing a GU-rich sequence, namely, ssRNA40, selectively activated liver innate immune cells to produce IFN-γ, thus suggesting a potential role for this TLR8 agonist in the treatment of HCV or HBV diseases.(15)
Figure 6
Figure 6. Chemical structures of the TLR7, TLR8, and TLR9 modulators 15–27 endowed with an antiviral activity.
To date, the vast majority of TLR7 and TLR8 antagonists are modified analogues of known agonists that bind to the receptor but fail to trigger the downstream signaling. To date, only a few TLR7 and TLR8 antagonists have been developed or investigated for antiviral purposes, the main examples being chloroquine (CQ, 26), anti-miRNA oligonucleotides (AMOs) and IRS 954, which showed inhibition of TLR7/8/9 signaling. 26 was investigated for the treatment of severe sepsis, HIV, IAV, and DENV infections. AMOs proved to strongly bind TLR7 and TLR8 and to inhibit their sensing for viral ssRNA. IRS 954 (5′-TGCTCCTGGAGGGGTTGT-3′) is an oligonucleotide TLR7/9 antagonist able to decrease IFN-α production in HIV-stimulated peripheral blood monocyte cells, currently under preclinical investigation to treat HIV infections.(2)
TLR9 in Viral Infections and the Role of Its Modulators
TLR9 is the only DNA-sensing TLR, and it is expressed in the endosomes of B cells, macrophages, DCs, ECs, VSMCs, T cells, and platelets. It recognizes unmethylated cytosine–phosphate–guanine (CpG) motifs commonly found in the dsDNA of many viruses, such as poxviruses, KSHV, VZV, CMV, and human herpesvirus 6. TLR9 is also involved in the antiviral response against HSV-1, HSV-2, HAdV, and EBV in cooperation with TLR2 signaling.(10,26) Emerging evidence suggests a role for TLR9 in the detection of HPV infections.(75) There are some reports that relate TLR9 signaling to RNA viruses infections, such as HIV and EV-A71, despite the fact that it only recognizes dsDNA. Indeed, the HIV envelope glycoprotein gp120 has been shown to selectively disrupt TLR9-mediated DCs activation, thus reducing the immune response. On the other hand, the ability of TLR9 to activate the immune system in the brain of EV-A71 infected mice may be related to the sensing of host DNA derived from dying infected cells.(43,76) Moreover, it has been reported that two SNPs in TLR9 lead to enhanced progression of HIV infection.(31)
The innate immune system is able to detect DNA from pathogens in order to activate an innate immune response. This recognition is often complex and influenced by several factors, including nucleotide sequence, subcellular localization, secondary structure, and covalent modifications of the latter.(77) TLR9 ligands are represented by unmethylated CpG-oligodeoxynucleotides (CpG-ODNs) DNA sequences. Synthetic CpG ODNs differ from the natural analogues mainly for the replacement of the phosphodiester backbone with a phosphorothioated one, which confers increased stability toward nucleases. To date, four classes of CpG ODNs have been developed: class A (also known as D-type), class B (also known as K-type), class C, and class P. Their sequences are responsible for their different activities: class A ODNs induce type I IFN production in pDCs, whereas class B ODNs stimulate B cell proliferation and DC maturation.(16) The main applications of CpG ODNs as antiviral agents are in the treatment of HIV, IAV, HPV and hepatitis infections, both as drugs and as vaccine adjuvants.(20,34) For example, CpG 1826 (5′-TCCATGACGTTCCTGACGTT-3′), which is an A class ODN, elicited a strong anti-HBV response by increasing HBsAg-specific IFN-γ and IL-2 production in mice.(16) At the same time, other class A agonists have been tested with good results as HIV or SIV vaccine adjuvants.(67) Two class B ODNs, namely, CpG 7909 (5′-TCGTCGTTTTGTCGTTTTGTCGTT-3′) and 1018 ISS (5′-TGACTGTGAACGTTCGAGATGA-3′) are currently under investigation and in use, respectively, as adjuvants in HBV vaccines (Engerix-B and HEPISLAV), suitable also for immunocompromised patients.(15) Moreover, CpG 7909 was also added to the formulation of a chimeric peptide vaccine for CMV infection, with promising outcomes from a Phase 1b trial (NCT01588015). CpG 10101 (C class, sequence not available) was tested in a Phase 1b clinical trial for the treatment of chronic HCV infection, showing encouraging results and tolerable side effects (NCT00142103). SD-101 (sequence not available), which is a second-generation C class ODN, was proved to induce potent IFN-α and IFN-γ responses in HCV patients while being well-tolerated.(12) Another class of TLR9 agonists are the so-called immune modulatory oligonucleotides (IMOs), which are synthetic DNA structures containing the dinucleotide motifs CpR or RpG, where R is a synthetic analogue of a base, characterized by a higher metabolic stability. IMO-2125 is a member of this class that showed promising results in a Phase I trial on HCV patients (NCT00728936). MGN 1703 (5′-AAAGTCTCGGGGCGTTCTTAGGTGGTAACCCCTAGGGGTTACCACCTTCATTGGAAAACGTTCTTCGGGGCGTTCTTAGGTGGTAACCCCTAGGGGTTACCACCTTCATTGG-3′) is a dsDNA sequence with a double-stem tridimensional structure including CG motifs without any chemical modification, which was shown to induce a strong antiviral innate immune response and boost NK cell-mediated suppression of HIV-1 infections in CD4+ T cells.(78) Finally, also the natural product oxymatrine (27, Figure 6), extracted from the herb Sophora alopecuraides L., seems to induce the TLR9 pathway and the secretion of antiviral cytokines, thus enhancing the effect of TLR9 ligands in chronic HBV patients.(79)
Although the main application of TLR9 antagonists is for autoimmune and inflammatory diseases, in some cases, the inhibition of this receptor may be a useful strategy to counteract viral infections. It has been reported that, by inhibiting the infiltration of CD4+ lymphocytes into the SIV infected vaginal environment a limitation of the initial systemic dissemination of the virus may occur. Thus, TLR7 and TLR9 inhibition can exert a positive role in SIV or HIV infections. For this reason, several studies explored the modification of ODNs required to exert an antagonist effect on TLR9. Fraietta et al. reported that a baseless 14-mer phosphorothioate 2′-deoxyribose backbone was endowed with a dual activity against HIV, limiting both the viral replication and the TLR9-mediated recruitment of susceptible immune cells response.(80)
TLRs and Bacterial Infection
ARTICLE SECTIONS
As reported by several recent studies, TLRs play a fundamental role in host defense against microbial infections.(81) Studies conducted in models of Legionella pneumophila and Staphylococcus aureus infections defined the importance of MyD88-dependent responses in host protection following a TLR-signaling cascade.(82) Further evidence emerged from TLR knockout (KO) mice models exposed to various pathogens: they showed hyporesponsiveness against the infectant, a reduced release of pro-inflammatory cytokines (TNF-α, IL-6, IL-1) and, therefore, decreased host cell survival.(83) Mammalian TLRs exposed on the plasma membrane recognize bacterial cell surface components, while endosomal TLRs are responsible for the detection of intracellular nucleic acids from viruses and bacteria.(84)
TLR2/1 and TLR2/6 in Bacterial Infections and the Role of Their Modulators
Triacyl lipoproteins (from Gram-negative bacteria and some Gram-positive bacteria) and diacyl lipoproteins (from Gram-positive bacteria and mycoplasma) are known to be recognized by TLR2/1 heterodimers and TLR2/6 heterodimers, respectively. A well-characterized TLR2 agonist is 2 originally isolated from Mycoplasma fermentans. When administered in mice, by intratracheal instillation of (0.5 μg), 2 resulted in the activation and recruitment of macrophages and neutrophils into lungs. Furthermore, it reduced the pulmonary bacterial burden in Streptococcus pneumoniae infections following the increase in levels of C–C motif chemokine ligand 5 and leukocyte migration.(85) Lipopeptides derived from bacterial lipoproteins activate the innate immune system by engaging TLR2, without any apparent toxicity in ex vivo human blood models. Evidence suggests that this class of compounds may represent safe and effective vaccine adjuvants to be applied against bacterial infections.(86) Pam2Cys has been incorporated in many lipopeptide vaccine candidates, as a result, becoming a potent adjuvant. Pam2Cys plays a pivotal role in lipopeptide-based vaccines immunogenicity by enabling them to target and activate DCs.(87) A major cause of mortality that occurs with influenza virus is represented by the comorbidity of bacterial infections, as in the case of influenza accompanied by pneumonia caused by Streptococcus pneumoniae. Prophylaxis with the pegylated analogue of Pam2Cys (PEG-Pam2Cys, 20 nmol by the intranasal route 3 days before infection) determined a reduction of the impact of S. pneumoniae infections.(88) The authors of this study reported that PEG-Pam2Cys (28, Figure 7) decreased the pulmonary bacterial burden, the level of pro-inflammatory cytokines, and the permeability of lungs’ blood vessels; therefore, it was able to limit the spread of the bacteria into the blood.(88) The growing interest for this class of lipopeptide agonists prompted several efforts of different research groups in developing new derivatives characterized by simpler structures and an improved pharmacokinetic profile. Wu et al.(89) investigated the importance of the highly conserved Cys residue of these peptides, as well as the stereochemistry and geometry of the Cys-Ser dipeptide unit. They found that the thioether bridge is essential for the retention of the activity.(89) Further studies focused on optimizing the length of the acyl chain. SAR studies led Salunke et al. to synthesize a series of selective hTLR2 agonists analogues characterized by a single C16 acyl chain on the oxygen of the thioether bridge and acyl chains of different lengths and compositions on the amino group of the Cys residue.(90) In this way, they obtained a highly potent lead compound (29, EC50 = 5.52 nM) but with poor water solubility. With the aim of synthesizing a fully optimized (highly water-soluble and chemically stable) hTLR2-specific agonist, they designed a new class of compounds characterized by a C16 carbamate moiety and a tertiary amine. Compound 30, which is the prototypical compound of this series, showed an excellent safety profile and prominent adjuvant activities.(86) Given their extensive potential applications, many of these lipopeptide TLR2 agonists have been evaluated for several therapeutic uses and reached different stages in clinical trials.(91) One of the most recent and successful examples of a self-adjuvanting lipopeptide vaccine composed of two factor H binding proteins (rLP2086-A05 and rLP2086-B01) linked to a TLR2 agonist similar to Pam3Cys is Trumenba. It was developed by Pfizer, and it received U.S. Food and Drug Administration (FDA) approval in 2014 for the treatment of meningococcal meningitis (caused by Neisseria meningitidis serogroup B) in patients 10–25 years old.(92,93) For a better understanding of the TLR modulation machinery, several research groups designed new molecular entities to decipher the mechanisms responsible for TLRs dimerization and ligand binding.(94) On the basis of a high-throughput screening on a chemical library of 24 000 compounds and by using several biophysical assays, Cheng et al. synthesized and characterized a novel class of small-molecule TLR2-ligands. One of these compounds, namely, CU-T12-9 (31), was able to facilitate TLR2/1 dimerization (with an IC50 value of 54.4 nM), thereby activating the transcription of NF-κB. This event upregulates the release of pro-inflammatory cytokines and chemokines, as well as costimulatory molecules of DCs, which are crucial for T cell activation and the subsequent challenge against pathogens.(95) The discovery of 4, together with the resolution of the crystal structure of many TLRs, has paved the way for the rational design of a new class of small molecules that might overcome the problems of lipopeptide agonists, such as high molecular weight and lipophilia, as well as problems related to drug delivery.(96) Accordingly, in a recent work, Hu et al. identified a group of TLR2 agonists characterized by a dihydropyridine–quinolone carboxamide scaffold. These compounds (31a–31c) turned out to be modulators of TLR2/TLR6 dimerization with EC50 values ranging from 1 μM to 10 μM. Moreover, extensive SAR studies demonstrated that (i) the carboxamide moiety is fundamental for their TLR2/TLR6 agonistic activity and (ii) these compounds are potentially useful as vaccine adjuvants in infectious diseases, similar to 1b. Further studies are ongoing to explore both the dihydropyridine and quinolone rings, in order to obtain new analogues with a better potency and pharmacokinetic profile.(97)
Figure 7
Figure 7. Chemical structures of TLR2, TLR4, and TLR5 modulators 28–33 discovered for the treatment of bacterial infections.
TLR3 and TLR4 in Bacterial Infections and the Role of Their Modulators
Ribes et al. reported the stimulation of TLR3 with the viral agonist poly(I:C). Treatment with different doses of poly(I:C) (0.1, 0.3, 1, 3, 10, 30, and 100 μg/mL) and 100 U/mL of IFN-γ resulted in the enhancement of primary microglia cells ability to phagocytose and kill bacteria (E. coli K1 strain) by increasing the release of cytokines/chemokines and NO in a dose-dependent manner. They also suggested that this kind of treatment could be useful for preventing brain bacterial infections in vivo.(98) Despite these good results, further investigation by other research groups uncovered some issues related to bacterial infection treatment with poly(I:C). In fact, Jackson et al. reviewed some of these reports indicating that the release of cytokines/chemokines may lead to adverse events in the host and also to the further increase in bacterial burden.(85) Collected data suggest the need for further studies in order to explore the risks/benefits ratio of using TLR3 agonists for the treatment of bacterial infections.
TLR4 has been long described as the target for Gram-negative LPS. However, it can also be activated by various bacterial proteins, which play an important role in the generation of protective immune responses, such as some bacterial proteins from Brucella abortus, Neisseria meninigitidis, Mycobacterium paratuberculosis, and Streptococcus pneumoniae. In recent years, several other ligands have been identified from both exogenous sources and the host cells. It has been demonstrated that TLR4 activation is a complex process, depending on both TLR4 association with LPS and the further noncovalent binding with MD2 on the cell surface, which activates the dimeric complex (LPS-MD2-TLR4)2.(99,100) Lipid A represents both the membrane-anchoring moiety and the biologically active (and toxic) portion of LPS. Apart from lipid A of E. coli, which is endowed with endotoxic properties, there are many natural variants of lipid A able to determine changes in pathogenesis, bacterial physiology, and bacterial interactions with the host immune system.(101) Synthetic analogues of lipid A, obtained by dephosphorylation or substitution of the sugar backbone, resulted in low-toxicity TLR4-agonists, such as 9 and AGPs, which are currently in use as vaccine adjuvants. In a recent study, Fensterheim et al. showed that the in vivo (mice) treatment with MPLA (intraperitoneal (ip) or intravenous (iv) injection of 20 μg MPLA in 0.2 mL of lactated Ringer’s solution) resulted in an increased resistance to infection by inducing a metabolic reprogramming of macrophage cells and the subsequent enhancement of pathogen clearance. This event was induced by the overexpression of MyD88- and TRIF-dependent signaling pathways, as well as the mammalian target of rapamycin (mTOR) activation.(102) The synthetic AGPs derivative CRX-547 (32, Figure 7) revealed a TRIF-selective signaling in human cells, thus resulting in a reduced release of pro-inflammatory mediators, with respect to that associated with MyD88 signaling, and reduced toxicity. The experiment was performed in macrophages (differentiated from THP-1 cells) by stimulating the cultures with 1 μM CRX-547 for 14 h; the parameters (amounts of TRIF-dependent cytokines/chemokines and TNF-α) then were evaluated.(103) The growing interest for the modulation of TLR4 as a therapeutic target for infectious diseases drove several research groups to further investigate both natural products and synthetic derivatives as TLR4 modulators in order to determine the best features for the enhancement of the immune system response of the host against pathogens. Research advances in this field have been nicely reviewed by Peri and Pascual.(39,104) Besides the above-mentioned approaches, there are other ways to modulate TLR4 signaling that will be later discussed for the treatment of bacterial sepsis.
TLR5 and TLR9 in Bacterial Infections and the Role of Their Modulators
Several mammal cells, tissues, and organs are equipped with TLR5 for the detection of flagellin. S. pneumoniae is the main causative agent of pneumonia worldwide. Flagellin isolated from S. typhimurium (1 μg in saline solution) promoted mice survival, following S. pneumoniae infections, by recruiting neutrophils, as well as the release of IL-6, CXCL-1/2/20, and TNF-α into the airways.(85) TLR5 is also abundantly expressed on the basolateral side of intestinal epithelial cells. The overexpression of TLR5 in the gastrointestinal tract is consistent with the prominent location of bacteria in this area, in order to prevent diseases associated with intestinal inflammation. However, an excessive TLR5 response to bacterial flagellin might result in the disruption of the epithelial barrier integrity and in the further exacerbation of the inflammation process. It is also known that TLR5 plays a central role in the innate immune response against uropathogenic bacteria and Legionella pneumophila.(105) Flagellin contains two to four domains (D0, D1, D2, and D3), depending on the bacterial species. D0 and D1 domains are involved in the recognition and activation of TLR5. An arginine residue on D1 domain forms a hotspot with chemical and geometrical complementarity in the leucine-rich repeat 9 (LRR9) loop of TLR5.(106) From a therapeutic point of view, recombinant flagellin proteins have been widely used in clinical trials targeting TLR5, whereas small molecules are being tested in preclinical studies in order to investigate the consequences of TLR5-flagellin complex disruption. The use of flagellin as vaccine adjuvant could represent a valid approach in the enhancement of immune responses in elderly patients.(107) In the recent years, TLR5 became an attractive target for the modulation of the immune response, because it only detects proteins. Indeed, peptides derived from flagellin could be used as TLR5 activators, while modified analogues of the latter could inhibit TLR5.(3) Nevertheless, the discovery of compounds capable of interfering with the TLR5-flagellin complex produced only a few examples, because of the difficulties in disrupting protein–protein interactions. Recently, by a high-throughput screening, Yan et al. identified two hit compounds with a common pharmacophore that were used to successfully develop a series of small molecules as novel inhibitors of flagellin binding to TLR5.(108) Further investigations led this research team to synthesize a pyrimidine triazole thioether derivative (TH1020, 33; see Figure 7) with promising activity (IC50 = 0.85 ± 0.12 μM) and selectivity. Notably, TH1020 represents a potential lead compound for the identification of novel therapeutics targeting TLR5.(108) In addition to the important role in immunoregulation, bacteria are also able to cause local and systemic inflammation. Chronic inflammation, as well as some bacteria, such as H. pylori, have been shown to promote oncogenesis. Kauppila et al. showed that TLR5 expression levels are predictors of the survival and recurrence of patients affected by oral tongue squamous carcinoma. Therefore, TLR5 may represent a key element for the treatment of bacterial infections during oral oncogenesis.(109) Further investigations are necessary to shed new light on the role of TLR5 in both sustaining immune homeostasis and the clearance of pathogenic bacteria.
The recognition of pathogens and nonself components must be efficient in order to orchestrate an appropriate response, thereby limiting excessive inflammation and the insurgence of autoimmune diseases. Indeed, the immune system evolved in order to protect the host from pathogenic insults, but the development of uncontrolled inflammation must be avoided to prevent autoimmune diseases. Accordingly, immune responses are typically downregulated during the physiological processes of tissue remodeling to accelerate the resolution phase of inflammation.(110) The TTAGGG tandem motif ((TTAGGG)n), which is present in mammalian telomeres, regulates this immunosuppression, and this effect can be mimicked by using synthetic (TTAGGG)n-ODNs.(111,112) This event culminates in the development of an innate immune response, which can be applied to limit the spread of pathogens and enhance adaptive immunity, which can be exploited to improve vaccines.(113) Taken together, these considerations make TLR9 one of the most promising targets for fighting against infectious diseases. Chuang et al. reported that several synthetic CpG-ODNs generate potent immune stimuli by inducing the production of pro-inflammatory cytokines and a TH1-dependent immune response. This mechanism increases the expression of co-stimulatory molecules in APCs and, consequently, the activation of T, B, and NK cells. The experiment was performed by treating human PBMC cultures with a 0.3 μM concentration of different CpG-ODNs. They also demonstrated that the immunostimulatory activity is closely related to the number, spacing, and position of the bases surrounding CpG-motifs, which also determine the species-specific activity.(114) CpGs pretreatment (250 nM, 4 h before infection) resulted in effectively reducing S. aureus survival in osteoblast-like SAOS-2 cells. Since S. aureus has been recognized as the causative pathogen of osteomyelitis, scientists(115) demonstrated that this beneficial effect is ascribable to the stimulation of TLR9 with CpGs and the subsequent induction of oxidative stress in the affected cells. Therefore, the treatment with ODN2216 (5′-GGGGGACGA:TCGTCGGGGGG-3′) or ODN2006 (5′-TCGTCGTTTTGTCGTTTTGTCGTT-3′) might represent a therapeutic option for the management of this disease.(115) The emergence of methicillin-resistant strains of S. aureus, because of the excessive use of multiple antibiotics, represents a serious complication that is spreading worldwide. CpG-DNAs are known to trigger the differentiation and proliferation of B cells, thereby increasing the production of antibodies. Kwon and colleagues showed that ip injection of CpG-DNA 1826 (5′-TCCATGACGTTCCTGACGTT-3′, 50 μg) determined an increased production of bacteria-reactive IgM in both peritoneal fluid and serum through the TLR9 signaling pathway. They also proved that the monoclonal IgM antibodies enhanced the phagocytosis process of murine macrophage cells against S. aureus MW2 infection.(116) Apart from the use of a single TLR ligand, an alternative approach in protecting the host against pathogen insult provides the use of multiple TLR agonists. Indeed, the combination of the TLR2/6 agonist, 1a and the TLR9 agonist, ODN2395 (5′-TCGTCGTTTTCGGCGC:GCGCCG-3′), exerted a synergistic action against both virulent Gram-positive and Gram-negative bacteria. In this experiment, cells were treated with 20 μL of a RMPI-1640 solution containing 10 μg/mL of 1a and 20 μg/mL of ODN2395. In particular, this combination guaranteed protection against some cases of bacterial pneumonia, in which the monotherapy has failed and that are characterized by a high mortality rate worldwide. Moreover, this approach could represent an effective antimicrobial strategy for the development of vaccines able to enhance mucosal T cells immune response.(117)
TLR Modulators in Sepsis
ARTICLE SECTIONS
The stimulation of TLRs signaling plays a central role in the immune response to microbial infections, but the pro-inflammatory molecules induced by the activation of these pathways may also be detrimental for the host when an excessive and generalized sepsis occurs. Sepsis is the most common cause of death in hospitalized patients. The management of sepsis primarily aims to support patients through the iv administration of fluids, vasoactive molecules, and antibiotics in order to fight the pathogen. To date, no drugs have been approved by FDA for the treatment of sepsis, and those that reached clinical trials failed to reduce mortality, thus indicating the need for further investigation. The main culprits of sepsis are Gram-positive and Gram-negative bacteria, such as S. aureus, S pneumoniae, E. coli, P. aeruginosa, and Klebsiella spp., as well as some fungal species (e.g., Candida spp.) and viruses (e.g., IAV). Sepsis is a multifactorial condition characterized by the activation of several complex molecular and cellular processes (e.g., NF-κB, TNF, IL-6, IL-12, IFNs, IL-1β, and IL-18) that generate micro- and macro-circulatory disorders involving vasodilatation (angiopoietin-2- and NO-mediated), capillary leakage and coagulopathy (caused by the release of neutrophil extracellular traps, the Von Willebrand factor, adenosine, bradykinin, and reactive oxygen species (ROS)). These events, together with inflammation, may result in a life-threatening multiorgan dysfunction syndrome. As opposed to these pro-inflammatory stimuli evolving during sepsis, other events that support immunosuppression are involved in the disease. The immune system undergoes a complete reprogramming of its cells by activating several immunosuppressive mechanisms: reduction in the number of lymphocytes, recruitment of anti-inflammatory immune cells, and the altered expression of sensors, such as human leukocyte antigen-DR isotype and programmed cell death protein 1 (PD1)/antiprogrammed dead ligand 1 (PD-L1), together with metabolic and epigenetic remodulations. Unfortunately, such compensatory mechanisms are not always enough to restore homeostasis in patients. The latest discoveries regarding the molecules subject of clinical trials for the treatment of both the hyperinflammatory and immunosuppressive phases of sepsis have been exhaustively reviewed by Roger, Peri, and Steinhagen. The most relevant clinical trials are those regarding the use of 8 and TAK-242 (34, Figure 8) for the treatment of patients with severe sepsis. 34 is a small molecule developed by Takeda that selectively blocks TLR4 signaling pathway by binding to the Cys747 residue in the intracellular domain of TLR4, thus preventing the interactions between TLR4 and its adaptor molecules MAL and TRAM. It has been evaluated in a randomized, double-blind phase II trial (NCT00143611), but it failed to suppress cytokine levels in patients with sepsis. Despite these unsatisfactory results, both compounds showed good safety and tolerability profiles and 8 was able to treat the cytokine storm; therefore, they are currently under evaluation in other clinical tests.(118−120) Causative pathogens of sepsis are endowed with ligands that trigger TLRs, especially TLR4, as the presence of LPS significantly contributes to sepsis development. Accordingly, various TLR inhibitors, from both semisynthetic and synthetic origins, have been evaluated and new modulating approaches are currently being devised. Preliminary studies conducted by Yin et al. led to the discovery of a new class of small-molecule TLR4 inhibitors as potential tools for sepsis treatment. They developed several derivatives with a β-aminoalcohol moiety able to disrupt the MD2/TLR4 complex, but characterized by a modest activity (in the micromolar range).(121) Further studies focused on the development of simplified analogues of lipid A. Among them, compound 35, bearing two phosphate groups, was effective in reducing TLR4 signaling. Its activity profile has been investigated by computational analysis and experiments on macrophages. It emerged that the activity of 35 was dependent on both the interaction with MD2/TLR4 complex and CD14 (which upregulates TLR4 signaling by binding to LPS).(122) The development of novel lipid A derivatives as TLR4 antagonists inspired the discovery of compounds 36a [IAXO101] and 36b [IAXO102], which are positively charged monosaccharide glycolipids, and 36c [IAXO-103], which is the analogue obtained by the replacement of the glucopyranoside core with an aromatic ring. Because of their inhibitory activity on TLR4, they were effective in treating acute sepsis and ALI induced by viral infections.(39) Moreover, several natural compounds endowed with anti-inflammatory activity—for instance, chalcone derivatives, naringenin (37), and sparstolonin B (SsnB, 38)—were shown to interfere with TLR2 and TLR4 pathways and to be potential therapeutic candidates for viral-induced sepsis.(123,124) An intensive SAR study allowed Katzenellenbogen et al. to accurately characterize the triaryl pyrazole scaffold for TLR inhibition.(125) Studies performed on several basic side chains and variations of the electronic profile of the aryl rings provided a better knowledge around the features needed for the inhibition of TLRs. They finally succeeded in obtaining compounds able to block the signaling of multiple TLRs simultaneously (39a–39c), as well as selective TLR7 and TLR9 inhibitors, which are involved in the pathogenesis of sepsis. The identified compounds are endowed with good potency and toxicity profiles, and could represent a valid approach for the discovery of new molecular entities to be used in the treatment of sepsis.(125) In a work by Talukdar and Ganguly, the development of selective TLR9 inhibitors was described. Their investigation on the quinazoline scaffold led to the synthesis of compounds with favorable in vitro ADME and pharmacokinetics. Noteworthy, compound 40 showed an inhibition potency lower than 50 nM and a selectivity index for TLR9 more than 600-fold greater, with respect to TLR7.(126)
Figure 8
Figure 8. Chemical structures of the TLR modulators 34–41 involved in sepsis and parasitic diseases.
TLRs Modulation for the Treatment of Malaria and Other Parasitic Diseases
ARTICLE SECTIONS
Despite the undeniable progresses in prevention, diagnosis, and therapy of malaria, it still represents a devastating disease, that kills millions of people each year in many developing countries.(127) Current knowledge about the regulatory role played by the innate immune system in malaria still remains limited. An inadequate activation of the innate immune system could theoretically promote the growth of the parasite, whereas the hyperactivation could lead to an excessive release of pro-inflammatory mediators and a consequential worsening of the disease. Therefore, TLRs have emerged as a potential target for the modulation of host immune response during malaria infection. Among human TLRs, TLR2, TLR4, TLR7, and TLR9 can detect plasmodial antigens, thus inducing an antimalarial immune response. Accordingly, many efforts have been made in order to elucidate the involvement of TLRs in severe malaria pathogenesis and of the signaling pathway involving TLRs during infection. Kalantari has recently reviewed the mechanisms by which Plasmodium components (especially glycosylphosphatidylinositol anchors, hemozoin and DNA) are recognized by the immune system, highlighting the role of TLRs in sensing these molecules.(128,129) The major issues that limited the development of an effective vaccine or chemotherapeutic agent for malaria treatment over the years are the high antigenic variability within parasite populations and the capacity of the latter to quickly develop a resistance to drugs. In order to provide an alternative approach for the development of an effective vaccine for malaria prevention, Chua and Culletton described a protocol that potentially grants protection from parasitic invasion and simultaneously stimulates the host immune system.(130) They investigated the activity of the TLR2 agonist PEG-Pam2Cys in mouse models of malaria induced by P. voelii, in both hepatocytic and erythrocytic stages. Results showed a significant decrease in the number of malaria parasites in mice liver, following sporozoites invasion. Moreover, 28 was able to completely clear parasites from the liver if administered into full-blown malaria. Further investigation also showed a reduction in the number of infective mosquitoes, following their blood feeding on gametocytaemic mice, thus indicating that this TLR2 agonist could be used for both treating the liver stage of malaria and for the prevention of malaria itself.(130) Further attempts to exploit TLR agonists as potential antimalarial vaccine adjuvants have been recently reviewed by Salunke and Coban.(131,132) The recent advances in malaria vaccines formulations involved the incorporation of TLR2 agonists (Pam2Cys and Pam3Cys), TLR3 agonists (poly(IC:LC)), TLR4 agonists (3-O-deacylated-MPLA (3D-MPLA) and GLA), TLR5 agonists (flagellin), TLR7/8 agonists (imiquimod), and TLR9 agonists (CpG-ODNs). Among these, one of the most important examples is represented by the TLR4 agonist 3D-MPLA (41, Figure 8). Indeed, it has been employed as an adjuvant in the production of the experimental RTS,S/AS01 malaria vaccine (Mosquirix) by GlaxoSmithKline. Since February 2019, it has been undergoing clinical evaluation to investigate its safety profile in Ghana, Kenya, and Malawi (NCT03806465).(131,132) Besides being used as vaccine adjuvants, TLR ligands hold another potential application as mitigating agents for the inflammatory profile related to the disease. Therefore, considering the involvement of multiple TLRs in the recognition of plasmodial components, it is conceivable that the pan-TLR inhibitors developed by Pollock et al. could represent an alternative approach for the management of malaria.(125) Other parasitic diseases, such as trypanosomiasis, leishmaniasis, and schistosomiasis, represent a huge socioeconomic burden and leading causes of death, in endemic areas.(133,134) To date, no vaccine has been approved for the prevention of these major problems, thus indicating the need for a better understanding of the pathogenesis of such diseases and even more of the mechanism by which the host immune system recognizes and faces the parasites.(135) Nowadays, research efforts led to the identifications of the PAMPs recognized by host immune system and the pathways involved in the inflammation and resolution processes (reviewed by Babu et al.).(136) Unfortunately, the application of TLR agonists/antagonists led to few or unsatisfactory results in parasites clearance. On the other hand, the use of TLR ligands resulted in the enhancement of the efficacy of experimental vaccines,(137) thus underlying, once again, the pivotal role played by TLRs in driving the immune system in the fight against micro-organisms.
TLRs Modulation for the Treatment of Fungal Infections
ARTICLE SECTIONS
Fungal pathogens have been less extensively studied, compared to viruses in relation to TLRs. Nevertheless, some TLRs seem to be involved in fungal infections, especially by Candida spp., Cryptococcus neoformans, and Aspergillus fumigatus, which cause life-threatening diseases. Indeed, heterodimers of TLR2 with TLR1 and TLR6 are associated with the recognition of widespread fungal PAMPs, such as β-glucans, and other species-specific molecules, e.g., phospholipomannans of Candida albicans and glucuronoxylomannan (GXM) of Cryptococcus neoformans. Nevertheless, other evidence suggest a dual role for TLR2 signaling in Candida spp., since the pattern of ILs expressed by TLR2-deficient mice is associated with an increased resistance to the infection.(25)Aspergillus fumigatus, in both the conidia and hyphae forms, is able to stimulate TLR2 signaling, although the mechanism and the related PAMPs are still unclear.(138) Interestingly, an increased susceptibility to A. fumigatus infection has been related to SNPs in TLR1 and TLR6.(31,139) Only a few reports suggest a role for TLR3 in the detection of fungal PAMPs, but it is confirmed that A. fumigatus dsRNA from conidia is sensed by this PRR in lung epithelial cells.(138) TLR4 also is stimulated by fungal PAMPs, such as C. albicans O-linked mannosyl chains present in the cell walls or C. neoformans GXM; moreover, A. fumigatus conidia are able to present yet unknown ligands to activate TLR4 signaling.(138,139) Interestingly, only TLR7, but not TLR8, seems to be involved in the immune response against fungal pathogens, since murine bone-marrow DCs detect Candida spp. and other fungal ssRNA through this receptor.(138,139) Moreover, since unmethylated CpG motifs can be found also in genome DNA of several fungal species, A. fumigatus and C. neoformans among the others, also TLR9 may play a role in the recognition of fungal pathogens.(138) To further support the antifungal role of this receptor, recent studies showed the importance of two SNPs, namely, 1237C/T and P99L, in promoting susceptibility to pulmonary aspergillosis.(31)
Currently, only a few compounds have been developed to fight fungal infections, and the majority of them are synthetic small molecules originally identified with other purposes. It has been shown that prolonged exposure of C57BL/6 mice to 1b protects the kidneys and spleen from C. albicans invasion during systemic infection.(140) Moreover, 1b promoted a marked increase of intracellularly killed C. neoformans in microglial cells, compared to control cells, thus suggesting TLR2 agonists as potential candidates for the prevention and treatment of CNS infections caused by C. neoformans.(141) To the best of our knowledge, no TLR ligands have been specifically developed to fight fungal infections. Indubitably, further studies are needed to better elucidate the antifungal potential of TLR modulation, thus prompting a way for the design of compounds to be able to address this unmet medical need.
TLRs and Inflammation
ARTICLE SECTIONS
Inflammation has been established as a pivotal issue in several pathological conditions, such as sepsis, cancer, and diabetes. Since TLRs are widely expressed in endothelial cells (ECs), they can influence the pathogenesis and outcomes of certain inflammatory disorders where these cells are involved. The TLR signaling pathways behave differently upon stimulation from monocytes or macrophages. Following TLR stimulation, ECs secrete IFN-β, IL-1α, IL-6, IL-10, IL-28, IL-29, granulocyte-colony stimulating factor (G-CSF), and granulocyte macrophage colony stimulating factor (GM-CSF) as major cytokines; meanwhile, leukocytes secrete G-CSF, IL-1α, IL-1β, IL-2, IL-6, IL-9, IL-10, IL-12 (p35, p40, p70), IL-13, IL-15, IFN-α, IFN-β, IFN-γ, transforming growth factor-β1 (TGF-β1), and TNF-α. TLR3 is highly expressed in ECs and involved in the secretion of embryonic alkaline phosphatase after treatment with the agonist poly(I:C).(142) Overactivation of TLR4 signaling upon pathogen- or host-derived PAMPs and DAMPs is strongly associated with the insurgence of a wide variety of inflammation-related diseases, such as septic shock, acute lung injury (ALI), asthma, chronic obstructive pulmonary disease (COPD), airway epithelium inflammation, liver failure, bowel chronic inflammations, allergies, and others.(25,123,143) TLR7 and TLR8 have been recognized as IFN-α inducers and they are expressed in myeloid DCs, monocytes, and monocyte-derived DCs; they evoke distinct cytokine responses, depending on the involved tissue. In particular, TLR7 has been validated as a potential target in asthma management.(144) These considerations demonstrated that TLR modulators represent a promising strategy to treat inflammation. Recently, starting from a computational approach, several TLR ligands have been discovered and assayed under inflammatory conditions.(94) In the context of allergies and asthma, an inappropriate TH2 T-cell response to environmental antigens is usually observed. The functions and cell development of TH2 can be compensated by cytokines released from TH1 T cells, thus modulating these inflammatory conditions. In this context, TLR4 and 9 agonists (monophosphoryl lipids, and CpG-ODN) resulted as a strong inducer of TH1 response and have been evaluated as potential agents against allergic rhinitis. Moreover, TLR7/8 agonists (including imidazoquinolines) showed efficacy in animal model against allergic asthma, by switching the cytokine profile from TH2 to TH1.(2,8)
TLR2/1, TLR2/6, and TLR3 Modulators against Inflammatory Disorders
One of the most studied antagonists of TLR2 heterodimers was CU-CPT22 (42; see Figure 9). Discovered in 2012, it prevents the inflammatory cascade by disrupting both TLR2/TLR1 and TLR2/TLR6 heterodimers. Furthermore, the natural polyphenolic compound phloretin (43) significantly inhibited 1b-induced TLR2/1 signaling in RAW264.7 cells, by blocking NF-κB-p65 expression, with a consequent reduction in the secretion of TNF-α and IL-8.(145) SMU-8c (44), which is a gallic acid derivative, exhibited the most potent anti-inflammatory profile in RAW264.7 macrophages, with an IC50 value of 22.5 ± 2.6 μM. It inhibited the formation of TLR1/TLR2 and TLR2/TLR6 heterodimers and downregulated the expression of nitric oxide (NO) and TNF-α. In the monocytic inflammatory MUTZ-3-cell model, in which inflammation is mediated by TLR2–TLR4 signaling, soyasaponin I (45) suppressed pro-inflammatory cytokine and chemokine secretions in a dose-dependent manner (5–100 μg/mL), by influencing both TLR2 and TLR4 activity.(146)
Figure 9
Figure 9. Chemical structures of TLR2/1, TLR2/6 and TLR3 modulators 42–46 involved in inflammatory diseases.
Oleanolic acid acetate (OAA, 46), a triterpenoid compound extracted from Vigna angulariz, was able to downregulate the expression of poly(I:C)-induced pro-inflammatory cytokines and chemokines genes, such as monocyte chemotactic protein-1 (MCP-1), IL-1β, IL-8, vascular cell adhesion molecule-1 (VCAM-1), and intracellular adhesion molecule-1 (ICAM-1). OAA behaved as an TLR3 antagonist, limiting the activation of NF-κB/MAPK/IKKα/β signaling pathway in monocyte THP1-XBlue cells.(147)
TLR4 Antagonists to Treat Inflammatory Disorders
The main examples of TLR4 antagonists are 8 and 34; indeed, the latter compound has recently been proposed as a potential therapeutic candidate for the treatment of liver failure-induced systemic inflammation, of post-hemorrhagic brain edema and BBB disruption.(143,148) Moreover, the interest for 34 prodrugs is increasing due to their potential to be delivered to a specific target, as in the case of pancreatic islets, in order to protect them from inflammatory response during transplantation.(149) Extensive SAR studies of LPS or lipid A derivatives led to the discovery of new agonists and antagonists endowed with better pharmacokinetic and therapeutic profiles. CRX-526 (47, Figure 10), an AGP showed beneficial effects on colonic inflammation in mice models.(104) The diphosphorylated diacylated monosaccharide 14 was proposed to treat ALI and sterile inflammation disesases.(150) RS-LPS, an under-acylated form of Rhodobacter sphaeroides LPS, was shown to improve asthma symptoms by reducing the release of pro-inflammatory cytokines.(25) Beside TAK-242, several other compounds unrelated to LPS have been designed in order to treat sterile inflammation and related pathologies: AV411 (48), T5342126 (49), and NCI 126224 (50) are three small molecules potentially able to treat a wide variety of inflammatory diseases, including chronic fatigue syndrome and RA.(21) Two DNA aptamers, called ApTLR#1R and ApTLR#4F, and their corresponding optimized forms (ApTLR#1RT and ApTLR#4FT), were identified through a computational screening as selective TLR4 antagonist in HEK-Blue-hTLR4 cells showing the maximal inhibition at 20 nM. Moreover, it was shown that at least ApTLR#4F and ApTLR#4FT ameliorated stroke symptoms in different animal models, thus suggesting them as potential candidates for the treatment of diseases, which are worsened by TLR4-dependent signaling.(151) In 2015, Flacher and co-workers assessed the anti-inflammatory activity of two mannoside glycolipid conjugates (MGCs), 51a and 51b with promising anti-inflammatory and lung protective effects mediated by TLR4 inhibition.(152) Interestingly, several natural compounds already known for their anti-inflammatory properties have been suggested to act, at least in part, through the inhibition of TLR4 signaling. Many examples from a wide variety of natural sources have been reviewed by others.(39,123) Lu et al. reported an interesting anti-inflammatory activity for the water and methanolic extracts of the mushroom Cordyceps cicadae and demonstrated that its components, namely, adenosine, cordycepin (3′-deoxyadenosine) and N6-(2-hydroxyethyl)-adenosine (HEA, 52a–52c, respectively), inhibited the LPS-induced expression of TNF-α and prostaglandin E2 (PGE2) in RAW264.7 macrophages at 2.5, 1, and 5 μg/mL, respectively. Moreover, HEA was shown to reduce the expression of TLR4 and to decrease NF-κB translocation to the nucleus, thus downregulating the production of several pro-inflammatory proteins.(153) Similarly, parthenolide (53), which is a sesquiterpene lactone extracted from the herb Tanacetum parthenium, abolished in a dose-dependent matter the LPS-induced upregulation of pro-inflammatory cytokines and NO in THP-1 cells (human monocytic cells). Flow cytometry assays proved the ability of this compound to inhibit TLR4 expression (IC50 = 1.4 μM), thus suggesting that the anti-inflammatory activity of 53 could be exerted through the modulation of this pathway.(154) In 2019, Ye et al. reported that chlojaponilactone B (54), which is a sesquiterpenoid extracted from Chloranthus japonicum, was able to reduce the LPS-induced production of several cytokines and inflammation-related enzymes through the suppression of NF-κB, similarly to 34. Moreover, docking studies suggested the possibility for this natural compound to bind TLR4 in the same pocket as TAK-242.(155) In the same year, another traditional Chinese medicinal herb, namely, Salvia miltiorrhiza, was investigated for its anti-inflammatory properties. It was found that one component, diethyl blechnic ester (55), showed no toxicity on RAW264.7 cells, and exerted an anti-inflammatory activity by inhibiting the LPS-induced expression of inducible nitric oxide synthase (iNOS), cyclooxygenase 2 (COX2), and several cytokines by disrupting NF-κB translocation to the nucleus and TLR4/MyD88 pathway.(156) Further in vitro studies elucidated the positive effects of soya phosphatidylcholines (PCs) in asthma models of mice sensitized with ovalbumin and treated with LPS. Moreover, soya PCs reduced the symptoms of asthma in a comparable manner as dexamethasone, without influencing glucose serum levels.(157) The marine environment provided the indole alkaloid hypaphorine (56), which was shown to inhibit the production of pro-inflammatory cytokines upon LPS treatment of HMEC-1 cells (human microvascular ECs line-1) through the suppression of TLR4 signaling both at protein and mRNA levels.(158) Interestingly, some bacterial cell wall components have been shown to exert anti-inflammatory activity through TLR4 signaling blockade. Indeed, LPS from the Gram negative bacterium Bartonella quintana abolished, for a prolonged time, the production of pro-inflammatory cytokines in human peripheral blood mononuclear cells (PBMCs) upon treatment with E. coli LPS.(159) Natural compounds have also been studied in the discovery of novel derivatives with improved properties. For instance, Shih et al. designed a series of halo-substituted chalcones and azachalcones (57a, 57b), which represent the most promising analogues able to improve the cytokine expression pattern in macrophages upon LPS treatment, thus making them promising anti-inflammatory nutraceuticals.(160) At the same time, 38 showed potent anti-inflammatory and antiviral activities, thus driving the research toward the design of novel derivatives with improved properties.(161) Some TLR4 agonists, such as 9, poly-γ-glutamic acid (58), and ER803022 (59), have been proposed as potential candidates for the treatment of inflammatory diseases such as asthma and allergies.(162)
Figure 10
Figure 10. Chemical structures of TLR4 modulators 47–59 studied against inflammation.
Inflammatory Disorders and Effect of TLR7 and TLR8 Modulators
8-Oxoadenine derivatives bearing saturated oxygen or nitrogen heterocycles at the N-9 position demonstrated good efficacy in inducing IFN-α. This observation triggered the development of GSK2245035 (60, Figure 11) as intranasal formulation. This molecule was able to activate TLR7 with a pEC50 value of 5.7 μM. Furthermore, it suppressed TH2-mediated cytokine responses to allergens.(163) From a SAR study on imidazoquinolines, compound 61 demonstrated a selective TLR7 agonism and negligible activity on TLR8. The compound showed IFN-α induction in human PBMCs and minimal pro-inflammatory cytokine production.(164)
Figure 11
Figure 11. Chemical structures of TLR7 and TLR8 modulators 60–64 studied against inflammation.
Nitrogen-derived compounds have been fully investigated in the field of TLRs and demonstrated a particular efficacy as TLR8 selective agonists. Indeed, 1-pentyl-4-phenyl-1H-imidazol-2-amine turned out to be a suitable scaffold for the development of TLR8 agonist. In particular, compound 62 showed an EC50 value of 2.48 μM and attenuated the secretion of inflammatory cytokines in ex vivo human blood models.(165) Subsequently, a multiplexed high-throughput screening led to the identification of N4-butyl-5-iodo-6-methylpyrimidine-2,4-diamine as a new scaffold for TLR8 agonists development. The best EC50 value (0.30 μM) has been obtained with compound 63, which potently induced T helper 1 (TH1)-biasing IFN-γ and IL-12 in human blood, together with lower levels of the pro-inflammatory cytokines IL-1β, IL-6, and IL-8.(166) Recently, a series of triazole-based antagonists has been synthesized to specifically interfere with TLR8 homodimerization. The best compound TH1027 (64, IC50 = 30 nM) presents a switched substitution of the 3,4,5-tri-Cl in the aromatic core, which determined an increased inhibitory activity. This SAR studies conducted on 64 suggested that this compound may interact better with the hydrophobic pocket, located between the two TLR8 monomers, thereby preventing TLR8 activation.(167)
The Role of TLRs in Cancer
ARTICLE SECTIONS
Chemotherapy and molecular targeted therapy represent the mainstay for cancer treatment; however, in the last decades, immunological therapies have shown invaluable potential as antitumor strategies. The main role of cancer immunotherapy consists of stimulating the host immune system to fight and kill cancerous cells. Among the large number of targets studied to date (such as stimulator of interferon genes, chemokine receptor etc.), TLR modulators proved a pivotal role in this field.(168) In fact, the TLR7 agonist 15 has been approved by FDA for the treatment of superficial basal cell carcinoma, while many other TLR modulators are currently under evaluation in several clinical trials in patients with various tumor conditions.(3)
Recent studies have uncovered a double-edged sword role for the involvement of TLRs in cancer.(169) In particular, based on type of cancer cell and tissues involved, TLR activation can either lead to tumor regression or the promotion of cancer cell growth. TLR2 and TLR3 activation leads to a greater cytotoxicity of CD8+ T lymphocytes or to the stimulation of NK cells. Moreover, TLR7/8 activation can induce caspase-mediated apoptosis in cancer cells. Furthermore, 15 demonstrated the ability to inhibit angiogenesis in the tumor microenvironment. An increased number of CD8+ T lymphocytes and M1 macrophages has also been observed in a neuroblastoma model, following TLR9 activation by CpG-ODN, thus determining a decrease in tumor proliferation and the activation of the apoptotic cascade. Nevertheless, we should consider that cancer patients are usually treated with classic chemotherapeutic agents, which determine immunosuppression, making it harder to induce a positive immune response by TLR modulation that could result in an effect strong enough to reduce tumors. These factors may explain and justify the failure of many clinical trials with TLR agonists.(170)
On the other hand, chronic inflammation can promote carcinogenesis in a TLR-dependent manner. For example, an increased release of NF-κB, mediated by TLRs, promotes the upregulation of inflammatory cytokines such as in IL-1β, IL-6, and TNF-α. These cytokines are pro-carcinogenic in liver, skin, intestine, and stomach tissues. Moreover, NF-κB is believed to be one of the most important antiapoptotic modulators, which can be activated by both MyD88-dependent and MyD88-independet mechanisms. TLR7-expressing cancer cells showed high levels of Bcl-2 (an antiapoptotic factor). In pancreatic cancer cells, an overexpression of TLR7 and TLR8 was recently observed. TLR4 inhibition in xenograft mice with colon cancer determined a reduced tumor growth. Furthermore, the overexpression of TLR3, TLR5, and TLR9 have been associated with the progression of colon, cervical, and prostatic cancers.(1,171)
To date, many clinical trials have been performed to study the newly developed TLR modulators in cancer patients. The beneficial properties of these compounds were investigated alone, in combination with chemotherapeutics and/or as vaccine adjuvants. In particular, 15 has been tested against many different cancers such as breast, melanoma, actinic keratosis, and basal cell carcinoma.(3,171) Other imidazoquinolines acting as TLR7/8 agonists under clinical investigation are 852A (65, Figure 12), 16, Telratolimod (66), and Motolimod (67). 65 has been evaluated in two phase II trials (NCT00276159 and NCT00319748) in patients with breast, ovarian, endometrial, and cervical cancers and different types of leukemia. 16 is currently under phase II clinical trials for the treatment of colorectal cancer, glioma, astrocytoma, melanoma, and other tumors (NCT00960752, NCT01204684, and NCT00960752). The imidazoquinoline derivative 66, which acts as a TLR7/8 agonist, was evaluated in a phase I clinical trial (NCT02556463) for solid tumors and cutaneous T cell lymphoma in association with the monoclonal antibody durvalumab. 67 is currently under phase I and II clinical trials in patients with ovarian, head, and neck carcinoma (NCT02431559 and NCT03906526). Together with TLR7/8 agonists tested for cancer treatment, lipoproteins such as CBLB612 (a TLR2 agonist) and the IgG monoclonal antibody against TLR2, such as OPN-305, have been recently evaluated in phase II clinical trials in patients affected by breast cancer, myelodysplastic syndrome and pancreatic cancer (NCT02363491, NCT03337451 and NCT02778763). The TLR3 agonist poly(IC:LC) has been widely used in clinical trials as vaccines adjuvants against many cancer types including B-cell lymphoma, melanoma, brain tumors and head and neck squamous cell carcinoma (NCT01976585, NCT01079741, NCT01204684 and NCT02643303). Lipid VI-A and derivatives such as GLA (68) and 9 are TLR4 modulators that were widely used in anticancer clinical trials. Accordingly, the TLR4 agonist 68 was investigated as a vaccine adjuvant in phase I trials in patients affected by skin melanoma or sarcoma (NCT02320305 and NCT02180698). The recombinant flagellin proteins Entolimod and Mobilan are TLR5 agonists that have been tested as adjuvants in clinical trials with patients affected by prostate cancer and other solid tumors (NCT02654938 and NCT01527136). Numerous CpG-ODN, acting as TLR9 modulators (such as SD-101, GNKG168, CpG 10104, etc.), have been evaluated in patients with esophageal cancer, leukemias, squamous cell carcinoma of head and neck, etc. (NCT00669292, NCT01040832 and NCT01743807).(3,170)
Figure 12
Figure 12. Chemical structures of some of the most-relevant TLR modulators 65–68 investigated in clinical trials against cancer.
The interest in developing new TLR ligands for cancer treatment has increased in the last years, leading to the generation of different classes of modulators that will be discussed in the following sections, divided by TLR class.
TLR2/TLR1 and TLR2/TLR6 Modulators as Anticancer Agents
Compounds 1a and 1b were able to prolong the survival of patients with inoperable pancreatic cancer.(172) Many efforts have been conducted in the past decade for developing new lipoproteins as vaccine adjuvants, comprising of novel PamCSK4 derivatives or conjugated molecules. Ingale et al. described the synthesis of a self-adjuvanting vaccine (69; see Figure 13) composed by a tumor-associated MUC-1 glycopeptide B-epitope (a T-cell-epitope) and a TLR2 ligand (2) and its investigation as a potential pharmacological tool in anticancer therapy. This compound stimulated the production of TNF-α, and, in mice (3 μg), it prompted the release of high titers of IgG antibodies able to recognize the MUC-1 glycopeptide that is usually overexpressed on MCF-7 cells (breast cancer).(173) Successively, the same research group investigated the role of different classes of TLR agonists implemented in the structure of this self-adjuvanting vaccine. In particular, by replacing the TLR2 (Pam3CysSK4) inducer with a TLR9 (CpG-ODN 1826) agonist, the authors reported a reduced antigenic cellular response when compared to the TLR2-MUC-1 compound.(174) Shi et al. investigated the structural features of a MUC-1-glycopeptide carrying a Pam3CysSK4 portion. They evaluated the roles of (i) the configuration of the chiral center of the glycerol moiety, (ii) the glycosylation site on the MUC-1, and (iii) the antigen bound to the MUC-1 tandem repeat. No significant difference was observed in immune response induced by the two epimers, while modification of the glycosylation site and the different antigen bound to MUC-1 generated significant differences in antibody titers. The best bioconjugated molecule possesses a sialyl-N-acetyl-d-galactosamine alpha-O-threonine (STn) antigen on Thr9 of the MUC-1 tandem repeat sequence (70).(175)
Figure 13
Figure 13. Chemical structures of Pam3CysSK4-MUC-1 conjugated 69–71 and UPam derivatives 72a–72e.
In 2014, new Pam3CysSK4 derivatives were developed by using the co-crystal structure of TLR2/TLR1 heterodimer in complex with the original ligand. The new compounds, named UPams (72a–72e), bear an ureidic N-tetradecylcarbamyl moiety, which replaces one of the original N-palmitoyl chains of Pam3CysSK4, and several natural and non-natural amino acids to replace the original serine. The best compounds, at low concentration values (ranging from 3 nM to 30 nM), exhibited a marked increase in immunostimulatory activity, which was measured as the production of IL-12p40, that is strictly correlated with DC maturation. The enhanced activity is linked to the improved affinity of the ligand for the receptor, determined by an additional hydrogen bond with the TLR1 monomer.(176) Successively, one of the best compounds of the series, namely, Amplivant (72a), was further subjected to other biological studies to assess its anticancer properties. Therefore, in 2018, the authors evaluated in in vivo studies the antitumoral properties of 72a, in conjugation and not with synthetic long peptides (SLPs). It emerged that SLPs conjugated to Amplivant (5 nmol in 50 μL) stimulated DCs maturation, T cells priming, calculated as the amount of IFN-γ, TNF-α, IL-12, and other factors related to antitumor immunity. Note that 72a in solution with the SLPs determined a reduced induction of these indicators; also, the replacement of Amplivant with Pam3CSK4 further determined a lower response to the treatment. Modulation of the macrophage population in a tumor microenvironment was observed; 72a in combination with cisplatin or photodynamic therapy determined a synergic action in TC-1 mice (lung cancer).(177)
Novel potential TLR2 agonists as adjuvants for cancer vaccines have been described by Lu et al. The authors reported that homologated versions of the Pam2Cys molecules have a similar potency, with respect to the original TLR2 agonist. The Pam2CSK4 unit was linked to the SLLMWITQV linear peptide sequence (NY-ESO-1 epitope), which is known to stimulate CD8+ T cells in cancer models. The best compounds of this new series (73a–73d, EC50 range from 0.28 nM to 0.38 nM; see Figure 14) have the glycerol moiety in R configuration and a length of the homologated chain varying from one to four carbons. In addition, the authors observed that the N-acetylation of the Cys did not reduce the activity of the molecules. Huynh et al. developed 13 new TLR2 agonists and identified 74a as the most potent with an EC50 value of 20 nM and a binding affinity of 25 nM. This compound was also able to stimulate the immune system in vivo (generation of antigen-specific CD8+ T cells) suggesting this product as a valid immune adjuvant to be applied in cancer immunotherapy. Successively, 74a was conjugated with near-infrared (NIR) fluorescent dye obtaining compound 74b, which showed EC50 and Ki values of 34 and 11 nM, respectively. This product was employed as a probe to detect the selectivity of the ligand for TLR2 in xenograft mice bearing pancreatic cancer. By using this assay, compound 74b revealed a high selectivity for pancreatic cancer cells.(178)
Figure 14
Figure 14. Chemical structures of the homologated Pam2CysSK4–NY-ESO-1 73a–73d and of the Pam2Cys derivative 74a and 74b.
Yamamoto et al. developed a new trehalose 6,6′-dimycolates (TDMs)-based compound named Vizantin (75; see Figure 15). TDMs are known as inducers of the innate immune response through TLR2 and possess potent antitumor activity in in vivo models.(179) The anticancer properties of 75 were evaluated in an in vivo mouse model; 75 stimulated cytokine production and the macrophages phagocytic activity against cancer tissues at a concentration of 50 μM.(180) In 2018, two molecules—namely, diprovocim-1 and diprovocim-2—were reported as potent TLR2/TLR1 agonists. Noteworthy, these compounds do not share structure similarity with any other reported synthetic or natural TLR agonists. The most potent compound (76) possessed a high affinity for TLR1/2 (EC50 of 110 pM) in human THP-1 cells supplemented by a strong TNF-α release. Preliminary studies conducted in mice, using 76 (10 mg/kg) as a vaccine adjuvant, showed a systemic protection against melanoma; moreover, in conjugation with the immune checkpoint inhibitor anti-PD-L1, it completely inhibited tumor growth. Long-term anticancer memory was induced, thus prolonging the survival of tumor-bearing mice.(181−183) SMU-Z1 (77) is a TLR2/TLR1 agonist possessing an EC50 value of 4.88 nM, which was discovered from a screening performed on a library of more than 14 000 compounds. Imidazole 77 was found to promote the release of NF-κB, TNF-α, IL-1β, and other cytokines in several cell lines in a dose-dependent manner. 77 also determined a higher expression of CD8+ T, NK and DCs cells were observed in murine leukemia model, thus providing a significant antitumor effect. Indeed, a strong reduction of tumoral mass was observed after the treatment of leukemia xenograft mice with 77 (0.3 mg).(184) By the application of virtual screening techniques using ∼10.5 million of compounds, the TLR2/TLR1 agonist SMU127 (78) was discovered. When tested, it showed an EC50 value of 550 nM and it stimulated TNF-α and NF-κB release in human macrophages and mononuclear cells. A strong tumor immunizing effect against breast cancer in vivo was observed after ip administration of 78 (0.1 mg) in mice.(185) In 2003, the proapoptotic properties of two polyphenols (purpurogallin and gossypol) targeting Bcl-2 proteins in leukemia cells were discovered.(186) Successively, it was demonstrated that purpurogallin (79) was able to inhibit TLR1/TLR2 activation by 70% at 3.0 μM in RAW 264.7 (macrophages) cells. Starting from this molecule, a SAR study was performed by Cheng et al. to improve the potency of the hit compound. Among the 26 newly developed compounds, 42 resulted as the best TLR1/TLR2 inhibitor of the series, showing an IC50 value of 0.58 μM. Further studies demonstrated that 42 was able to compete with 1b to bind the heterodimer with a Ki of 0.41 μM. A dose-dependent reduction of IL-1β and TNF-α release was observed after the treatment of RAW264.7 cells with 1b and increasing doses of 42, thus confirming its anti-TLR2/TLR1 activity.(187)
Figure 15
Figure 15. Chemical structures of TLR1/2 modulators 75–79 as anticancer agents.
TLR3 Modulators as Anticancer Agents
Until now, the best TLR3 modulators investigated under several pathological conditions, other than cancer, are dsRNA analogues (1.5–8 kbp). For example, poly(I:C) was able to activate NK cells, to release DC and CD8+ T lymphocytes and to activate anticarcinogenic processes (apoptosis and necroptosis) in mice models.(1) However, in clinical trials, it revealed an insufficient stability of this molecule under physiological conditions, resulting in a rapid metabolic inactivation and, consequently, poor anticancer activity.(171) BM-06, which is another dsRNA acting as a TLR3 agonist, was able to decrease tumor growth and cell proliferation by inducing apoptosis. It also showed a higher anticancer effect against rat hepatocellular cell carcinoma than poly(I:C).(188) When used as a vaccine adjuvant, poly(IC:LC) demonstrated a high potency in in vivo assays; therefore, it has been evaluated in several clinical trials. Poly(I:C12U) has been evaluated as a vaccine adjuvant in cancer therapy and, to date, 13 Phase I/II clinical trials are ongoing in patients with different tumors.(171) IPH-3102 is another TLR3 agonist that is able to activate a NF-κB signaling pathway in in vitro studies and to induce type I-IFN responses, thus exerting a cytotoxic activity against breast cancer cells. It has been reported to behave as a strong immunostimulatory agent in mice.(189) A DNA-capped dsRNA modulator has been recently evaluated as a vaccine candidate in cancer therapy. The structure of this molecule, named ARNAX, includes 120–140 bp dsRNA, derived from the measles virus vaccine strain, linked to a GpC-type phosphorothioated oligodeoxynucleotide at the 5′-site. Studies in murine models revealed the ability of ARNAX, combined with tumor-associated antigen (TAA), to induce the generation of tumor-specific cytotoxic T lymphocytes (CTLs) that determined the reduction of the tumoral mass. Moreover, in the murine model, the association of ARNAX+TAA with anti-PD-1/PD-L1 antibodies induced tumor-specific memory CD8+ T cells and a strong anticancer effect, higher than that observed with ARNAX+TAA alone.(190,191)
TLR4 Modulators as Anticancer Agents
The best TLR4 modulators are LPSs, which are usually derivatives of lipid A. In a very exhaustive review by Peri and Calabrese, the structures and the activities of these compounds were nicely described, along with other small molecules reported up to 2013.(39) In addition, the performed and ongoing clinical trials on these compounds have been reviewed by Anwar et al.(3) Therefore, in this section, we will describe only the latest discovery on TLR4 modulators endowed with endowed with anticancer activity.
CXC195 (80, Figure 16) showed a significant antiproliferative effect in LPS-induced human hepatocellular carcinoma cells. In HepG2 cells, 80 suppressed the release of pro-inflammatory cytokines such as TNF-α, IL-1β, IL-6, etc., through the inhibition of TLR4 pathway and TLR4 downregulation.(192) Atractylenolide 1 (81) is a natural sesquiterpene lactone capable of downregulating the expression of TLR4 and MyD88/NF-κB in ovarian cancer. This event is accompanied by the secretion of cytokines by EOC SKOV3 cells, thus reverting EOC cell-mediated immunosuppression, following the activation of T lymphocytes.(193) The TLR4 inhibitor 34 has been recently reinvestigated as an antitumoral agent. It induced a cytotoxic effect against ovarian and breast cancer cell lines (the best results were obtained with SKOV3 and 2008C13 cell lines) with IC50 values in the μM range. A strong correlation between TLR4/MyD88 expression and anticancer cell response was observed: the higher the expression, the lower the IC50 value. Furthermore, 34 decreased the invasive properties of these tumors in other tissues. The properties of this compound were also investigated in association with other FDA-approved drugs (cisplatin and paclitaxel). This study revealed an increased sensitivity of both ovarian and breast cancer cells to the two drugs when combined with 34, thus confirming that TLR4 overexpression on cancer cells may contribute to chemoresistance. This validates TLR4 inhibitors as valuable tools in combination with other drugs for cancer therapy. Kashani et al. investigated 34 against ovarian cancer in combination with LPS. The activation of TLR4 by LPS resulted in an enhanced proliferation and invasive properties of the tumor cells, which were reverted upon the co-administration of TAK-242. Moreover, disruption of the cell cycle and the induction of apoptosis were observed after treatment with 34. The combination of this molecule with doxorubicin increased the antitumoral activity of this latter compound.(194−196) Triptolide (82) is a diterpenoid epoxide that was able to reduce the TLR4/NF-κB signaling in vitro.(197) The antitumoral activity of 82, in combination with gemcitabine (GEM), against LPS-activated PANC-1 cells (pancreatic cancer) in xenografts mice was investigated by Ma et al. The reduction of TLR4/NF-κB signaling by 82 (0.4 mg/kg in mice) reversed the low sensitivity of LPS-activated PANC-1 cells to GEM (25 mg/kg), resulting in induction of apoptosis and a significant reduction in tumor volume.(198) The activity of paeonol (83) against osteosarcoma was evaluated in a work by Zhou et al. This compound proved to have the ability to inhibit the activation of TLR4/MAPK/NF-κB pathway and block the proliferation of several cancer cells. The administration of 83 in osteosarcoma cells resulted in cell proliferation suppression by inducing apoptosis in a dose-dependent manner. Moreover, 83 was able to block the invasive and migratory properties of cancer cells. From in vivo studies, it emerged that paeonol (200 mg/kg) was able to decelerate the growth of the tumor growth and reduce TLR4 expression in mice.(199)
Figure 16
Figure 16. Chemical structures of TLR4 modulators 80–85 investigated as anticancer agents.
Three molecules—namely, diaporine (84), sophoridine (85), and a polysaccharide extracted from Strongylocentrotus nudus eggs—were able to exert an anticancer action by activating the TLR4 pathway. This profile is consistent with the previously explained double-edged sword role that TLRs may play in tumoral cells, which are mostly dependent on the type of cancer and on the expression of TLRs on the tumoral cells. The investigation of the antiproliferative properties of 84 were discussed in a work by Ge et al. In breast cancer xenograft-mice, 84 (0.2 mg/kg) determined the switch of the phenotype of tumor-associated macrophages (TAMs) from M2 to M1 by triggering the TLR4-MAPK pathway. M1 are the macrophages involved in the activation of TH1 cells, which are responsible for killing pathogens and tumors.(200)85 is a quinolizidine with a recognized antitumoral activity against different cancers. In gastric cancer, it induced the TLR4/IRF3 pathway determining an increased polarization of TAMs to M1, thus suppressing M2 generation. The release of iNOS, IFN-β, and IL-12α was upregulated, while Arg1, CD206, and IL-10 were downregulated. The M1 polarization determined CD8+ T cells proliferation and an increased cytotoxic activity that were promoted by these cells.(201) The activity against pancreatic and other cancer cells of a polysaccharide extracted from Strongylocentrotus nudus eggs was evaluated in a work by Xie et al., and a reduced proliferation was observed after the treatment with this product. This event was correlated to an increased number of CD4+ and CD8+ T cells, and by the release of IL-2 and TNF-α. This polysaccharide could hamper pancreatic cancer growth by activating NK cells both in vitro and in vivo by triggering the TLR4/MAPK/NF-κB signaling pathway. At a 40 mg/kg dose in xenograft mice, this polysaccharide reduced the tumor growth by 50%; when used in combination with GEM, the inhibitory rate increased to 68%.(202)
TLR5, TLR7, TLR8, and TLR9 Modulators as Anticancer Agents
Flagellin and its derivatives are the only TLR5 modulators that have been investigated as potential antitumoral agents in several clinical trials.(3)
Several TLR7/8 modulators developed during the last years have been thoroughly and recently reviewed by Patinote et al.(2) Accordingly, in this section, we will update the TLR7/8 modulators outcome, followed by a discussion about TLR9 modulators and nonselective TLR ligands.
Novel bistriazolyl acyclonucleoside compounds were developed by Xia et al. as TLR7 agonists. These compounds revealed strong antiproliferative effect specific cell lines, together with an immunomodulatory activity. The best compound of the series (86, Figure 17) stimulated the immune response in DCs via TLR7 signaling and resulted cytotoxic against several cancer cell lines (IC50 values of ∼10 μM) by activating the apoptotic process.(203) From a cell-based high-throughput screening designed to discover novel NF-κB signaling inhibitors, two hit scaffolds were selected. 69 derivatives were synthesized, and among them, compound 87 resulted in being the most active. This latter was able to inhibit the TLR7-mediated NF-κB activation with an IC50 value of 260 nM and to suppress the PI3K/Akt and IKK/IκB pathways. In addition, administration of 87 to LPS-stimulated RAW 264.7 cells determined a significant suppression of TNF-α and NO levels. 87 showed significant growth inhibition against HeLa cells with a GI50 value of 1.35 μM after 48 h of exposure, resulting from the induction of apoptosis. The same study highlighted both the anticancer and anti-inflammatory activities of 87.(204)
Figure 17
Figure 17. Chemical structures of TLR modulators 86–88b endowed with anticancer activity.
As previously mentioned, CpG-ODN is the more deeply investigated class of TLR9 agonist. From preclinical studies, these compounds showed a good anticancer profile, alone or in combination with other chemotherapeutics or radiations, against many tumor models, such as cervical and colon cancers, rhabdomyosarcoma, and neuroblastoma.(205) Therefore, many IMOs have been developed and used in preclinical and clinical investigations for cancer treatment, alone or as vaccine adjuvants.(170,206) From the Web site clinicaltrials.gov, we could retrieve 24 studies regarding TLR9 modulators against cancer in the last decades. Among these, compounds CpG7909, SD-101, and IMO-2125 were the most investigated; however, none of these products overcame phase III trials.(171) In this context, we will describe the latest CpG that have been discovered and applied in preclinical cancer research. KSK-CpG is a phosphorothioated CpG-ODN with the following sequence: 5′-TCGTCGTTTTCGTCGTCGTTTT-3′. As a cancer immunotherapeutic agent, this product showed an activity slightly higher than other previously developed CpG-ODN. From in vivo studies on melanoma cancer cells, KSK-CpG (10 μg, ip administration) showed a marked increase in the activity of CTLs and NK cells, along with TH1 cells activation and IL-6 and IL-12 induction. These factors determined longer mice survival and a reduction in the number of tumor nodules.(207) In another study, the same product was investigated against lymphoma (A20 and EL4 cell lines). KSK-CpG had a direct cytotoxicity against these cells by inducing the TLR9 pathway, which determined the activation of apoptosis, the cell cycle arrest in G1-phase, and the release of IFN-γ in a time- or dose-dependent manner.(208) Another phosphorothioated CpG-ODN, namely, ODN M362 (5′-TCGTCGTCGTTC:GAACGACGTTGAT-3′), was studied as a potential cancer therapeutic. When administered in human HCC cell lines (0.5 μg/mL), this CpG determined the release of inflammatory cytokines, such as IFN-α, IFN-β, TNF-α, IL-6, and IL-8 and the activation of a TLR9-independent apoptotic process. The injection of ODN M362 in a human HCC xenograft mouse model (5 μg), directly at the tumor level, slowed the tumor growth and prevented the enlargement of the lymphoid tissue.(209) A class C CpG-ODN, YW002 (sequence 5′-TCGCGAACGTTCGCC:GCGTTCGAACGCGG-3′), was investigated and determined to exhibit a strong reduction or complete healing in breast tumor-bearing mice after the injection of 25 μg at the tumor-draining lymph-node area.(210) In another study, YW002 was formulated with MF59 (an oil-in-water nanoemulsion used as an adjuvant in an influenza vaccine) as a vaccine adjuvant for HSP65-MUC1 (a recombinant fusion protein incorporating HSP65 and mucin-1-derived peptide) to induce anti-MUC-1 tumor immunity. When administered as a preventive treatment, the MF59-YW002 adjuvant containing HSP65-MUC1 inhibited the growth of MUC1+ B16 melanoma and prolonged the survival of tumor-bearing mice. It is important to highlight that the absence of YW002 in the formulation did not provide any inhibition in tumor growth rate.(211) The synergistic effect of cyclophosphamide with the TLR9 agonist CpG-1826 (5′-TCCATGACGTTCCTGACGTT-3′) was evaluated in a mouse glioma model. An increased number of tumor-associated macrophages, B cells, DCs, and cytotoxic T cells was observed. After the injection of CpG-1826 (100 μg/50 μL) and cyclophosphamide (90 mg/kg), glioma regression and immune memory against this tumor were observed. A moderate response to the same treatment was observed in the B16F10 melanoma mouse model.(212) The same CpG-ODC, in association with radio-frequency ablation (RFA), was evaluated against thymic lymphoma in a work by Xu et al. Intratumorally administered CpG-1862 (10 μg in 30 μL) after RFA treatment determined a higher number of M1 macrophages, CD4+ and CD8+ T-cells, leading to a potent inhibition of primary, distant, and lung metastasis in mice bearing large EG7 tumors.(213) In a work by Babaer et al., three CpG-ODN—namely, ODN2216, ODN2006, and ODN M362 (class A, class B, and class C, respectively)—were tested as anticancer agents. The potential role of these compounds as vaccine adjuvants, that are able to enhance the activity of mammaglobin-A (MamA) peptide-specific cytotoxic CD8+ T lymphocyte responses against breast cancer, was evaluated. MamA peptide is overexpressed in the largest part of breast cancers and it has been applied as cancer vaccine in clinical trials with modest increase in MamA-specific CD8+ T lymphocyte activation. Therefore, this peptide was used to activate immature CD8+ T cells, co-administered with one of the previously described CpG (10 μM). In comparison with MamA peptide alone, a stronger activity against AU565 breast cancer cells was observed when ODN2006 (5′-TCGTCGTTTTGTCGTTTTGTCGTT-3′) or ODN M362 were co-administered.(214) Enantiomeric DNA-based immunomodulators (EnanDIM) represent a new family of TLR9 agonists bearing nuclease-resistant l-deoxyribose nucleotides that replace the d-deoxyribose at the 3′-ends. Different molecules belonging to this class were analyzed in a work by Kapp et al., in both in vitro and in vivo models. These compounds revealed a broad range of immune cells activation, promoting T cell infiltration into CT26 colon carcinoma, followed by a marked reduction in tumor growth. Furthermore, EnanDIM-C (250 μg in 50 μL) determined regression in other tumors, such as B16 melanoma, MC38 colon carcinoma, EMT-6 breast cancer, and A20 lymphoma in murine models. Significantly, EnanDIM-C against A20 and EMT-6 tumors cured the largest part of the animals, establishing a persistent antitumor immune memory.(215) A self-designed CpG-ODN (GACGCGCGTC GACGATCGCGAATTCGAACGTACGCT) was evaluated in combination with pimozide (a neuroleptic drug, acting as a STAT5 inhibitor and possessing antimelanoma activity) against melanoma in a mouse model. This combination determined a strong inhibition in melanoma growth, prolonging the survival of melanoma-bearing mice. A stronger infiltration of CD4+ and CD8+ T cells in the tumor was observed, along with an increased count with regard to the number of these and NK cells.(216)
From a cell-based high-throughput screening, compound 88a was chosen as a hit compound for TLR3 activation (EC50 = 22.3 μM). Starting from this molecule, SAR studies were performed and the best compound (CU-CPT17e, 88b), with an EC50 value of 4.8 μM, significantly improved NF-κB activation by 13.9-fold in HEK293 cells (human embryonic kidney). Surprisingly, this compound was also able to trigger TLR8 and TLR9 with EC50 values of 13.5 and 5.7 μM, respectively. In THP-1 cells, 88b stimulated cytokines release, such as TNF-α, IL-6, and IL-12, after 12 h in a dose-dependent manner. Moreover, this molecule resulted in a cytotoxic effect to HeLa cells in a dose-dependent manner, thanks to the activation of the apoptotic process.(217)
TLRs in Autoimmune Diseases
ARTICLE SECTIONS
Autoimmune diseases are a family of chronic inflammatory disorders characterized by alterations in the homeostasis of the immune system and the subsequent break of tolerance to self-antigens.(218) An autoimmune response is the result of genetic and environmental factors, and it is mediated by several biological processes, in which TLRs play a fundamental role. TLRs are implicated in different autoimmune diseases, such as multiple sclerosis (MS), systemic lupus erythematosus (SLE), and rheumatoid arthritis (RA). The expression of these receptors in immune cells is enhanced and they can trigger pro/anti-inflammatory mechanisms by releasing several cytokines, which are the main mediators in the inflammatory processes. In this scenario, the modulation of TLRs may represent an interesting pharmacological approach for the treatment of autoimmune diseases.(219,220) However, the relationships among the various TLR pathways in these diseases is highly complex.
TLRs in Multiple Sclerosis
MS is an autoimmune disease characterized by loss of neuronal communication as a result of myelin sheath deterioration. In the pathogenesis of MS, both neurodegeneration and neuroinflammation are involved. Myelin lesions hamper the diffusion of electrical signals among neurons in CNS, leading to several motor and psychiatric symptoms such as pain, sensory loss, cognitive decline, and fatigue.(221) TLRs are usually localized on the cell or endosomal membranes of immune cells, including T-cells, B-cells, astrocytes, macrophages, and microglia cells.(222) The overactivation of these cells by TLRs, during neuroinflammatory processes, contributes to the pathogenesis of MS.(223) In 2019, Clements et al. demonstrated, in experimental autoimmune encephalitis (EAE, the most common model of MS in mice), that TLR2 and TLR4 are involved in the genesis of MS secondary symptoms (such as neuropathic pain, depression, anhedonia, anxiety), which are determined by the release of IL-1β. In this work, the treatment with TLR2 and TLR4 antagonist led to an improvement of the above-mentioned symptoms.(224) Moreover, poly(I:C)-treated EAE mice showed partial disease remission, thus highlighting the importance of TLR3 activation in MS.(225) TLR9 stimulation with CpG-ODN pointed out the role of this receptor in B-cells, resulting in changes of their cytokine profile. In particular, the levels of IL-10 decreased after TLR9 activation by this agonist.(226) Several novel TLR modulators have been identified for the treatment of MS in the past decade, whose pharmacological properties will be summarized in the following section.
TLR Modulators in Multiple Sclerosis
Inhibition of TLR2, TLR4, TLR7, TL8, and TLR9 can prevent MS initiation and progression; on the other hand, TLR3 stimulation seems to promote the MS course. MyD88 deficiency in EAE models permits a partial slowdown in the onset of the disease, highlighting that MyD88 might be considered a pharmacological target in CNS inflammation. It was discovered that the linear heptameric peptide RDVLPGT, corresponding to the region between the βB strand and the αB helix of MyD88 (called BB loop), competitively inhibits MyD88 dimerization. Taking into account the low metabolic stability and selectivity of linear peptides, Shira et al. identified two cyclic mimetic peptides—namely, c(MyD 4–4) and c(MyD6–6) (89a and 89b; see Figure 18)—that were able to disrupt human and mouse TLR2/4 signaling by inhibiting MyD88. In EAE models, this event inhibited the TH1/TH17 cells differentiation, thereby reducing the severity of the disease.(227) Rabeximod (90) is a small molecule that downstreamed the TLR2/4 stimulation, leading to a decreased activation of inflammatory cells. Its immunomodulatory activity was tested by Hultqvist et al. in vivo for RA and MS. Subcutaneous (20 mg/kg) or oral (40 mg/kg) administration of 90 in mice reduced EAE severity.(228) Since TLR3 plays an important immune-protective role, TLR3 agonists could represent valid therapeutic tools in MS. The most investigated compound in MS treatment is poly(I:C12U), which prevented inflammation and the demyelination process by TLR3-mediated IFN-β production. (+)-Naltrexone (91, NTX), a nonopioid TLR2, TLR4 antagonist, was studied in MS models, resulting in the inhibition of the NF-κB signaling pathway.(224) Compound 91 underwent randomized trials to determine low-dose effects in the treatment of MS patients (NCT00501696). In 2015, Crowley et al. discovered that baclofen (92), which is a γ-aminobutyric receptor B modulator, is able to inhibit the TLR3 and TLR4 signaling pathways. In murine glia cells PBMCs (isolated from patients with a relapse-remitting form of MS), it showed an anti-inflammatory effect. Compound 92 reduced the levels of NF-κB and TNF-α in a dose-dependent manner, thus regulating the innate immune response in MS.(229) This inhibitor has been applied in 10 clinical trials, subsequently reaching phase III in six studies (NCT00139789, NCT01743651, NCT00488839, NCT03319732, NCT03290131, NCT01359566). Interestingly, the water-soluble artemisinin analogue SM934 (93) showed immunosuppressive properties in EAE murine models by inhibiting TLR9. The administration of 93 in EAE mice resulted in a strong suppression of TH17 and TH1 and, at the same time, promoted Treg expansion.(230)
Figure 18
Figure 18. Chemical structures of TLR modulators 89–93 investigated against MS.
TLRs in Rheumatoid Arthritis
RA is a common autoimmune disease characterized by localized and systemic symptoms, including synovial inflammation and hyperplasia, “swelling”, cartilage, bone and joint destruction, pain, and cardiovascular, pulmonary, and psychological disorders. The clinical outcome of RA is the result of abnormal immune response in which both synovial cells—fibroblast-like synoviocytes (FLS) and immune cells—are involved. Plasma cells produce autoantibodies (Abs), such as rheumatoid factors and/or anticyclic citrullinated peptides Abs, which activate the immune response, determining the above-mentioned symptoms.(231,232) TLRs amplify the immune cells response in RA by producing pro-inflammatory cytokines in the synovial, promoting FLS and macrophage-like synoviocytes activity and Abs production. Several studies demonstrated the involvement of TLR2 in the pathogenesis of RA. The stimulation of synovial fibroblasts (SFs) in RA patients with pro-inflammatory cytokines (such as IL-1β and TNF-α), LPS, and synthetic bacterial lipopolysaccharides considerably increased TLR2 mRNA expression. This determined an improved TLR2-mediated production of pro-inflammatory cytokines in the synovial cells, contributing to bone and cartilage destruction.(233) It is consistently demonstrated that the synovial macrophages (SMs) are the main source of TNF-α, IL-1β, and IL-8 in RA. Huang et al. showed the crucial role of TLR2 and TLR4 from SMs in the persistence and progression of RA disease. Moreover, an increased expression of TLR2 and TLR4 was observed in SMs isolated from joints of RA and other forms of inflammatory arthritis patients. Stimulation of these macrophages with TLR2 or TLR4 agonists, respectively, peptidoglycan and LPS showed a higher production of pro-inflammatory cytokine in SMs of RA patients. These results highlight the primary role mediated by TLR2 and TLR4 in promoting the inflammation and joint destruction in RA.(234) High levels of TLR3 and TLR4 were identified in SFs of patients in the early stages of RA. These values resulted in being comparable with TLR3 and TLR4 expression in patients with long-standing RA, highlighting the importance of TLR signaling pathway in developing joint destruction.(235) Moreover, Roelofs et al. evaluated, in RA patients, the expression of TLR3 and TLR7 in the synovium and the TLR-mediated cytokines production from DCs. TLR2, TLR3, TLR4, TLR7, and TLR8 were stimulated in DCs with Pam3Cys, poly(I:C), LPS, and R848, respectively, resulting in the release of TNF-α, IL-6, IL-10, and IL-12. TLR3 and TLR7 were overexpressed in synovial tissue of RA patients and cytokines production in RA DCs was more pronounced, if compared to that of the healthy control. These factors enhanced pro-inflammatory response and favored a breakdown of tolerance in RA.(236) It was also noted that low-dose administration of TLR7 agonists induced tolerance or hyporesponsiveness to TLR2, TLR7, and TLR9 activators, reducing inflammation in a passive antibody-mediated arthritis model. These findings suggest that the induction of TLR7 tolerance might be a new therapeutic approach to overcome inflammation in autoimmune diseases.(237) As reported by Sacre et al., TLR8 is involved in RA pathogenesis; in fact, by treating human synovial RA cells with TLR8 antagonists, a significant reduction in TNF production was observed.(238) In addition, Lacerte et al. reported that TLR2 and TLR9 stimulation by EBV may contribute to the pathogenesis of RA.(239)
Considering the involvement of several TLRs in RA pathogenesis, many TLR antagonists, including monoclonal antibodies or small molecules, might represent potential therapeutic agents.
TLR Modulators in Rheumatoid Arthritis
OPN-301 and NI-0101 are monoclonal antibodies that act as TLR antagonists applied in RA therapy, as TLR2 and TLR4 ligands, respectively.(240−242) OPN-301 is a novel mouse IgG1 monoclonal anti-TLR2 antibody that was able to block 1b-dependent cytokine production in RA synovial tissues. OPN-301 efficiently penetrated into the synovia and its anti-inflammatory activity was comparable to that of Adalimumab (an anti-TNF-α antibody). After OPN-301 administration in RA patients, 62% of the subjects showed a moderate to good response.(240) NI-0101 is a humanized IgG monoclonal antibody that is able to block TLR4 dimerization, thus promoting inhibition of the TLR4 pathway. In a phase II clinical trial, Monnet et al. treated RA patients (which poorly responded to Methotrexate (MTX)) with NI-0101 (5 mg/kg). However, no patients showed an improvement after the administration of NI-0101, proving that the TLR4 inhibition alone was insufficient to obtain a therapeutic effect in RA patients.(241) Auranofin (94, Figure 19) is a small molecule widely used in RA treatment; its mechanism of action seems to involve TLR pathways at different levels. It blocked TLR4 dimerization after the stimulation of this receptor with LPS. At the same time, 94 suppressed TRIF-dependent signaling pathway by reducing TLR3-mediated NF-κB production.(243) The TLR2/4 antagonist 92 considerably reduced RA severity after oral (40 mg/kg) and subcutaneous (40 mg/kg) administration in mice.(228) Furthermore, Hultqvist et al. demonstrated that 92 efficiently reduced collagen antibody-induced arthritis in mice, by suppressing immune cells, mostly macrophages, in a time-dependent manner.(244) In 2020, Samarpita et al. evaluated the application of the TLR4 inhibitor 34 as a potential anti-RA molecule. 34 reduced the expression of adjuvant-induced arthritis in a rat model by inhibiting inflammatory cytokines release in LPS-stimulated FLS, thus exhibiting interesting anti-RA properties.(245) PF-0665083 (95) is an IRAK4 inhibitor developed by Pfizer, which, in 2019, overcame two randomized phase I studies (NCT02224651, NCT02485769) aimed at evaluating its safety, pharmacokinetics, and pharmacodynamics. The compound was generally well-tolerated, showing mild adverse effects such as headache, gastrointestinal disorders, and acne.(246) These data supported the successive evaluation in a phase II clinical trial in RA (NCT02996500) patients with poor response to MTX. In 2018, Zhang et al. identified a very potent TLR8 inhibitor, named CU-CPT9a (96, IC50 = 0.50 nM), by a SAR study on pyrazolo[1,5-a]pyrimidine series. 96 stabilized the inactive state of TLR8 and antagonized the binding of TLR8 activators, also suppressing, in a dose-dependent manner, TNF-α production in PBMC harvested from RA patients, exerting an important anti-inflammatory effect.(247) Antimalarial drugs, such as 26 and hydroxychloroquine (HCQ, 97), have been applied in the treatment of autoimmune diseases, including RA and SLE. 26 and 97 can modulate both the TLR7 and TLR9 activity by altering endosomal pH and/or preventing TLR7 andTLR9 activation by binding their ligands (DNA and RNA respectively). These mechanisms of action led to a reduced production of pro-inflammatory cytokines, such as IL-1, IL-6, TNF, and IFN, with significant improvements in the treatment of autoimmune RA.(248)
Figure 19
Figure 19. Chemical structures of TLR modulators 94–98 investigated against RA and SLE treatment.
TLRs in Systemic Lupus Erythematosus
SLE is a multiorgan autoimmune disease characterized by loss of self-tolerance against ubiquitous autoantigens, involving numerous mechanisms of adaptive immunity. SLE has a progressive/remitting form and it shows different symptomatology, depending on which organs are affected. It can target kidneys, joints, the nervous system, and hematopoietic organs. The main hallmark of SLE is a massive autoantibody production that targets dsDNA and nucleosomes of the cells in the involved tissues. This is due to a dysregulation of cytokine levels, lymphocyte T and B hyperactivity, and APC abnormalities.(249) SLE patients exhibit glomerulonephritis (GN) caused by immune complex deposits and an insufficient clearance of apoptotic cells debris, which can activate TLRs and therefore elicit autoantibody production.(250,251) TLRs can contribute in different ways to the SLE pathogenesis. Studies conducted on TLR2- and TLR4-deficient lupus prone mice were performed to analyze the phenotype, autoantibody productions, and renal injury related to the disease. It resulted that TLR4-deficient (and, to a lesser extent, TLR2-deficient) mice showed a drastic reduction in GN and autoantibody production.(252) As additional evidence of the involvement of TLR4 in SLE pathogenesis, Liu et al. showed that HSPs act as chaperones in inducing hyperresponsiveness after TLR4-LPS interaction. This increased response elicited a breakdown of immunological tolerance and, at the same time, TLR4 upregulation induced a similar lupus-like autoimmune GN.(253) TLR3 expression in APCs and glomerular mesangial cells resulted in an increase in MRLlpr/lpr mice characterized by lymphadenopathy associated with aberrant production of T cells and used to evaluate SLE therapy, exacerbating GN conditions. Poly(I:C) aggravated lupus nephritis by stimulating TLR3 in glomerular mesangial cells and APCs in the same mouse model. However, poly(I:C) injections did not increase antibodies production, suggesting that TLR3 is involved in SLE pathogenesis in a B-cell-independent mechanism.(254) The key role of endosomal TLRs in SLE pathogenesis was assessed by inducing lupus-like disease in TLR-deficient mice, which showed an important reduction in antibodies.(255) A 2014 ethnic-epidemiological study on lupus- and non-lupus-affected women demonstrated that SLE patients presented an upregulation of both TLR7 and TLR9 and an increased level of IFN-α and IL-6, which induced the release of B-cell activating factor in DC with the consequent activation of autoreactive B-cells.(256) Not much is known about TLR8 implications in SLE. In 2014, Tran et al. studied the effects on TLR8 gene deletion in lupus-prone mice, which underwent an accelerated disease progression, because of an increased number of antibodies, active monocytes, and an exacerbated cell response to TLR7 ligands. Therefore, TLR8 regulates TLR7-mediated immune responses.(257) Currently, SLE therapy mainly consists of anti-inflammatory drugs, antimalarials, steroids, and immunosuppressors. By virtue of the strong TLRs-mediated immune response, a selective TLRs inhibition could prevent the initiation or progression of SLE.
TLR Modulators in Systemic Lupus Erythematosus
Because of the main role of endosomal TLRs in the pathogenesis of SLE, TLR7/8/9 inhibitors are the best therapeutic options, as demonstrated by Patinote et al. in a very detailed review on such inhibitors. The CpG-ODNs (dual TLR7/9 inhibitors) IMO-3100, INH-ODN-24888 (T*C*C*T*G*G*C*mE*G*G*G*A*A*G*T, where * denotes phosophorothioate bonds) and mE is 7-deaza-2′-O-methyl-guanosine) and IRS 954 (5′-TGCTCCTGGAGGGGTTGT-3′) are indicated in the treatment of SLE.(2) The above-mentioned TLR7/9 antagonists 93 and 95 are all indicated as potential drugs in the treatment of SM and SLE.(2,246) The TLR7/9 inhibitors 26 and 97 are both used as immunosuppressors in the treatment of RA and SLE.(248) The peptidomimetic compound ST2825 (98) mimics the MyD88 BB-loop domain (RDVLPGT). It was used by Capolunghi et al. in a study on PBMC extracted from SLE patients. In particular, these cells were treated with 98 (1, 3, 10, 30, or 60 μM) in the presence (or in the absence) of a TLR9 agonist, namely, ODN 2006 (2.5 μg/mL). Results showed that TLR9 inhibition by 98 blocked the de novo generation of plasma cell and the secretion of autoantibodies.(258)
TLRs in Cardiovascular Diseases
ARTICLE SECTIONS
Cardiovascular disease (CVD) represents one of the leading causes of death worldwide. Atherosclerosis is the major pathology associated with cardiovascular dysfunctions, often mediated by inflammatory stimuli. Seminal data show that TLRs and the innate immune system play a key role in the initiation and development of CVDs. The main TLRs involved in CVDs are the TLR1/2 heterodimer and TLR4, whose presence in atherosclerotic plaques accelerates the progression of the disease, while the disruption of the signaling affects its progression.(259) TLRs are mostly expressed in ECs, VSMCs, B cells, neutrophils, fibroblasts, macrophages, monocytes, NK cells, and platelets. Several studies highlighted the pivotal role of TLRs during the development of atherosclerotic plaques, myocardial ischemia/reperfusion injury, and platelet aggregation.(260) The TLR1/2 agonist 1b triggered the growth of profuse abdominal atherosclerosis in low-density lipoprotein receptors null mice (LDLr–/–). TLR3 activation led to the formation of atherosclerotic plaques, by partially regulating the activity of matrix metallo-proteinases (MMP) 2 and 9 in macrophages and by enhancing the production of ROS.(261) LPS is known as a TLR4 activator able to enhance the inflammatory response in patients with atherosclerosis. It prompted platelets adhesion to neutrophils, which is a fundamental event in the development of atherosclerosis.(262) In addition, the treatment with a TLR4 antibody decreased ROS production and the expression of IL-6 in mesenteric resistance arteries from hypertensive rats.(263) TLR5 expression is upregulated in atherosclerotic lesions, while the deficiency of this receptor resulted in a reduction of high fat-induced atherosclerosis.(264) In patients affected by acute ischemic stroke, the high expression of TLR7 in peripheral blood is associated with poor outcomes and strong inflammatory responses. The deficiency of this receptor accelerated the development of atherosclerotic plaques by reducing the release of pro-inflammatory cytokines. In a rabbit model fed with HFD, TLR8 is upregulated and related with the progression of atherosclerosis.(260) Finally, TLR9 pathway activation is implicated in the management of atherosclerosis. Indeed, genetic deletion or pharmacologic blockade of TLR9 attenuated atherogenesis in the aortic arch and reduced the accumulation of lipid and macrophages in atherosclerotic plaques in mice models.(265) Moreover, TLR9 inhibition led to a decrease in blood pressure, whereas its activation induced vascular dysfunction and increased blood pressure in normotensive rats.(261)
TLR Modulators in Cardiovascular Diseases
The TLR2 agonist 1b was able to protect the myocardium following ischemia/reperfusion (I/R) injury. The same behavior was observed prior to brain ischemia, with a significant reduction in infarct size and mortality rate in a mouse model of cerebral I/R injury, possibly through a TLR2/PI3K/PKB-dependent mechanism.(266) In LDLr–/– mice, the TLR2/6 agonist 2 induced an intense inflammatory process, by increasing plasma levels of pro-inflammatory cytokines IL-12/IL-23p40. Therefore, MALP-2 treatment induced a remarkable increase in heart valve lesions.(260) Vitamin K2 (99, Figure 20) served as an inhibitor of HFD-induced aortic intimal calcification in apolipoprotein E KO mice, by suppressing the expression of TLR2 and 4.(267) TLR6 is involved in thrombus formation, because it favors the generation of oxLDL cholesterol, which is responsible for plaque development. These events were limited by simvastatin (100) treatment, which acts as a suitable TLR4/TLR6 antagonist.(268)
Figure 20
Figure 20. Chemical structures of TLR modulators 99–103 investigated against CVDs.
Melatonin (101) showed an antagonistic TLR3/TLR4 activity demonstrating protective effects on liver ischemia in a rat model and prevented necrosis and apoptosis in hepatic cells, by balancing the endothelin-1/NO ratio. Despite the TLR3 agonist poly(I:C) impaired endothelium-dependent vasodilation, it was able to reduce right ventricular failure in established pulmonary hypertension.(269) Moreover, poly(IC:LC) showed a protective effect in renal and cerebral I/R injury in vitro and in vivo, by reducing the release of inflammatory cytokines, including IL-1, IL-6, and IL-12, and decreasing the infarct size.(270)
The TLR4 antagonist LPS-RS inhibited monocyte and macrophage recruitment and collagen accumulation in the intima and, consequently, inhibited atherosclerosis in diabetic LDLr–/– mice.(262) Palmitic acid (102) administration resulted in a significant upregulation of KCa3.1 and KCa2.3 channels and downregulation of TNF-α and IL-1β expression, hence highlighting the potential of TLR4 antagonists as blood pressure regulators.(271) In a model of abdominal aortic aneurysm, the TLR4 antagonist 36b inhibited MAPK and NF-κB p65 phosphorylation associated with TLR4 downregulation. Furthermore, IAXO-102 decreased Angiotensin II-induced aortic expansion.(272) After intracerebral hemorrhage-evoked injuries, the TLR4 antagonist 34 significantly reduced brain water content, neurological deficit scores, and inflammatory factors levels, as a result of the reduced expression of IκBα and NF-κB. The selective TLR4 inhibitor 34 downregulated the expression of TLR4, MyD88, IL-1β, TNF-α, and Bax, and upregulated IκB-α and Bcl-2 expression, thus proving to be a useful tool in stroke management.(273)
The flagellin-analogue Entolimod (CBLB-502) has been shown to be protective in I/R injury by decreasing the accumulation of ROS. In renal I/R injury, pretreatment with CBLB-502 inhibited neutrophil infiltration during the reperfusion period, eliciting a beneficial role.(260)
Fluvastatin (103) decreased atherosclerotic plaque, calcium deposition, intraplaque hemorrhage, and macrophage infiltration, but increased smooth muscle cells in plaques of aortic segments by downregulating TLR2, TLR3, TLR4, and TLR8.(274)
The administration of the TLR9 modulator CpG-ODN 1668 (5′-TCCATGACGTTCCTGATGCT-3′) determined a reduced severity of atherosclerotic plaque lesions.(275) Moreover, 26, which is a TLR9 antagonist, increased the expression of MyD88-dependent proteins, thus decreasing blood pressure, as well as reducing circulating T cells and vascular infiltrating leukocytes.(276)
TLRs in Diabetes
ARTICLE SECTIONS
Type 2 diabetes mellitus (T2DM) is a multifactorial metabolic disorder that is essentially due to an incorrect alimentary lifestyle, which leads to several complications, including retinopathies and diabetic foot ulcers.(277,278) Several evidence highlighted the regulatory role of TLRs in promoting the inflammatory process during T2DM course. TLR2 and TLR4 are enhancers of islet inflammation in T2DM, leading to the activation of macrophages and the subsequent islet endocrine cell dysfunction.(279) Increased concentrations of saturated fatty acids led to the activation of TLR2 and TLR4, potentially inducing inflammatory events, although other studies demonstrated the insulin–secretagogue properties of polyunsaturated fatty acids.(280) Noteworthy, the endogenous TLR ligands HSP60 and HSP70 (reported to be higher in T2DM patients) induced the production of pro-inflammatory cytokines via activation of TLR2 and TLR4. The ability of TLRs to initiate and propagate inflammation makes them attractive therapeutic targets in T2DM management. It has been demonstrated that TLR2 downregulation in wounds of T2DM patients, compared to nondiabetic patients, may lead to the development of nonhealing chronic ulcers.(281) Moreover, gestational diabetes patients showed a high TLR2 expression, thus confirming a suitable role for TLR2 antagonists in the management of the disease.(282) The TLR2 agonist zymosan led neutrophils to ROS release with the subsequent T2DM initiation; on the other hand, GIT2, which is a nonspecific TLR inhibitor, decreased NF-κB and Nox4 levels and improved tissue lipid metabolism and insulin resistance.(283) From a therapeutic point of view, the upregulation of insulin is an important mechanism that suppresses the expression of TLR2, thus suggesting the possibility to explore new TLR2 antagonists for the management of diabetes.(284)
TLR3 is a regulator of immune cells, pancreatic β-cells, and glucose homeostasis. Studies reported how the TLR3 agonist poly(I:C) plays a negative role in the proliferation of pancreatic β-cells. The loss of TLR3 function led to improved glucose tolerance and declined liver steatosis in obese mice.(285)
Fatty acids, such as lauric and palmitic acids, are capable of stimulating an inflammatory response through TLR4 signaling pathway; however, at the same time, omega-3 fatty acids can oppose the action of classic TLR4 agonists, such as LPS and derivatives.(286) TLR4 activation is responsible for the excessive inflammation that rapidly leads to the chronic behavior of nonhealing wounds that occur in diabetic patients, often coexisting with ischemia.(287) Thus, TLR4 ablation is responsible for the reduction of inflammation in diabetic mice.
TLR Modulators in Diabetes
Treatment of Leydig cells (derived from diabetic mice) with the TLR4 antagonist 34 (10 nM for 24 h) attenuated oxidative stress and restored the levels of phospho-ERK1/2.(288) In a model of diabetic liver injury, vitamin D3 administration for 16 weeks (0.3 μg/kg/day) downregulated the expression of TLR4, NF-κB, and TNF-α, thus attenuating hepatic inflammation and fibrosis.(289) Another feature of T2DM is diabetic nephropathy. In this context, rapamycin (104, Figure 21) was able to attenuate the inflammation via inhibition of the TLR4 signaling pathway and consequent reduction in IL-17 levels, limiting the disease at an early stage.(290) Under the same conditions, the TLR4 antagonist CRX-526 (47) significantly reduced albuminuria and blood urea nitrogen without altering blood glucose and systolic blood pressure in diabetic mice; this TLR4 inhibition was associated with a reduction of TGF-β overexpression and NF-κB activation.(291) Phytochemicals such as curcumin (105), helenalin (106), and cinnamaldehyde (107) inhibited TLR4 activation by interfering with cysteine-residue-mediated receptor dimerization. Other antagonists such as resveratrol (108), epigallocatechin gallate (109), and luteolin (110) specifically reduced TLR4 signaling by targeting TRAF-associated NF-κB activator-binding kinase 1 and receptor interacting protein 1 (RIP1) in the TRIF complex. All of these compounds showed anti-inflammatory effects, thus limiting the progression of metabolic diseases.(292) Therefore, the development of new TLR4 antagonists could provide an alternative approach for diabetic wounds.
Figure 21
Figure 21. Chemical structures of TLR modulators 104–110 investigated against diabetes.
TLRs in Neurodegenerative Diseases and Retinal Degeneration
ARTICLE SECTIONS
TLRs are widely expressed in the CNS, including neurons, astrocytes, and microglia. Mice, rats, and human microglia express TLRs to detect their related ligands. Astrocytes mainly express TLR1, TLR3, and TLR4; neurons express TLR2, TLR3, TLR4, TLR8, and TLR9; oligodendrocytes express TLR2 and TLR3; cerebral endothelial cells constitutively express TLR2, TLR4, and TLR9. There is increasing evidence of the involvement of TLRs, especially TLR2, TLR4, and TLR9, in neurodegenerative diseases, such as Alzheimer’s disease (AD) and Parkinson’s disease (PD). Several factors, involved in the pathogenesis of neurodegenerative diseases, have been reported to be modulated by TLR ligands. Accordingly, they might represent useful tools for the development of new therapeutic agents for such pathologies. Kainic acid (KA), which is a TLR2 activator, was able to induce excitotoxicity, which was decreased in TLR2 KO mice. In the collagenase-induced mouse intracerebral hemorrhage model of stroke, TLR2 KO reduced the typical stroke inflammatory conditions. These investigations showed that an antagonistic pharmacological approach could reduce neuroinflammation.(293) Several studies showed that TLR2 activation in microglia enhances pathological β-amyloid (Aβ) uptake, while others showed that TLR2 inhibition decreased glial cells reactivity, leading to a reduction of Aβ deposits and an improved cognitive performance in mice.(294) Moreover, TLR2 activation induces an abnormal α-synuclein accumulation by impairing autophagy, and it also modulates α-synuclein transmission, which, in turn, induces several diseases, including PD and dementia with Lewy bodies. Treatment with the TLR2 functional blocking antibody T2.5 reduced astrogliosis and microgliosis, with impaired expression of TNF-α and IL-6, and it ameliorated neuronal loss in synucleinopathy mice.(295) The systemic treatment with the TLR3 agonist poly(I:C) induced the production of inflammatory mediators, which increased Aβ levels in the hippocampus, which is a feature linked to cognitive dysfunction. TLR4 activation is able to increase the expression of inflammatory mediators, activating molecular pathways, which leads to neurodegenerative conditions. In AD, TLR4 promotes the abnormal accumulation of Aβ that contributes to neuroinflammation.(296) In PD, α-synuclein induces inflammatory responses in glial cells through the TLR4 pathway, causing neuronal death.(296)
Since retinal degeneration shares many hallmarks with neurodegeneration (i.e., the expression of inflammatory and oxidative markers), there is the opportunity to treat inherited retinal diseases as CNS pathologies. A study using the TLR2 antibody showed that the blockade of TLR2 transduction preserved tight junction expression and promoted retinal pigment epithelium resistance to fragmentation.(297) mRNA levels of TLR4 were found to be higher in mice with retinal degeneration. Furthermore, TLR4 favored microglial activation by endogenous photoreceptor proteins, which, in turn, prompted retinal cell death.(298) In the retinas of the degenerative rd1 mice, microglia underwent necroptosis through RIP1- and RIP3-dependent pathways. In addition, necroptotic microglia produced larger amounts of pro-inflammatory cytokines, in response to LPS-mediated TLR4 activation.(299)
TLR Modulators in Neurodegenerative Diseases
In a model of cerebral I/R, 83 reduced the expression of TLR2–TLR4, thus limiting the production of IL-1β and the number of apoptotic cells.(300) In a model of injured cornea, poly(I:C) treatment enhanced the migration of endothelial progenitor cells and the expression of the stromal cell-derived factor 1, resulting in neovascularization.(301) The neuroprotective effect of TLR3 was also evaluated against cardiopulmonary bypass-induced injury: the treatment with sevoflurane (111) reduced the number of apoptotic hippocampal neurons via TLR3 activation. Only the agonist MPLA was able to prevent the accumulation of Aβ in AD mice models.(302) In aluminum-chloride-induced AD, a TLR4 overexpression was documented. In this study, ethyl pyruvate treatment (112, 50, 100, 200 mg/kg/day) rescued TLR4 overexpression and associated oxidative stress in brain tissues.(303) In inflamed microglia, treatment with the TLR4 antagonist 34 (1 μM) suppressed LPS-induced microglial activation, improving levels of neurogenesis.(304) Noteworthy, 34, acting via TLR4-MyD88/TRIF-NF-κB signaling pathway, was able to reduce traumatic brain injury-induced neurons loss, brain edema, and neurobehavioral impairment in rats, subsequently inhibiting neuronal autophagy and neuroinflammation responses in the hippocampus.(305) In inflammation-induced primary microglia, dihydrotestosterone (113) acted as a TLR4 antagonist by limiting LPS-mediated activation, NF-κB, and MAPK p38 signaling pathways and attenuating the release of TNF-α, IL-1β, IL-6, iNOS, COX-2, NO, and PGE2.(306) In another work, the cyanobacteria-derivative TLR4 inhibitor VB3323 was able to decrease microglial activation and morphological alterations of spinal cord neurons.(307) In an AD model, the mechanism of action of hesperetin (114) was shown to be related to the modulation of TLR4/Nrf2/NF-κB signaling, providing a new therapeutic opportunity in AD.(308) 2,2′,5′-Trihydroxychalcone (2,2′,5′-THC, 115) is a ROS scavenger that downregulates TLR4 expression and inhibits apoptosis in stimulated primary rat neuronal cultures by reducing TNF-α and IL-6 secretion.(309) Phytocompounds from licorice showed interesting neuroprotective properties via inhibition of the TLR4 signaling pathway. For example, isoliquiritigenin (116) pretreatment in KA-induced epileptic rats reduced the release of CCL3, TNF-α, and IL-1β; moreover, the blockade of MyD88 signaling attenuated KA-induced neuroinflammation and neuronal damage in the hippocampus.(310) In AD, CpG-ODNs activate TLR9, enhancing Aβ ingestion by microglia, reducing Aβ aggregation, and ameliorating memory impairment. In addition, TLR9 activity attenuated aberrant neurogenesis in the hippocampus and reduced seizure mediated by KA.(296) In the PD model, TLR9 activation is mediated by glucocorticoid receptors, which are responsible for dopamine neuron loss. This behavior was limited by COV08-0064 (117), which is a selective TLR9 inhibitor, opening the way for further studies with the aim to discover new drug candidates for PD.(311)Figure 22 shows the chemical structures of TLR modulators 111–117.
Figure 22
Figure 22. Chemical structures of TLR modulators 111–117 useful in neurodegenerative diseases.
Conclusions and Perspectives
ARTICLE SECTIONS
Since the discovery of TLRs, many research efforts have been accomplished to select promising hit compounds for each TLR family member. TLR activity underpins many disorders, including infectious and autoimmune diseases, cancer, cardiovascular and neurodegenerative disorders. Accordingly, alteration of TLR functioning is deeply involved in the progression of several diseases, as changes in TLRs activity during their pathogenesis have been widely demonstrated. The modulation of TLRs by small molecules or natural compounds could be exploited to attain a therapeutic effect. In this context, the majority of TLRs’ modulators so far undergone in clinical evaluation have been investigated as potential vaccine adjuvants (65%) while the remaining have been developed as therapeutic drugs (small molecules).
Table 1 summarizes the most promising TLR modulators among the compounds herein discussed. Compounds 1a, 1b, and their derivatives are the most studied TLR1/2 and 2/6 agonists, which have been evaluated in several diseases. Another important TLR2 modulator worthy of particular mention is the picomolar agonist 76, endowed with significant antitumor against melanoma. On the other hand, the TLR2 antagonists 42 and 44 are characterized by a potential anti-inflammatory activity. Poly(IC:LC) and poly(I:C12U) are the most explored poly(I:C) derivatives in clinical trials as TLR3 modulators. Derivatives of the natural TLR4 ligand lipid A, such as 8 and 9, are the most representative TLR4 agonists and antagonists, respectively. In particular, 9, as well as AGPs, have been approved in cancer immunotherapy as vaccine adjuvants. Notably, a small molecule, the TLR4 antagonist 34, represents one of the most important small molecules employed against many pathologies, including inflammation, sepsis, cancer, RA, CVDs, diabetes, and neurodegenerative disorders. Flagellin and its derivatives are the most studied TLR5 ligands. Entolimod is a promising TLR5 agonist, widely evaluated in cancer and infectious diseases. Since the discovery of imidazoquinolines as potent TLR7 and TLR8 agonists, many derivatives have been developed and the most representative analogue (15) was approved for the treatment of superficial basal cell carcinoma and genital warts. In this context, structural modifications of the imidazoquinoline core, by removal of the five-membered ring (i.e., 15 vs 96) inferred an activity switch from agonism to antagonism. Notably, the TLR8 antagonist 96 is under clinical evaluation for inflammation, MS, SLE and other autoimmune diseases. In a repurposing approach, 26 and 97 stood out as TLR7 and TLR8 inhibitors for the treatment of RA, SLE, sepsis, viral infections, and autoimmune diseases. The wide class of CpG-ODNs encompassed the best TLR9 modulators which are in clinical trials against various diseases.
Table 1. Summary of the Most Promising TLR Modulators Described in the Previous Sections
| TLR | ligand | disease | mechanism/biological effect | ref(s) |
|---|---|---|---|---|
| Agonists | ||||
| TLR2/1 and TLR2/6 | Pam2/3CSK4, 1a, 1b | HBV | inhibition of replication and capsid formation | (22) |
| TLR2/1 and TLR2/6 | Pam2/3CSK4, 1a, 1b | breast cancer | production of TNF-α | (173) |
| TLR2/1 and TLR2/6 | Pam2/3CSK4, 1a, 1b | ischemia/reperfusion | induction of survival factor PI3K/PKB | (260) |
| TLR2/1 and TLR2/6 | Trumenba | meningococcal meningitis | induction of inflammation | (92) |
| TLR2/1 and TLR2/6 | PEG-Pam2Cys, 28 | malaria and infectious diseases | decrease in the number of parasites | (130) |
| TLR2/1 and TLR2/6 | UPam 72a | lung cancer | increased release of IL-12 and p40 | (177) |
| TLR2/1 and TLR2/6 | Diprovocim-1, 76 | melanoma | increased release of TNF-α | (181,183) |
| TLR2/1 and TLR2/6 | SMU-Z1, 77 | leukemia | NF-κB, TNF-α, IL-1β induction | (184) |
| TLR2/1 and TLR2/6 | Zymosan | diabetes | increased release of ROS | (284) |
| TLR3 | poly(I:C) | several viruses | immune system stimulation | (20) |
| TLR3 | poly(I:C) | E. coli | phagocytosis increasing the release of cyto-/chemokines and NO | (98) |
| TLR3 | poly(I:C) | MS | IFN-β and TNF-α induction | (225) |
| TLR3 | poly(I:C) | pulmonary hypertension | increased release of IL-10 | (269) |
| TLR3 | poly(I:C) | diabetic wounds | growth factors amplification | (312) |
| TLR3 | BM-06 | hepatocellular cell carcinoma | induction of apoptosis | (188) |
| TLR3 | Sevoflurane, 111 | cardiopulmonary bypass-induced injury | reduction of the apoptotic hippocampal neurons | (296) |
| TLR3 | poly(IC:LC) | IAV, RSV, SARS-CoV | stimulation of the immune system | (12) |
| TLR3 | poly(IC:LC) | HBV, HIV | increased expression of IFNs and stimulation of innate immune response | (15) |
| TLR3 | IPH-3102 | breast cancer | activation of NF-κB signaling pathway and induction of type I-IFN responses | (189) |
| TLR3 | poly(I:C12U) | MS | activation of IFNs and p68 | (32) |
| TLR4 | MPLA, 9 | cancer immunotherapy | Th-1-mediated immune response | (39) |
| TLR4 | MPLA, 9 | bacterial infections | increased resistance to bacteria | (102) |
| TLR4 | MPLA, 9 | AD | Aβ accumulation prevention | (302) |
| TLR4 | GLA, 68 | HIV | enhanced immunization | (3) |
| TLR4 | GLA, 68 | melanoma and sarcoma | DCs, monocytes, and macrophages stimulation | (3,170) |
| TLR4 | Sophoridine, 85 | gastric cancer | release of iNOS, IFN-β and IL-12α | (201) |
| TLR4 | 1Z105, 11 | IAV | regulation of TH1- and TH2-type immune response | (49) |
| TLR5 | Entolimod | hepatic cancer and melanoma | reduction of metastasis | (313) |
| TLR5 | Flagellin | S. pneumoniae | increased release of IL-6 and TNF-α | (85) |
| TLR7 | GSK2245035, 60 | inflammation | suppression of TH2-mediated cytokine responses to allergens | (163) |
| TLR7 | 61 | inflammation | IFNα induction | (164) |
| TLR7 | Imiquimod, 15 | several viruses | enhance the T cell response | (25) |
| TLR7 | Imiquimod, 15 | superficial basal cell carcinoma | IFN-α, IL-6 and TNF-α | (3) |
| TLR7 | SMIP-7.7 | HSV-2 | reduction of replication and enhancement of immune response | (58) |
| TLR7 | 86 | various cancers | induction of apoptosis | (203) |
| TLR7/8 | Resiquimod, 16 | HSV-2, HCV, HIV | reduction of replication and enhancement of immune response | (58,67) |
| TLR7/8 | 23 | HBV | reduction of replication | (72) |
| TLR7/8 | 852A, 65 | various cancers | reduction of metastasis | (170) |
| TLR8 | 62 | inflammation | reduction of cytokines | (165) |
| TLR8 | 63 | inflammation | induced TH1-biasing IFN-γ and IL-12 | (166) |
| TLR8/9 | CU-CPT17e, 88b | cervical cancer | induction of apoptosis | (217) |
| TLR9 | MGN 1703 | HIV | increased innate immune response | (78) |
| TLR9 | various CpG-ODNs | bacterial infections | pro-inflammatory cytokines induction and (TH1)-dependent immune response | (114) |
| TLR9 | various CpG-ODNs | neuroblastoma | induction of apoptosis | (170) |
| TLR9 | ODN2395 | bacterial pneumonia | enhanced mucosal T cells immune response | (117) |
| TLR9 | KSK-CpG | melanoma | increase activity of CTLs and NK cells, TH1 activation and IL-6 and IL-12 induction | (207) |
| TLR9 | CpG-1826 | glioma | tumor-associated macrophages, B cells, DCs and cytotoxic T cells induction | (212) |
| Antagonists | ||||
| TLR2/1 | CU-CPT22, 42 | macrophage inflammation | reduction of NF-κB signaling | (94) |
| TLR2/1 | SMU-8c, 44 | macrophage inflammation | down-regulation of NO and TNF-α | (314) |
| TLR2/1 | E567, 6 | HSV-1 | reduction of inflammation | (20) |
| TLR2/4 | Rabeximod, 92 | MS | reduction of EAE severity | (228) |
| TLR2/4 | Vitamin K2, 99 | atherosclerosis | inhibition of aortic intimal calcification | (267) |
| TLR2/6 | GIT2 | diabetes | decreased NF-κB and Nox4 levels | (281) |
| TLR3 | OAA, 46 | inflammation | reduction of the activation of NF-κB/MAPK/IKKα/β | (281) |
| TLR3/4 | Baclofen, 90 | MS | reduction of NF-κB and TNF-α levels | (229) |
| TLR3/4 | Auranofin, 94 | RA | reduction of NF-κB production | (243) |
| TLR3/4 | melatonin, 101 | liver ischemia | prevention of necrosis and apoptosis by balancing the endothelin-1/NO ratio | (261) |
| TLR4 | TAK-242, 34 | various inflammatory conditions | reduction of cytokines expression | (143,148) |
| TLR4 | TAK-242, 34 | RA | reduction of cytokines | (245) |
| TLR4 | TAK-242, 34 | neuroinflammation | suppression of LPS-induced microglial activation | (304) |
| TLR4 | IAXO series, 36a–36c | HIV, HSV, IAV | reduction of acute sepsis and acute lung injury | (12) |
| TLR4 | IAXO series, 36a–36c | abdominal aortic aneurysm | inhibition of MAPK and NF-κB p65 phosphorylation | (272) |
| TLR4 | Eritoran, 8 | sepsis | reduction of cytokines | (118,120) |
| TLR4 | CXC195, 80 | hepatocellular carcinoma | suppression of cytokines release (TNF-α, IL-1β, IL-6) | (192) |
| TLR4 | Triptolide, 82 | pancreatic cancer | reduction of NF-κB signaling and apoptosis promotion | (198) |
| TLR4 | LPS-RS | atherosclerosis | inhibition of monocytes and macrophages recruitment and collagen accumulation | (262) |
| TLR4 | CRX-526, 47 | diabetes | reduction of TGF-β overexpression and NF-κB activation | (287) |
| TLR7/8 | HCQ, 97 | RA, SLE, sepsis, HIV, IAV, DENV | suppression of autoantigen presentation and decreased cytokine production | (2,315) |
| TLR7/8 | CQ, 26 | RA, SLE, sepsis, HIV, IAV, DENV | suppression of autoantigen presentation and decreased cytokine production | (2,315) |
| TLR7/8 | SM934, 93 | inflammatory and autoimmune diseases | IFN-γ and IL-17 production | (2) |
| TLR8 | CU-CPT9a, 96 | inflammatory and autoimmune diseases | reduction of TNF-α | (247) |
| TLR8 | ST2825, 98 | SLE | blockage of the de novo generation of plasma cells and autoantibodies secretion | (258) |
| TLR8 | COV08-0064, 117 | PD | reduction of dopamine neurons degeneration | (311) |
To complement the data reported by Anwar et al., Table 2 summarizes the latest clinical trials launched in the last two years about TLR modulators. The majority of these studies are on infectious diseases and cancer. These studies exploited TLR modulators belonging to different classes, including poly(IC:LC), LPS, imdazoquinolines (Vesatolimod), and CPG-ODNs.(316)
Table 2. Summary of the Latest Clinical Trials Involving TLR Modulators
| TLR | modulator | activity | condition | phase | NCT |
|---|---|---|---|---|---|
| TLR3 | poly(IC:LC) | Agonist | melanoma vaccine | Phase 1 | NCT04364230 |
| TLR3 | poly(IC:LC) | Agonist | melanoma vaccine | Phase 2 | NCT04364230 |
| TLR3 | poly(I:C12U) | Agonist | breast cancer | Phase 1 | NCT04081389 |
| TLR4 | AS04 | Agonist | HIV infection | Phase 1 | NCT04301154 |
| TLR4 | AP 10-701 | Agonist | schistosomiasis | Phase 1 | NCT03910972 |
| TLR4 | AP 10-701 | Agonist | schistosomiasis | Phase 2 | NCT03910972 |
| TLR4 | GLA, 68 | Agonist | schistosomiasis | Phase 2 | NCT03799510 |
| TLR7 | Vesatolimod | Agonist | HIV infection | Phase 2 | NCT04364035 |
| TLR7 | Imiquimod, 15 | Agonist | inflammatory bowel disease | Phase 2 | NCT04083157 |
| TLR7 | Imiquimod, 15 | Agonist | Hepatitis B | Phase 3 | NCT04083157 |
| TLR8 | VTX-2337, 67 | Agonist | squamous cells carcinoma | Phase 1 | NCT03906526 |
| TLR9 | IMO-2125 | Agonist | melanoma | Phase 2 | NCT04126876 |
| TLR9 | SD-101 | Agonist | pancreatic cancer | Phase 1 | NCT04050085 |
With regard to the natural compounds reported herein as TLR ligands, they are summarized in Table 3. Note that they are, by a vast majority, represented by fragments of bacterial cell wall components, pathogenic nucleic acids, and other PAMPs or extracted from plants. This part also holds promise, from a medicinal chemistry perspective, and there is enough room for further improvements and discoveries. In our view, it is thus important to keep exploring the activity of new additional natural products, to assess their potential TLR modulatory activity and therapeutic effects.
Table 3. Summary of Natural-Derived Compounds Explored as TLR Modulators
| TLR | natural ligand | description | therapeutic indication | ref(s) |
|---|---|---|---|---|
| Agonists | ||||
| TLR2/1 and TLR2/6 | MALP-2, 2 | Lipopeptide isolated from Mycoplasma fermentas | antibacterial | (85) |
| TLR4 | Lipid A | membrane-anchoring moiety of LPS | not explored for any diseases due to toxicity | (39) |
| TLR4 | Lipid A | antifungal drug extracted from Streptomyces nodosus | antiviral | (54) |
| TLR4 | Amphotericin B, 13 | antifungal drug extracted from Streptomyces nodosus | antiviral | (54) |
| TLR4 | Diaporine, 84 | fungal metabolic product | breast cancer | (200) |
| TLR4 | Sophoridine, 85 | quinolizidine isolated from Sophora flavescens | antitumoral activity | (201) |
| TLR4 | PSP | extracted from Coriolus versicolor | antiviral | (50) |
| TLR4 | FimH | constituent of E. coli type 1 fimbriae | immune-stimulating activity against IAV and CVB3 | (52,53) |
| TLR5 | STF2 | Salmonella typhimurium flagellin | IAV as vaccines adjuvant | (3,20) |
| TLR5 | Flagellin | main component of bacterial flagella | anticancer and antibacterial activity | (85,313) |
| TLR9 | Oxymatrine, 27 | extracted from Sophora alopecuraides | chronic HBV patients | (79) |
| Antagonists | ||||
| TLR2/1 | Phloretin | polyphenol | anti-inflammatory | (145) |
| TLR2 and TLR4 | Soyasaponin I, 45 | soy derivative monodesmoside saponin | anti-inflammatory | (146) |
| TLR2 and TLR4 | Vitamin K2, 99 | human and bacterial metabolic product | atherosclerosis | (267) |
| TLR2 and TLR4 | Sparstolonin B, 38 Naringenin, 37 | chalcone | viral sepsis | (123,124,161) |
| TLR3 | OAA, 46 | triterpenoid derived from Vigna angulariz | anti-inflammatory | (147) |
| TLR3 and TLR4 | melatonin, 101 | human hormone | liver ischemia | (270) |
| TLR4 | Adenosine, Codycepin, HEA, 52a–c | extracted from mushroom Cordyceps cicadae | anti-inflammatory | (153) |
| TLR4 | Parthenolide, 53 | sesquiterpene lactone extracted from Tanacetum parthenium | anti-inflammatory | (154) |
| TLR4 | Palmitic acid, 102 | common saturated fatty acid found in animals, plants and microorganisms | CVDs | (271) |
| TLR4 | Rapamycin, 104 | isolated from Streptomyces hygroscopicus | diabetes | (290) |
| TLR4 | Curcumin, 105 | diarylheptanoid isolated from Curcuma longa | diabetes | (292) |
| TLR4 | Resveratrol, 108 | stilbenoid obtained from several plants | diabetes | (292) |
| TLR4 | Epigallocatechin gallate, 109 | catechin of tea | diabetes | (292) |
| TLR4 | Luteolin, 110 | flovonoid isolated from Reseda luteola | diabetes | (292) |
| TLR4 | Helenalin, 106 | sesquiterpene lactone isolated from Arnica montana | diabetes | (292) |
| TLR4 | Cinnamaldeyde, 107 | isolated from the bark of cinnamon tree | diabetes | (292) |
| TLR4 | Chlojaponilactone B, 54 | sesquiterpenoid extracted from Chloranthus japonicum | anti-inflammatory | (155) |
| TLR4 | Diethyl blechnic, 55 | extracted from Salvia miltiorrhiza | anti-inflammatory | (156) |
| TLR4 | Hypaphorine, 56 | indole alkaloid isolated Extracted from Caragana | anti-inflammatory | (158) |
| TLR4 | Dihydrotestosterone, 113 | androgen gonadal steroid | antineuroinflammatory | (306) |
| TLR4 | Hesperetin, 114 | flavanone isolated from Citrus | potential use in AD | (308) |
| TLR4 | 2,2′,5′-THC, 115 | chalcone derivatives | neuroprotection | (309) |
| TLR4 | Isoliquiritigenin, 116 | chalcone derivatives extracted from licorice | neuroprotection | (310) |
| TLR4 | Triptolide, 82 | diterpenoide isolated from Tripterygium wilfordii | antitumoral activity | (197,198) |
| TLR4 | Paeonol, 83 | phenolic compound | antitumoral activity | (199) |
The beneficial effects of TLR modulation have been extensively demonstrated against viral and bacterial infections, cancer, and autoimmune diseases. However, because of the ability of TLR to either ameliorate the progression of several diseases or worsen the inflammatory state, we must underline the importance of planning a wise therapeutic approach, which will not overactivate or overinhibit the immunomodulatory signaling. Among the most promising therapeutic options, combined therapies represent a valuable and widely explored approach. Recent studies also point in the direction of using combinations of multiple TLR agonists or TLR antagonists with appropriate pathway modulators. Accordingly, several reports and trials describe the benefits of the association of monoclonal antibodies, chemotherapeutics, or radiations with TLR modulators in cancer patients (NCT02643303, NCT01421017, etc.), as well as the association of TLR modulators and antiviral drugs (NCT00823862, NCT04225715).
The design of many clinical trials involving the use of TLR modulators, and the approval of some of these drugs by FDA and EMA, should encourage researchers to keep exploring these fascinating targets, in order to develop new and more potent modulators that may represent key pharmacological tools for the treatment of various human diseases. In this context, the evaluation of biological samples such as anti-TLR antibodies or TLR fragments peptide-conjugated is providing mounting evidence of their possible leading role in the development of specific, potent, and less-toxic TLR-modulators.(317,318) In this frame, the availability of modern computational protocols and chemoproteomic profiling may help researchers in the development of improved TLR modulators endowed with a safer profile to be also applied in personalized medicine.
The pandemic SARS-CoV-2 outbreak of December 2019 pulled researchers to join their efforts to find effective therapeutic approaches to eradicate this virus. In this context, we have previously discussed the implication of TLR3, TLR7, and TLR8 modulators against 2003 SARS-CoV. Furthermore, a possible correlation between TLRs and the new coronavirus has been recently discovered. Particularly, TLR2, TLR3, TLR7, and TLR8 of epithelial and myeloid cells can stimulate the production of antiviral pro-inflammatory mediators (IL-6, IL-8, IFNs), following the activation of NF-κB.(319) Moreover, a therapeutic role for TLR5 has been proposed very recently by Chakraborty et al.; it can be used as an immunomodulator that is able to activate the immune system to fight the SARS-CoV-2.(320) Interestingly, in a 2020 preprint research article, the use of a combination of inhaled 1a and CpG-ODNs in mice to stimulate their immune system against SARS-CoV-2 has been reported.(321) For these reasons, a wider exploration of TLRs and their modulators may drive the discovery of new potential drugs or vaccine adjuvants to be applied against SARS-CoV-2. As recently reported by Conti et al., the binding of SARS-CoV-2 to TLR2, TLR3, or TLR4 determines the release of inflammatory cytokines such as IFN-α, TNF, and IL-1. These mediators stimulate inflammasome activation and the production of active mature IL-1β, which is a mediator of fever, lung inflammation, and fibrosis. Hence, the inhibition of TLR-mediated inflammation could represent another therapeutic strategy in the management of SARS-CoV-2 infection.(322)
For some pathologies (e.g., diabetes and neurodegenerative disorders), the discovery of effective TLR modulators has been hampered by the lack of solid pharmacological models, and a clear understanding of the role of these receptors in the progression of the specific disease. In these cases, we advise that, in a repurposing-like approach, the application of known TLR modulators might contribute to establish the role of these receptors during disease progression, paving the way for the discovery of novel pharmacological tools and TLRs-based therapeutic options.
Author Information
ARTICLE SECTIONS
- Stefania Butini - Department of Biotechnology, Chemistry and Pharmacy, Department of Excellence 2018−2022, University of Siena, via Aldo Moro 2, 53100, Siena, Italy;
http://orcid.org/0000-0002-8471-0880;
- Giuseppe Campiani - Department of Biotechnology, Chemistry and Pharmacy, Department of Excellence 2018−2022, University of Siena, via Aldo Moro 2, 53100, Siena, Italy;http://orcid.org/0000-0001-5295-9529;
- Gabriele Carullo - Department of Biotechnology, Chemistry and Pharmacy, Department of Excellence 2018−2022, University of Siena, via Aldo Moro 2, 53100, Siena, Italy;http://orcid.org/0000-0002-1619-3295
- Sandra Gemma - Department of Biotechnology, Chemistry and Pharmacy, Department of Excellence 2018−2022, University of Siena, via Aldo Moro 2, 53100, Siena, Italy;http://orcid.org/0000-0002-8313-2417
- Nicola Relitti - Department of Biotechnology, Chemistry and Pharmacy, Department of Excellence 2018−2022, University of Siena, via Aldo Moro 2, 53100, Siena, Italy;http://orcid.org/0000-0001-9783-8966
These authors contributed equally
Biographies
ARTICLE SECTIONS
Stefano Federico
Stefano Federico obtained his Master’s Degree in Chemical and Pharmaceutical Sciences at the University of Siena in 2017, under the supervision of Prof. Stefania Butini. Since 2018, he has been working as a Ph.D. student (in Chemical and Pharmaceutical Sciences) at the same university, under the guidance of Prof. Giuseppe Campiani. His research activity involves the development of multistage drugs to fight poverty-related and neglected parasitic diseases, especially directed against Plasmodium, Leishmania, and Schistosoma life stages.
Luca Pozzetti
Luca Pozzetti graduated cum laude in Chemical and Pharmaceutical Sciences at University of Pavia in 2019 under the supervision of Prof. Simona Collina. He is currently pursuing his Ph.D. in Pharmaceutical Sciences at the University of Siena, mentored by Prof. Giuseppe Campiani. His research activity encompasses the development and application of analytical and synthetic methodologies for investigating nutraceutical products and bioactive molecules. Particularly, he is currently involved in the development of novel anticancer and antiparasitic agents.
Alessandro Papa
Alessandro Papa obtained his Master’s Degree in Chemical and Pharmaceutical Sciences in 2019 at University of Siena, under the supervision of Prof. Stefania Butini. He is currently pursuing his Ph.D. in Pharmaceutical Sciences at the University of Siena, under the supervision of Prof. Stefania Butini. His research activity is focused on the synthesis of novel compounds that are able to modulate the endocannabinoid system, control inflammation, and promote neuroprotection and myelin repair.
Gabriele Carullo
Gabriele Carullo obtained is Ph.D. in Translational Medicine-Design of New Therapeutic Tools, at the University of Calabria in 2020, with an international mobility period at the University of Seville. His research interests have focused on the development of GPR40 and GPR120 agonists, which are useful in type 2 diabetes and diabetic wounds, and also new KCa1.1 activators and Cav1.2 blockers for the treatment of hypertension, starting from natural products. Since 2020, he has been a Research Fellow in Medicinal Chemistry at the University of Siena, and he is involved in the research of new small molecules for the treatment of inherited retinal diseases.
Sandra Gemma
Sandra Gemma is an Associate Professor of Medicinal Chemistry at the University of Siena. She graduated in Chemical and Pharmaceutical Sciences at the University of Siena in 1998, where she also received her Ph.D. degree (2003). She was a postdoctoral fellow at the Department of Chemistry at the University of Illinois at Chicago in the research group of Prof. Arun K. Ghosh. She also visited the Department of Chemistry at Purdue University as a research assistant in the Ghosh group. Her research activity is currently focused on the structure- and ligand-based design and synthesis of therapeutic agents, comprising anti-infective and antiparasitic compounds, anticancer agents, and compounds active at the CNS. She has authored more than 100 papers in these fields.
Stefania Butini
Stefania Butini is an Associate Professor of Medicinal Chemistry at the University of Siena. She graduated from the University of Siena in 1997 and obtained her Ph.D. in Pharmaceutical Sciences in 2000. From 1999 to 2000, she interned at the University of Groningen, in The Netherlands, working on the development of novel agents for the treatment of Parkinson’s disease, under the supervision of H. W. Wikström. In 2004, she was appointed as a Senior Researcher at the University of Siena. Her research activity (reported in more than 110 manuscripts) includes target selection, rational design of innovative drugs, the development of new synthetic methodologies, and structure–activity relationship studies, with a primary focus on CNS diseases, as well as antiparasitic and antitumor agents.
Giuseppe Campiani
Giuseppe Campiani is a full professor of Medicinal Chemistry at the University of Siena. After his Ph.D. in Pharmaceutical Sciences, Dr. Campiani performed postdoctoral research at Mayo Clinic Jacksonville, in the group directed by Prof. Alan Kozikowski, and at Columbia University in New York City, working in Koji Nakanishi’s research group. He was also appointed as a Visiting Professor at Trinity College Dublin. Dr. Campiani is presently leading a drug discovery research group at the Department of Excellence of Biotechnology, Chemistry, and Pharmacy at the University of Siena. His broad interest in medicinal chemistry and drug discovery encompasses the development of modulators of epigenetic targets and the discovery of biologically active compounds to combat rare diseases, cancer, neuropsychiatric and neurodegenerative disorders, and infectious diseases.
Nicola Relitti
Nicola Relitti obtained his Ph.D. in Chemical and Pharmaceutical Sciences at the University of Siena in 2016. His research focused on the development of novel antiparasitic compounds. He later went on to pursue postdoctoral research at Purdue University (2016–2018), where he developed novel anticancer agents. Since 2018, Dr. Relitti has been a postdoctoral researcher at the University of Siena, involved in the research of new antitumoral and modulators of the autophagic process of esophageal squamous cell carcinoma.
Acknowledgments
ARTICLE SECTIONS
We acknowledge MIUR Grant Dipartimento di Eccellenza (N0. 2018–2022 (l. 232/2016)) to the Department of Biotechnology, Chemistry and Pharmacy, University of Siena and the Tuscany strategic project (No. POR-FSE 2014 to 2020), “Medicina di Precisione e Malattie Rare” (MePreMaRe), (ACE-ESCC). This work was supported by Ministero dell’Istruzione, dell’Università e della Ricerca (MIUR) PRIN Project No. 20154JRJPP.
| Abbreviations Used | |
| Abs | autoantibodies |
| AD | Alzheimer’s disease |
| AGPs | aminoalkylglucosaminide 4-phosphates |
| ALI | acute lung injury |
| AMOs | anti-miRNA oligonucleotides |
| AmpB | amphotericin B |
| AP1 | activated protein 1 |
| APCs | antigen-presenting cells |
| AS04 | adjuvant system 04 |
| Aβ | β-amyloid |
| KA | kainic acid |
| Bax | Bcl-2-associated X protein |
| CCL3 | chemokine (C–C motif) ligand 3 |
| CD80 | cluster of differentiation 80 |
| CHIKV | Chikungunya virus |
| CLRs | C-type lectin receptors |
| CNS | central nervous system |
| COPD | chronic obstructive pulmonary disease |
| COX2 | cyclooxygenase 2 |
| CpG | cytosine–phosphate–guanine |
| CQ | chloroquine |
| CTLs | cytotoxic T lymphocytes |
| CVB3 | coxsackievirus B3 |
| CVDs | cardiovascular diseases |
| DAMPs | damage-associated molecular patterns |
| DCs | dendritic cells |
| DENV | Dengue virus |
| EAE | experimental autoimmune encephalitis |
| EBOV | Ebola virus |
| EBV | Epstein-Barr virus |
| ECD | extracellular domain |
| ECs | endothelial cells |
| EMCV | encephalomyocarditis virus |
| EnanDIM | enantiomeric DNA-based immunomodulators |
| EV-A71 | enterovirus-A71 |
| FimH | Fimbriae H |
| FLS | fibroblast-like synoviocytes |
| G-CSF | granulocyte-colony stimulating factor |
| GEM | gemcitabine |
| GLA | glucopyranosyl lipid adjuvant |
| GM-CSF | granulocyte macrophage colony stimulating factor |
| GN | glomerulonephritis |
| GXM | glucuronoxylomannan |
| HAdV | human adenovirus |
| HBsAg | hepatitis B antigen |
| HBV | hepatitis B virus |
| HCMV | human cytomegalovirus |
| HCQ | hydroxychloroquine |
| HCV | hepatitis C virus |
| HEA | N6-(2-hydroxyethyl)-adenosine |
| HEV | hepatitis E virus |
| HFD | high fatty diet |
| I/R | ischemia/reperfusion |
| HIV | human immunodeficiency virus |
| HPV | human papilloma virus |
| HSP | heat shock protein |
| HSV | Herpes Simplex virus |
| HTLV-1 | human T-lymphotropic virus type 1 |
| HV | Hantaan virus |
| i.p. | intraperitoneal |
| i.v. | intravenous |
| IAV | influenza A virus |
| IC:LC | interstitial cajal-like cell |
| ICAM-1 | intracellular adhesion molecule-1 |
| IFNs | interferons |
| Ig | immunoglobulin |
| IKKα | IκB kinase α |
| p38 | protein 38 |
| IL | interleukin |
| IMOs | immune modulatory oligonucleotides |
| IMQ | imiquimod |
| iNOS | inducible nitric oxide synthase |
| IRAKs | IL-1 R-associated kinase |
| IRF-3 | IFN-regulatory factor 3 |
| IκB | inhibitor of κB |
| JEV | Japanese encephalitis virus |
| JNK | c-Jun-N-terminal kinase |
| KO | knockout |
| KSHV | Kaposi’s sarcoma-associated herpesvirus |
| LDLr | low density lipoprotein receptors |
| LEC | lowest effective concentration |
| LMMGFs | low molecular weight mannogalactofucans |
| LOS | lipooligosaccharides |
| LPS | lipopolysaccharides |
| LRR9 | leucine-rich repeat 9 |
| MAL | MyD88 adapter-like protein |
| MALP-2 | microsomal lipopeptide macrophage activating lipopeptide 2 |
| MamA | mammaglobin-A |
| MAPK | mitogen-activated protein kinase |
| MCP-1, VCAM-1 | vascular cell adhesion molecule-1 |
| MD2 | myeloid differentiation 2 |
| MDA5 | melanoma differentiation-associated protein 5 |
| MGCs | mannoside glycolipid conjugates |
| MHC | major histocompatibility complex |
| MMP | matrix metallo-proteinases |
| MPLA | monophosphoryl lipid A |
| MS | multiple sclerosis |
| mTOR | mammalian target of rapamycin |
| MyD88 | myeloid differentiation primary response protein 88 |
| NEMO | NF-κB essential modulator |
| p68 | protein kinase 68 |
| NF-κB | nuclear factor κB |
| NK | natural killer |
| NO | nitric oxide |
| NODs | domain-like receptors |
| Nox | NADPH oxidase |
| NS3 | nonstructural protein 3 |
| OAA | oleanoic acid acetate |
| ODNs | oligodeoxynucleotides |
| ORNs | oligoribonucleotides |
| Pam | palmitoyl |
| Pam2Cys | S-[2,3-bis(palmitoyloxy)propyl] cysteine |
| Pam3cys | S-[2,3-bis(palmitoyloxy)propyl]-N-palmitoyl-cysteine |
| PAMPs | pathogen-associated molecular patterns |
| PBMCs | human peripheral blood mononuclear cells |
| PCs | phosphatidylcholines |
| PD | Parkinson’s disease |
| PD1 | programmed cell death protein 1 |
| PD-L1 | antiprogrammed dead ligand 1 |
| PEG-Pam2Cys | pegylated Pam2Cys |
| PGE2 | prostaglandin E2 |
| poly(I:C) | polyinosinic:polycytidylic acid |
| PRRs | pattern recognition receptors |
| PSP | Polysaccharide peptide |
| PTV | Punta Toro virus |
| RA | rheumatoid arthritis |
| RABV | rabies virus |
| RFA | radio-frequency ablation |
| RIP1 | receptor interacting protein 1 |
| RIPK-1 | receptor interacting protein kinase 1 |
| RLRs | RIG-1 like receptors |
| ROS | reactive oxygen species |
| RSV | respiratory syncytial virus |
| SAR | structure–activity relationship |
| SARS-CoV | severe acute respiratory syndrome-corona virus |
| SFs | synovial fibroblasts |
| SIV | simian immunodeficiency virus |
| SLE | systemic lupus erythematosus |
| SLPs | synthetic long peptides |
| SMs | synovial macrophages |
| SNP | single nucleotide polymorphisms |
| STAT3 | signal transducer and activator of transcription 3 |
| T2DM | type 2 diabetes mellitus |
| TAA | tumor-associated antigen |
| TAK1 | transforming growth factor β-activated kinase |
| TAMs | tumor-associated macrophages |
| TBEV | tick-borne encephalitis virus |
| TGF-β1 | transforming growth factor-β1 |
| TH1 | T helper 1 |
| TIR | toll/IL-1 receptor |
| TLRs | toll-like receptors |
| TNF | tumor necrosis factor |
| TRAF6 | TNF receptor-associated factor 6 |
| TRAM | TRIF-related adapter molecule |
| TRIF | TIR-domain-containing adapter-inducing IFN-β |
| VSMCs | vascular smooth muscles |
| VSV | vesicular stomatitis virus |
| VV | vaccinia virus |
| LCMV | lymphocytic choriomeningitis virus |
| VZV | Varicella Zoster virus |
| WNV | West Nile virus |
| YFV | yellow fever virus |
| ZIKV | Zika virus |
References
ARTICLE SECTIONS
This article references 322 other publications.
- 1Khajeh Alizadeh Attar, M.; Anwar, M. A.; Eskian, M.; Keshavarz-Fathi, M.; Choi, S.; Rezaei, N. Basic Understanding and Therapeutic Approaches to Target Toll-like Receptors in Cancerous Microenvironment and Metastasis. Med. Res. Rev. 2018, 38 (5), 1469– 1484, DOI: 10.1002/med.21480[Crossref], [PubMed], [CAS], Google Scholar1https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC1Mzls1yhtg%253D%253D&md5=259501dd81d0c7f758c94da001bacda7Basic understanding and therapeutic approaches to target toll-like receptors in cancerous microenvironment and metastasisKhajeh Alizadeh Attar Mojtaba; Eskian Mahsa; Keshavarz-Fathi Mahsa; Khajeh Alizadeh Attar Mojtaba; Keshavarz-Fathi Mahsa; Anwar Muhammad Ayaz; Choi Sangdun; Eskian Mahsa; Keshavarz-Fathi Mahsa; Rezaei Nima; Eskian Mahsa; Rezaei Nima; Rezaei Nima; Rezaei NimaMedicinal research reviews (2018), 38 (5), 1469-1484 ISSN:.Toll-like receptors (TLRs) are transmembrane components that sense danger signals, like damage- and pathogen-associated molecular pattern molecules, as receptors, and maintain homeostasis in tissues. They are mainly involved in immune system activation through a variety of mediators, which either carry out (1) elimination of pathogenic threats and redressing homeostatic imbalances or (2) contribution to the initiation and worsening of pathological conditions, including cancers. Under physiological conditions, TLRs coordinate the innate and adaptive immunity, and inhibit autoimmune disorders. In pathological conditions, such as cancer, they can present both tumor and receptor-specific roles. Although the roles of individual TLRs in various cancers have been described, the effects of targeting TLRs to treat cancer and prevent metastasis are still controversial. A growing body of literature has suggested contribution of both activators and inhibitors of TLR signaling pathway for cancer treatment, dependent on several context-specific factors. In short, TLRs can play dual roles with contradictory outcomes in neoplastic conditions. This hampers the development of TLR-based therapeutic interventions. A better understanding of the interwoven TLR pathways in cancerous microenvironment is necessary to design TLR-based therapies. In this review, we consider the molecular mechanisms of TLRs signaling and their involvement in tumor progression. Therapeutic modalities targeting TLRs for cancer treatment are discussed as well.
- 2Patinote, C.; Karroum, N. B.; Moarbess, G.; Cirnat, N.; Kassab, I.; Bonnet, P. A.; Deleuze-Masquéfa, C. Agonist and Antagonist Ligands of Toll-like Receptors 7 and 8: Ingenious Tools for Therapeutic Purposes. Eur. J. Med. Chem. 2020, 193, 112238, DOI: 10.1016/j.ejmech.2020.112238[Crossref], [PubMed], [CAS], Google Scholar2https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXlsVWjt74%253D&md5=d11400c9ed60056bd0d33861aaeb5dbaAgonist and antagonist ligands of toll-like receptors 7 and 8: Ingenious tools for therapeutic purposesPatinote, Cindy; Karroum, Nour Bou; Moarbess, Georges; Cirnat, Natalina; Kassab, Issam; Bonnet, Pierre-Antoine; Deleuze-Masquefa, CarineEuropean Journal of Medicinal Chemistry (2020), 193 (), 112238CODEN: EJMCA5; ISSN:0223-5234. (Elsevier Masson SAS)A review. The discovery of the TLRs family and more precisely its functions opened a variety of gates to modulate immunol. host responses. TLRs 7/8 are located in the endosomal compartment and activate a specific signaling pathway in a MyD88-dependant manner. According to their involvement into various autoimmune, inflammatory and malignant diseases, researchers have designed diverse TLRs 7/8 ligands able to boost or block the inherent signal transduction. These modulators are often small synthetic compds. and most act as agonists and to a much lesser extent as antagonists. Some of them have reached preclin. and clin. trials, and only one has been approved by the FDA and EMA, imiquimod. The key to the success of these modulators probably lies in their combination with other therapies as recently demonstrated. We gather in this review more than 360 scientific publications, reviews and patents, relating the extensive work carried out by researchers on the design of TLRs 7/8 modulators, which are classified firstly by their biol. activities (agonist or antagonist) and then by their chem. structures, which total syntheses are not discussed here. This review also reports about 90 clin. cases, thereby showing the biol. interest of these modulators in multiple pathologies.
- 3Anwar, M. A.; Shah, M.; Kim, J.; Choi, S. Recent Clinical Trends in Toll-like Receptor Targeting Therapeutics. Med. Res. Rev. 2019, 39 (3), 1053– 1090, DOI: 10.1002/med.21553[Crossref], [PubMed], [CAS], Google Scholar3https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXntlGksbs%253D&md5=525a0020ddcf3bfd585e51a4f93e0265Recent clinical trends in Toll-like receptor targeting therapeuticsAnwar, Muhammad Ayaz; Shah, Masaud; Kim, Jason; Choi, SangdunMedicinal Research Reviews (2019), 39 (3), 1053-1090CODEN: MRREDD; ISSN:0198-6325. (John Wiley & Sons, Inc.)A review. Toll-like receptors (TLRs) are germline-encoded receptors that are central to innate and adaptive immune responses. Owing to their vital role in inflammation, TLRs are rational targets in clinics; thus, many ligands and biologics have been reported to overcome the progression of various inflammatory and malignant conditions and support the immune system. For each TLR, at least one, and often many, drug formulations are being evaluated. Ligands reported as stand-alone drugs may also be reported based on their use in combinatorial therapeutics as adjuvants. Despite their profound efficacy in TLR-modulation in preclin. studies, multiple drugs have been terminated at different stages of clin. trials. Here, TLR modulating drugs that have been evaluated in clin. trials are discussed, along with their mode of action, suggestive failure reasons, and ways to improve the clin. outcomes. This review presents recent advances in TLR-targeting drugs and provides directions for more successful immune system manipulation.
- 4Wang, Y.; Zhang, S.; Li, H.; Wang, H.; Zhang, T.; Hutchinson, M. R.; Yin, H.; Wang, X. Small-Molecule Modulators of Toll-like Receptors. Acc. Chem. Res. 2020, 53, 1046, DOI: 10.1021/acs.accounts.9b00631[ACS Full Text
], [CAS], Google Scholar4https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXlvFKqsrk%253D&md5=ff47634564c8a4229ca8431a9c4b283fSmall-Molecule Modulators of Toll-like ReceptorsWang, Yibo; Zhang, Shuting; Li, Hongyuan; Wang, Hongshuang; Zhang, Tianshu; Hutchinson, Mark R.; Yin, Hang; Wang, XiaohuiAccounts of Chemical Research (2020), 53 (5), 1046-1055CODEN: ACHRE4; ISSN:0001-4842. (American Chemical Society)A review. Conspectus: Toll-like receptors (TLRs) are the "gatekeepers" of the immune system in humans and other animals to protect the host from invading bacteria, viruses, and other microorganisms. Since TLR4 was discovered as the receptor for endotoxin in the late 1990s, significant progress has been made in exploiting an understanding of the function of TLRs. The TLR-signaling pathway is crucial for the induction and progression of various diseases. Dysregulation of TLR signaling contributes to numerous pathol. conditions, including chronic inflammation, sepsis, cancers, asthma, neuropathic pain, drug addiction, and autoimmune diseases. Therefore, manipulation of TLR signaling is promising to halt their activity in inflammatory diseases, to enhance their signaling to fight cancers, to modulate their role in autoimmune diseases, and to suppress them to treat drug addiction. TLR agonists have demonstrated great potential as antimicrobial agents and vaccine adjuvants, whereas TLR antagonists are being developed as reagents and drugs to dampen immune responses. Because of their pivotal potential therapeutic applications, fruitful small-mol. compds. and peptide fragments have been discovered, and many of them have advanced to various stages of clin. trials (though only two have been approved by the Food and Drug Administration (FDA): MPLA as a TLR4 agonist and imiquimod as a TLR7 agonist). In this Account, we focus on the progress in developing TLR signaling pathway modulators (mainly focused on the Yin and Wang labs.) over the past decade and highlight the accomplishments and currently existing challenges in the development of TLR modulators. First, we briefly describe the members of the human TLR family along with their natural modulators. Second, we illustrate our endeavors to discover TLR-targeted agents using comprehensive approaches. Specifically, a discussion of identification and characterization of new chem. entities, detn. of modes of action, and further applications is presented. For instance, the TLR3 antagonist was first discovered through in silico screening, and the inhibitory activity was confirmed in murine cells. Considering the glycosylation on TLR3, a new direction for TLR3 modulator design was pointed out to target asparagine glycosylation. We have particularly focused on the discovery of TLR4 antagonists and have assessed their great potential in the clin. treatment of drug addiction and alc. use disorders. In addn., we discuss multiple other popular and robust techniques for modulator discovery. Not only small org. modulators but also stapled peptides and peptidomimetics will attract more and more attention in the future. Finally, current challenges, opportunities, and future perspectives for TLR-targeted agents are also discussed. - 5Xu, Y.; Tao, X.; Shen, B.; Horng, T.; Medzhitov, R.; Manley, J. L.; Tong, L. Structural Basis for Signal Transduction by the Toll/Interleukin-1 Receptor Domains. Nature 2000, 408 (6808), 111– 115, DOI: 10.1038/35040600[Crossref], [PubMed], [CAS], Google Scholar5https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD3cXotVaksLc%253D&md5=3d546f7c6dd43407b5ed063a47bdde93Structural basis for signal transduction by the Toll/interleukin-1 receptor domainsXu, Yingwu; Tao, Xiao; Shen, Baohe; Horng, Tiffany; Medzhitov, Ruslan; Manley, James L.; Tong, LiangNature (London) (2000), 408 (6808), 111-115CODEN: NATUAS; ISSN:0028-0836. (Nature Publishing Group)Toll-like receptors (TLRs) and the interleukin-1 receptor super-family (IL-1Rs) are integral to both innate and adaptive immunity for host defense. These receptors share a conserved cytoplasmic domain, known as the TIR domain. A single-point mutation in the TIR domain of murine TLR4 (Pro712His, the Lpsd mutation) abolishes the host immune response to lipopolysaccharide (LPS), and mutation of the equiv. residue in TLR2, Pro681His, disrupts signal transduction in response to stimulation by yeast and Gram-pos. bacteria. Here the authors report the crystal structures of the TIR domains of human TLR1 and TLR2 and of the Pro681His mutant of TLR2. The structures have a large conserved surface patch that also contains the site of the Lpsd mutation. Mutagenesis and functional studies confirm that residues in this surface patch are crucial for receptor signaling. The Lpsd mutation does not disturb the structure of the TIR domain itself. Instead, structural and functional studies indicate that the conserved surface patch may mediate interactions with the down-stream MyD88 adapter mol., and that the Lpsd mutation may abolish receptor signaling by disrupting this recruitment.
- 6Marciani, D. J. Vaccine Adjuvants: Role and Mechanisms of Action in Vaccine Immunogenicity. Drug Discovery Today 2003, 8 (20), 934– 943, DOI: 10.1016/S1359-6446(03)02864-2[Crossref], [PubMed], [CAS], Google Scholar6https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD3sXnvFSiu7o%253D&md5=6be25370fd9755fc3fb78be4d6de31b8Vaccine adjuvants: role and mechanisms of action in vaccine immunogenicityMarciani, Dante J.Drug Discovery Today (2003), 8 (20), 934-943CODEN: DDTOFS; ISSN:1359-6446. (Elsevier Science Ltd.)A review. Inactivated vaccines require adjuvants to stimulate an immune response. The choice of adjuvant or immune enhancer dets. whether the immune response is effective, ineffective or damaging. Accordingly, there is a need for new adjuvants that stimulate the appropriate immunity, for example, T cell immunity for intracellular pathogens and cancer vaccines. In several adjuvants, the identification of chem. groups that interact with specific cell toll-like receptors (innate immunity) or receptors for co-stimulatory ligands (adaptive immunity), has enabled the establishment of structure-function relationships that are useful in the design of new adjuvants. Because of the crucial immunomodulating role of adjuvants, sub-unit vaccine development will remain dependent on new adjuvants. Adjuvants are crucial for an effective vaccine immunoresponse. Elucidation of functional groups that are responsible for immunomodulation enables the rational design of novel adjuvants that are useful in preventive and therapeutic vaccines.
- 7Halperin, S. A.; Dobson, S.; McNeil, S.; Langley, J. M.; Smith, B.; McCall-Sani, R.; Levitt, D.; Van Nest, G.; Gennevois, D.; Eiden, J. J. Comparison of the Safety and Immunogenicity of Hepatitis B Virus Surface Antigen Co-Administered with an Immunostimulatory Phosphorothioate Oligonucleotide and a Licensed Hepatitis B Vaccine in Healthy Young Adults. Vaccine 2006, 24 (1), 20– 26, DOI: 10.1016/j.vaccine.2005.08.095[Crossref], [PubMed], [CAS], Google Scholar7https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2MXht1Oksr7F&md5=77f1b28b74aaf8de735dcef6a9c9aae9Comparison of the safety and immunogenicity of hepatitis B virus surface antigen co-administered with an immunostimulatory phosphorothioate oligonucleotide and a licensed hepatitis B vaccine in healthy young adultsHalperin, Scott A.; Dobson, Simon; McNeil, Shelly; Langley, Joanne M.; Smith, Bruce; McCall-Sani, Robyn; Levitt, Dan; Van Nest, Gary; Gennevois, Daniel; Eiden, Joseph J.Vaccine (2006), 24 (1), 20-26CODEN: VACCDE; ISSN:0264-410X. (Elsevier B.V.)Background: Many individuals do not respond to a three-dose series of hepatitis B vaccine (HBV) and most do not achieve a protective antibody response until after dose 2 or 3. Methods: Healthy, seroneg. 18-28 yr old adults were randomly assigned in equal nos. to receive two doses of the exptl. vaccine (HBV-ISS without alum) (0, 8 wk) and placebo (24 wk) or Engerix-B (0, 8, 24 wk). Adverse events were collected during the first week and at 4 wk after each injection. Antibodies were measured 4 wk after dose 1; before, 1 and 4 wk after dose 2, and before, 1 and 4 wk after dose 3 and at 1 yr. Results: Ninety-nine participants were enrolled (65% female; mean age 22.6 years). 79% of HBV-ISS and 12% of Engerix-B recipients had a protective antibody response 4 wk post dose 1 (geometric mean concn. [GMC] 23.0 and 1.87 mIU/mL, resp.). By 1 wk post dose 2, 100% of HBV-ISS and 18% Engerix-B recipients had protective levels (GMC 1603 vs. 2.40 mIU/mL). Rates of adverse events were low and similar in both groups; headache and fatigue were the most common systemic adverse events in up to 1/3 of both groups. Mild injection-site tenderness was more common after HBV-ISS than Engerix-B after both doses (74-77% compared to 34-58%; p ≤ 0.029). Conclusions: Protective levels are achieved more quickly and after fewer doses of HBV-ISS than Engerix-B. HBV-ISS is well tolerated but assocd. with more mild injection-site tenderness than Engerix-B.
- 8Kanzler, H.; Barrat, F. J.; Hessel, E. M.; Coffman, R. L. Therapeutic Targeting of Innate Immunity with Toll-like Receptor Agonists and Antagonists. Nat. Med. 2007, 13 (5), 552– 559, DOI: 10.1038/nm1589[Crossref], [PubMed], [CAS], Google Scholar8https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2sXkvVOgsrs%253D&md5=5fcd32926d9b24f84ff9fd611dec2175Therapeutic targeting of innate immunity with Toll-like receptor agonists and antagonistsKanzler, Holger; Barrat, Franck J.; Hessel, Edith M.; Coffman, Robert L.Nature Medicine (New York, NY, United States) (2007), 13 (5), 552-559CODEN: NAMEFI; ISSN:1078-8956. (Nature Publishing Group)A review. The identification of the antigen recognition receptors for innate immunity, most notably the Toll-like receptors, has sparked great interest in therapeutic manipulation of the innate immune system. Toll-like receptor agonists are being developed for the treatment of cancer, allergies and viral infections, and as adjuvants for potent new vaccines to prevent or treat cancer and infectious diseases. As recognition grows of the role of inappropriate Toll-like receptor stimulation in inflammation and autoimmunity, significant efforts have begun to develop antagonists to Toll-like receptors as well.
- 9Kurt-Jones, E. A.; Popova, L.; Kwinn, L.; Haynes, L. M.; Jones, L. P.; Tripp, R. A.; Walsh, E. E.; Freeman, M. W.; Golenbock, D. T.; Anderson, L. J.; Finberg, R. W. Pattern Recognition Receptors TLR4 and CD14 Mediate Response to Respiratory Syncytial Virus. Nat. Immunol. 2000, 1 (5), 398– 401, DOI: 10.1038/80833[Crossref], [PubMed], [CAS], Google Scholar9https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD3cXnvVGht78%253D&md5=ce89033135ff579b641602cd70d65926Pattern recognition receptors TLR4 and CD14 mediate response to respiratory syncytial virusKurt-Jones, Evelyn A.; Popova, Lana; Kwinn, Laura; Haynes, Lia M.; Jones, Les P.; Tripp, Ralph A.; Walsh, Edward E.; Freeman, Mason W.; Golenbock, Douglas T.; Anderson, Larry J.; Finberg, Robert W.Nature Immunology (2000), 1 (5), 398-401CODEN: NIAMCZ; ISSN:1529-2908. (Nature America Inc.)The innate immune system contributes to the earliest phase of the host defense against foreign organisms and has both sol. and cellular pattern recognition receptors for microbial products. Two important members of this receptor group, CD14 and the Toll-like receptor (TLR) pattern recognition receptors, are essential for the innate immune response to components of Gram-neg. and Gram-pos. bacteria, mycobacteria, spirochetes and yeast. The authors now find that these receptors function in an antiviral response as well. The innate immune response to the fusion protein of an important respiratory pathogen of humans, respiratory syncytial virus (RSV), was mediated by TLR4 and CD14. RSV persisted longer in the lungs of infected TLR4-deficient mice compared to normal mice. Thus, a common receptor activation pathway can initiate innate immune responses to both bacterial and viral pathogens.
- 10Lester, S. N.; Li, K. Toll-like Receptors in Antiviral Innate Immunity. J. Mol. Biol. 2014, 426 (6), 1246– 1264, DOI: 10.1016/j.jmb.2013.11.024[Crossref], [PubMed], [CAS], Google Scholar10https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXhvFOgsrzF&md5=c58c0d532646cc9fa42ee0f2e291f257Toll-Like Receptors in Antiviral Innate ImmunityLester, Sandra N.; Li, KuiJournal of Molecular Biology (2014), 426 (6), 1246-1264CODEN: JMOBAK; ISSN:0022-2836. (Elsevier Ltd.)A review. Toll-like receptors (TLRs) are fundamental sensor mols. of the host innate immune system, which detect conserved mol. signatures of a wide range of microbial pathogens and initiate innate immune responses via distinct signaling pathways. Various TLRs are implicated in the early interplay of host cells with invading viruses, which regulates viral replication and/or host responses, ultimately impacting on viral pathogenesis. To survive the host innate defense mechanisms, many viruses have developed strategies to evade or counteract signaling through the TLR pathways, creating an advantageous environment for their propagation. Here we review the current knowledge of the roles TLRs play in antiviral innate immune responses, discuss examples of TLR-mediated viral recognition, and describe strategies used by viruses to antagonize the host antiviral innate immune responses.
- 11Carriere, J.; Rao, Y.; Liu, Q.; Lin, X.; Zhao, J.; Feng, P. Post-Translational Control of Innate Immune Signaling Pathways by Herpesviruses. Front. Microbiol. 2019, 10, 2647, DOI: 10.3389/fmicb.2019.02647[Crossref], [PubMed], [CAS], Google Scholar11https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB3Mfmt1yksw%253D%253D&md5=69c3c15b88490bc7aa17c2e439d6708fPost-translational Control of Innate Immune Signaling Pathways by HerpesvirusesCarriere Jessica; Rao Youliang; Liu Qizhi; Lin Xiaoxi; Zhao Jun; Feng PinghuiFrontiers in microbiology (2019), 10 (), 2647 ISSN:1664-302X.Herpesviruses constitute a large family of disease-causing DNA viruses. Each herpesvirus strain is capable of infecting particular organisms with a specific cell tropism. Upon infection, pattern recognition receptors (PRRs) recognize conserved viral features to trigger signaling cascades that culminate in the production of interferons and pro-inflammatory cytokines. To invoke a proper immune response while avoiding collateral tissue damage, signaling proteins involved in these cascades are tightly regulated by post-translational modifications (PTMs). Herpesviruses have developed strategies to subvert innate immune signaling pathways in order to ensure efficient viral replication and achieve persistent infection. The ability of these viruses to control the proteins involved in these signaling cascades post-translationally, either directly via virus-encoded enzymes or indirectly through the deregulation of cellular enzymes, has been widely reported. This ability provides herpesviruses with a powerful tool to shut off or restrict host antiviral and inflammatory responses. In this review, we highlight recent findings on the herpesvirus-mediated post-translational control along PRR-mediated signaling pathways.
- 12Patel, M. C.; Shirey, K. A.; Pletneva, L. M.; Boukhvalova, M. S.; Garzino-Demo, A.; Vogel, S. N.; Blanco, J. C. G. Novel Drugs Targeting Toll-like Receptors for Antiviral Therapy. Future Virol. 2014, 9 (9), 811– 829, DOI: 10.2217/fvl.14.70[Crossref], [PubMed], [CAS], Google Scholar12https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXhvVSrt73O&md5=285a60f9350d2a25526e03f821050a0eNovel drugs targeting Toll-like receptors for antiviral therapyPatel, Mira C.; Shirey, Kari Ann; Pletneva, Lioubov M.; Boukhvalova, Marina S.; Garzino-Demo, Alfredo; Vogel, Stefanie N.; Blanco, Jorge C. G.Future Virology (2014), 9 (9), 811-829CODEN: FVUIAM; ISSN:1746-0794. (Future Medicine Ltd.)A review. Toll-like receptors (TLRs) are sentinel receptors of the host innate immune system that recognize conserved 'pathogen-assocd. mol. patterns' of invading microbes, including viruses. The activation of TLRs establishes antiviral innate immune responses and coordinates the development of long-lasting adaptive immunity in order to control viral pathogenesis. However, microbe-induced damage to host tissues may release 'danger-assocd. mol. patterns' that also activate TLRs, leading to an overexuberant inflammatory response and, ultimately, to tissue damage. Thus, TLRs have proven to be promising targets as therapeutics for the treatment of viral infections that result in inflammatory damage or as adjuvants in order to enhance the efficacy of vaccines. Here, we explore recent advances in TLR biol. with a focus on novel drugs that target TLRs (agonists and antagonists) for antiviral therapy.
- 13Devhare, P. B.; Chatterjee, S. N.; Arankalle, V. A.; Lole, K. S. Analysis of Antiviral Response in Human Epithelial Cells Infected with Hepatitis E Virus. PLoS One 2013, 8 (5), e63793, DOI: 10.1371/journal.pone.0063793[Crossref], [PubMed], [CAS], Google Scholar13https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXnvFaisLo%253D&md5=4fd867f1f74f978e8d90adafa60ae176Analysis of antiviral response in human epithelial cells infected with hepatitis E virusDevhare, Pradip B.; Chatterjee, Subhashis N.; Arankalle, Vidya A.; Lole, Kavita S.PLoS One (2013), 8 (5), e63793CODEN: POLNCL; ISSN:1932-6203. (Public Library of Science)Hepatitis E virus (HEV) is a major cause of enterically transmitted acute hepatitis in developing nations and occurs in sporadic and epidemic forms. The disease may become severe with high mortality (20%) among pregnant women. Due to lack of efficient cell culture system and small animal model, early mol. events of HEV infection are not yet known. In the present study, human lung epithelial cells, A549, were infected with HEV to monitor expression levels of genes/proteins in antiviral pathways. Both live and UV inactivated virus elicited robust induction of inflammatory cytokines/chemokines such as IL-6, IL-8, TNF-α, and RANTES within 12 h of infection. Cells exposed to sol. capsid protein showed no induction suggesting the capsid structure and not the protein being detected as the pathogen pattern by cells. A delayed up-regulation of type I interferon genes only by the live virus at 48 h post HEV infection indicated the need of virus replication. However, absence of secreted interferons till 96 h suggested possible involvement of post-transcriptional regulation of type I IFN expression. HEV infected cells showed activation of both NF-κB and IRF3 transcription factors when seen at protein levels; however, reporter gene assays showed predominant expression via NF-κB promoter as compared to IRF3 promoter. Knockdown expts. done using siRNAs showed involvement of MyD88 and TRIF adaptors in generating antiviral response thus indicating role of TLR2, TLR4 and TLR3 in sensing viral mols. MAVS knockdown surprisingly enhanced only proinflammatory cytokines and not type I IFNs. This suggested that HEV not only down-regulates RIG-I helicase like receptor mediated IFN induction but also employs MAVS in curtailing host inflammatory response. Our findings uncover an early cellular response in HEV infection and assocd. mol. mechanisms suggesting the potential role of inflammatory response triggered by HEV infection in host immune response and pathogenesis.
- 14Martínez-Aguado, P.; Serna-Gallego, A.; Marrugal-Lorenzo, J. A.; Gómez-Marín, I.; Sánchez-Céspedes, J. Antiadenovirus Drug Discovery: Potential Targets and Evaluation Methodologies. Drug Discovery Today 2015, 20 (10), 1235– 1242, DOI: 10.1016/j.drudis.2015.07.007[Crossref], [PubMed], [CAS], Google Scholar14https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXht1Gru73O&md5=ecec72b654f0348637b1cb9bd465d10fAntiadenovirus drug discovery: potential targets and evaluation methodologiesMartinez-Aguado, Pablo; Serna-Gallego, Ana; Marrugal-Lorenzo, Jose A.; Gomez-Marin, Isabel; Sanchez-Cespedes, JavierDrug Discovery Today (2015), 20 (10), 1235-1242CODEN: DDTOFS; ISSN:1359-6446. (Elsevier Ltd.)Human adenoviruses (HAdV) are the cause of many acute infections, mostly in the respiratory and gastrointestinal (GI) tracts, as well as conjunctivitis. HAdV diseases in immunocompetent individuals are mostly self-limiting; however, in immunocompromised individuals, esp. in pediatric units, HAdV infections are the cause of high morbidity and mortality. Despite the significant clin. impact, there are currently no approved antiviral therapies for HAdV infections. Here, we provide an overview of the different targets that could be considered for the design of specific drugs against HAdV, as well as the available in vitro and in vivo tools for the screening and evaluation of candidate mols.
- 15Ma, Z.; Cao, Q.; Xiong, Y.; Zhang, E.; Lu, M. Interaction between Hepatitis B Virus and Toll-like Receptors: Current Status and Potential Therapeutic Use for Chronic Hepatitis B. Vaccines 2018, 6 (1), 6, DOI: 10.3390/vaccines6010006[Crossref], [CAS], Google Scholar15https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXnt1Kntbw%253D&md5=d01c582b647621d9b602fadcbfbf1cafInteraction between hepatitis B virus and toll-like receptors: current status and potential therapeutic use for chronic hepatitis BMa, Zhiyong; Cao, Qian; Xiong, Yong; Zhang, Ejuan; Lu, MengjiVaccines (Basel, Switzerland) (2018), 6 (1), 6/1-6/14CODEN: VBSABP; ISSN:2076-393X. (MDPI AG)Immune defense against infection with the hepatitis B virus (HBV) is complex and involves both host innate and adaptive immune systems. It is well accepted that the development of sufficient HBV-specific T cell and B cell responses are required for controlling an HBV infection. However, the contribution of innate immunity to removing HBV has been explored in recent years. Toll-like receptors (TLRs) are recognized as the first line of antiviral immunity because they initiate intracellular signaling pathways to induce antiviral mediators such as interferons (IFNs) and other cytokines. Recent studies show that the activation of TLR-mediated signaling pathways results in a suppression of HBV replication in vitro and in vivo. However, HBV has also evolved strategies to counter TLR responses including the suppression of TLR expression and the blockage of downstream signaling pathways. Antiviral treatment in chronic HBV-infected patients leads to an upregulation of TLR expression and the restoration of its innate antiviral functions. Thus, TLR activation may serve as an addnl. immunotherapeutic option for treating chronic HBV infection in combination with antiviral treatment.
- 16Du, K.; Liu, J.; Broering, R.; Zhang, X.; Yang, D.; Dittmer, U.; Lu, M. Recent Advances in the Discovery and Development of TLR Ligands as Novel Therapeutics for Chronic HBV and HIV Infections. Expert Opin. Drug Discovery 2018, 13 (7), 661– 670, DOI: 10.1080/17460441.2018.1473372[Crossref], [PubMed], [CAS], Google Scholar16https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXpslSksbw%253D&md5=b815b561b60f6f912260a37102e209bdRecent advances in the discovery and development of TLR ligands as novel therapeutics for chronic HBV and HIV infectionsDu, Keye; Liu, Jia; Broering, Ruth; Zhang, Xiaoyong; Yang, Dongliang; Dittmer, Ulf; Lu, MengjiExpert Opinion on Drug Discovery (2018), 13 (7), 661-670CODEN: EODDBX; ISSN:1746-0441. (Taylor & Francis Ltd.)A review. Toll-like receptor (TLR) ligands remain as promising antiviral drug candidates for the treatment of chronic viral infections. Basic research on the mechanisms of antiviral activity of TLR ligands in preclin. animal models and clin. testing of drug candidates have been carried out in recent years.: This review provides an overview of the preclin. and clin. testing of TLR ligands in two major viral infections: hepatitis B virus (HBV) and human immunodeficiency virus (HIV). Recent results have further demonstrated the potent antiviral activity of various TLR ligands . A TLR7 agonist is in clin. trials for the treatment of chronic HBV infection while a HBV vaccine using a TLR9 ligand as an adjuvant has proven to be superior to conventional HBV vaccines and has been approved for clin. use. Generally, TLR activation may achieve viral control mainly by promoting adaptive immunity to viral proteins.: Recent research in this field indicates that TLR ligands could be developed as clin. effective drugs if the obstacles concerning toxicity and application routes are overcome. TLR-mediated promotion of adaptive immunity is a major issue for future studies and will det. the future development of TLR ligands as drugs for immunomodulation.
- 17Jung, H. E.; Kim, T. H.; Lee, H. K. Contribution of Dendritic Cells in Protective Immunity against Respiratory Syncytial Virus Infection. Viruses 2020, 12 (1), 102, DOI: 10.3390/v12010102[Crossref], [CAS], Google Scholar17https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXmsVCqt7o%253D&md5=78d9b808f9f4ddd2c08c778fde329d7eContribution of dendritic cells in protective immunity against respiratory syncytial virus infectionJung, Hi Eun; Kim, Tae Hoon; Lee, Heung KyuViruses (2020), 12 (1), 102CODEN: VIRUBR; ISSN:1999-4915. (MDPI AG)A review. Respiratory syncytial virus (RSV) is a major cause of severe respiratory disease in infants and the elderly. The socioeconomic burden of RSV infection is substantial because it leads to serious respiratory problems, subsequent hospitalization, and mortality. Despite its clin. significance, a safe and effective vaccine is not yet available to prevent RSV infection. Upon RSV infection, lung dendritic cells (DCs) detecting pathogens migrate to the lymph nodes and activate the adaptive immune response. Therefore, RSV has evolved various immunomodulatory strategies to inhibit DC function. Due to the capacity of RSV to modulate defense mechanisms in hosts, RSV infection results in inappropriate activation of immune responses resulting in immunopathol. and frequent reinfection throughout life. This review discusses how DCs recognize invading RSV and induce adaptive immune responses, as well as the regulatory mechanisms mediated by RSV to disrupt DC functions and ultimately avoid host defenses.
- 18Jin, M. S.; Kim, S. E.; Heo, J. Y.; Lee, M. E.; Kim, H. M.; Paik, S. G.; Lee, H.; Lee, J. O. Crystal Structure of the TLR1-TLR2 Heterodimer Induced by Binding of a Tri-Acylated Lipopeptide. Cell 2007, 130 (6), 1071– 1082, DOI: 10.1016/j.cell.2007.09.008[Crossref], [PubMed], [CAS], Google Scholar18https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2sXhtFKnurvE&md5=3a610b4af1a57592a05a78dd53109105Crystal structure of the TLR1-TLR2 heterodimer induced by binding of a tri-acylated lipopeptideJin, Mi Sun; Kim, Sung Eun; Heo, Jin Young; Lee, Mi Eun; Kim, Ho Min; Paik, Sang-Gi; Lee, Hayyoung; Lee, Jie-OhCell (Cambridge, MA, United States) (2007), 130 (6), 1071-1082CODEN: CELLB5; ISSN:0092-8674. (Cell Press)TLR2 in assocn. with TLR1 or TLR6 plays an important role in the innate immune response by recognizing microbial lipoproteins and lipopeptides. Here the authors present the crystal structures of the human TLR1-TLR2-lipopeptide complex and of the mouse TLR2-lipopeptide complex. Binding of the tri-acylated lipopeptide, Pam3CSK4, induced the formation of an "m" shaped heterodimer of the TLR1 and TLR2 ectodomains whereas binding of the diacylated lipopeptide, Pam2CSK4, did not. The three lipid chains of Pam3CSK4 mediate the heterodimerization of the receptor; the two ester-bound lipid chains are inserted into a pocket in TLR2, while the amide-bound lipid chain is inserted into a hydrophobic channel in TLR1. An extensive hydrogen-bonding network, as well as hydrophobic interactions, between TLR1 and TLR2 further stabilize the heterodimer. The authors propose that formation of the TLR1-TLR2 heterodimer brings the intracellular TIR domains close to each other to promote dimerization and initiate signaling.
- 19Shukla, N. M.; Chan, M.; Hayashi, T.; Carson, D. A.; Cottam, H. B. Recent Advances and Perspectives in Small-Molecule TLR Ligands and Their Modulators. ACS Med. Chem. Lett. 2018, 9 (12), 1156– 1159, DOI: 10.1021/acsmedchemlett.8b00566[ACS Full Text], [CAS], Google Scholar19https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXitlKjurzL&md5=8575e9a1760c0360248ad088b38a24d4Recent Advances and Perspectives in Small-molecule TLR Ligands and Their ModulatorsShukla, Nikunj M.; Chan, Michael; Hayashi, Tomoko; Carson, Dennis A.; Cottam, Howard B.ACS Medicinal Chemistry Letters (2018), 9 (12), 1156-1159CODEN: AMCLCT; ISSN:1948-5875. (American Chemical Society)A review. Activation of Toll-like receptors (TLRs) located on immune cells leads to induction of immune responses that can be useful in vaccines for infectious diseases, cancer immunotherapy, and autoimmune diseases. Novel TLR signaling pathway modulators can further enhance the efficacy of TLR ligands.
- 20Shah, M.; Anwar, M. A.; Kim, J. H.; Choi, S. Advances in Antiviral Therapies Targeting Toll-like Receptors. Expert Opin. Invest. Drugs 2016, 25 (4), 437– 453, DOI: 10.1517/13543784.2016.1154040[Crossref], [PubMed], [CAS], Google Scholar20https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XjtlCiuro%253D&md5=81e771f844dcbd775f51e24ad04b2a5cAdvances in Antiviral Therapies Targeting Toll-like ReceptorsShah, Masaud; Anwar, Muhammad Ayaz; Kim, Jae-Ho; Choi, SangdunExpert Opinion on Investigational Drugs (2016), 25 (4), 437-453CODEN: EOIDER; ISSN:1354-3784. (Taylor & Francis Ltd.)Organisms have evolved a rapid and non-specific way to defend themselves via Toll-like receptors (TLRs), which recognize specific signatures present on invading microbes and viruses. Once detected, these receptors flood the cell with cytokines and IFNs that not only help to eradicate the invading viruses but also activate the adaptive immune response. Owing to difficulties in viral detection, a whole class of TLRs is dedicated to sensing viral nucleic acids, while other TLRs detect viral coat proteins and aid in establishing antiviral immunity. To protect humans better, TLRs and their downstream mediators can be used as potential drug targets, which can be either activated or inhibited, to counter viral infections. The current review focuses on TLR-targeting investigational drugs developed to treat viral diseases and virus-induced complications. TLRs are a good choice for eradicating viral infections because they can fine-tune the immune response. However, TLRs should be exploited carefully, as there have been instances where their activation has led to unwanted responses in terms of both immune and viral activation. Therefore, more focus should be placed on novel drugs that can induce significant and long-term immunity, while concomitantly alleviating side effects.
- 21Zhu, G.; Xu, Y.; Cen, X.; Nandakumar, K. S.; Liu, S.; Cheng, K. Targeting Pattern-Recognition Receptors to Discover New Small Molecule Immune Modulators. Eur. J. Med. Chem. 2018, 144, 82– 92, DOI: 10.1016/j.ejmech.2017.12.026[Crossref], [PubMed], [CAS], Google Scholar21https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXhvF2ntr7L&md5=dd71c03c5334ac994cbd0d987df28a9fTargeting pattern-recognition receptors to discover new small molecule immune modulatorsZhu, Gengzheng; Xu, Yao; Cen, Xiaohong; Nandakumar, Kutty Selva; Liu, Shuwen; Cheng, KuiEuropean Journal of Medicinal Chemistry (2018), 144 (), 82-92CODEN: EJMCA5; ISSN:0223-5234. (Elsevier Masson SAS)A review. Pattern recognition receptors (PRRs) are key immune receptors of the innate immune system, which recognize the conserved pathogen-assocd. mol. patterns (PAMPs) of the invading pathogens. Compared to the adaptive immune receptors, PRRs have three distinguishing features, viz., universal expression, fast response and recognizing many kinds of microbes. Toll-like receptors (TLRs), RIG-I-like receptors (RLRs), C-type lectin receptors (CLRs) and NOD-like receptors (NLRs) recognize viral nucleic acid/bacterial fragments and trigger anti-microbial innate immune responses. Upon recognition of their ligand species, PRRs recruit specific intracellular adaptor proteins to initiate signaling pathways culminating in the activation of nuclear factor-κB (NF-κB), mitogen-activated protein (MAP) kinases and interferon regulatory factors (IRFs) that control the transcription of genes encoding pro-inflammatory factors including type I interferon and other inflammatory cytokines, which are crit. for eliminating the potential threat to the host. Here, we summarize the effects of small mol. regulators acting on signaling pathways initiated by TLR, RLR and NLR as well as their influence on innate and adaptive immune responses leading to therapy.
- 22Lucifora, J.; Bonnin, M.; Aillot, L.; Fusil, F.; Maadadi, S.; Dimier, L.; Michelet, M.; Floriot, O.; Ollivier, A.; Rivoire, M.; Ait-Goughoulte, M.; Daffis, S.; Fletcher, S. P.; Salvetti, A.; Cosset, F. L.; Zoulim, F.; Durantel, D. Direct Antiviral Properties of TLR Ligands against HBV Replication in Immune-Competent Hepatocytes. Sci. Rep. 2018, 8 (1), 1– 11, DOI: 10.1038/s41598-018-23525-w[Crossref], [PubMed], [CAS], Google Scholar22https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhs1KrtrnK&md5=19d8422d0938b31218753f3bd5a648b8Direct antiviral properties of TLR ligands against HBV replication in immune-competent hepatocytesLucifora, Julie; Bonnin, Marc; Aillot, Ludovic; Fusil, Floriane; Maadadi, Sarah; Dimier, Laura; Michelet, Maud; Floriot, Oceane; Ollivier, Anais; Rivoire, Michel; Ait-Goughoulte, Malika; Daffis, Stephane; Fletcher, Simon P.; Salvetti, Anna; Cosset, Francois-Loic; Zoulim, Fabien; Durantel, DavidScientific Reports (2018), 8 (1), 1-11CODEN: SRCEC3; ISSN:2045-2322. (Nature Research)Current therapies for chronic hepatitis B virus (HBV) infections are effective at decreasing the viral load in serum, but do not lead to viral eradication. Recent studies highlighted the therapeutic or "adjuvant" potential of immune-modulators. Our aim was to explore the direct anti-HBV effect of Toll-Like-Receptors (TLR) agonists in hepatocytes. HBV-infected primary human hepatocytes (PHH) or differentiated HepaRG cells (dHepaRG) were treated with various TLR agonists. Amongst all TLR ligands tested, Pam3CSK4 (TLR1/2-ligand) and poly(I:C)-(HMW) (TLR3/MDA5-ligand) were the best at reducing all HBV parameters. No or little viral rebound was obsd. after treatment arrest, implying a long-lasting effect on cccDNA. We also tested Riboxxol that features improved TLR3 specificity compared to poly(I:C)-(HMW). This agonist demonstrated a potent antiviral effect in HBV-infected PHH. Whereas, poly(I:C)-(HMW) and Pam3CSK4 mainly induced the expression of classical genes from the interferon or NF-κB pathway resp., Riboxxol had a mixed phenotype. Moreover, TLR2 and TLR3 ligands can activate hepatocytes and immune cells, as demonstrated by antiviral cytokines produced by stimulated hepatocytes and peripheral blood mononuclear cells. In conclusion, our data highlight the potential of innate immunity activation in the direct control of HBV replication in hepatocytes, and support the development of TLR-based antiviral strategies.
- 23Kim, W. J.; Choi, J. W.; Jang, W. J.; Kang, Y. S.; Lee, C. W.; Synytsya, A.; Park, Y. Il. Low-Molecular Weight Mannogalactofucans Prevent Herpes Simplex Virus Type 1 Infection via Activation of Toll-like Receptor 2. Int. J. Biol. Macromol. 2017, 103, 286– 293, DOI: 10.1016/j.ijbiomac.2017.05.060[Crossref], [PubMed], [CAS], Google Scholar23https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXotF2ms74%253D&md5=7597f7f3178373521bc88fc2ca4af9baLow-molecular weight mannogalactofucans prevent herpes simplex virus type 1 infection via activation of Toll-like receptor 2Kim, Woo Jung; Choi, Ji Won; Jang, Won Jong; Kang, Young-Sun; Lee, Chang Won; Synytsya, Andriy; Park, Yong IlInternational Journal of Biological Macromolecules (2017), 103 (), 286-293CODEN: IJBMDR; ISSN:0141-8130. (Elsevier B.V.)Low-mol.-wt. mannogalactofucans (LMMGFs, <4000 g/mol) were prepd. by the enzymic degrdn. of Undaria pinnatifida sporophyll galactofucan (MF) and evaluated or their antiviral activities and underlying action mechanisms against herpes simplex virus type 1 (HSV-1). The 50% inhibitory concns. (IC50) of LMMGFs and MF were 2.64 and 2.42 μg/mL, resp. LMMGFs inhibited the viral entry on the host cell surface and also exhibited inhibitory activity directly against viral particles, as obsd. in a virucidal assay. LMMGFs dose-dependently enhanced the mRNA expression of Toll-like receptor 2 (TLR2) and stimulated the phosphorylation of Akt and JNK in Vero cells. These results clearly demonstrated that LMMGFs use TLR2 as their receptor, preventing HSV-1 infection on the host cell surface and antagonizing viral adsorption via TLR2 pathway activation in Vero cells.
- 24Santone, M.; Aprea, S.; Wu, T. Y. H.; Cooke, M. P.; Mbow, M. L.; Valiante, N. M.; Rush, J. S.; Dougan, S.; Avalos, A.; Ploegh, H.; De Gregorio, E.; Buonsanti, C.; D’Oro, U. A New TLR2 Agonist Promotes Cross-Presentation by Mouse and Human Antigen Presenting Cells. Hum. Vaccines Immunother. 2015, 11 (8), 2038– 2050, DOI: 10.1080/21645515.2015.1027467
- 25Arora, S.; Ahmad, S.; Irshad, R.; Goyal, Y.; Rafat, S.; Siddiqui, N.; Dev, K.; Husain, M.; Ali, S.; Mohan, A.; Syed, M. A. TLRs in Pulmonary Diseases. Life Sci. 2019, 233, 116671, DOI: 10.1016/j.lfs.2019.116671[Crossref], [PubMed], [CAS], Google Scholar25https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhsFGjsLnK&md5=be2ba61debcb16c8c2cb23451e5f3341TLRs in pulmonary diseasesArora, Shweta; Ahmad, Shaniya; Irshad, Rasha; Goyal, Yamini; Rafat, Sahar; Siddiqui, Neha; Dev, Kapil; Husain, Mohammad; Ali, Shakir; Mohan, Anant; Syed, Mansoor AliLife Sciences (2019), 233 (), 116671CODEN: LIFSAK; ISSN:0024-3205. (Elsevier B.V.)A review. Toll-like receptors (TLRs) comprise a clan of proteins involved in identification and triggering a suitable response against pathogenic attacks. As lung is steadily exposed to multiple infectious agents, antigens and host-derived danger signals, the inhabiting stromal and myeloid cells of the lung express an aggregate of TLRs which perceive the endogenously derived damage-assocd. mol. patterns (DAMPs) along with pathogen assocd. mol. patterns (PAMPs) and trigger the TLR-assocd. signalling events involved in host defense. Thus, they form an imperative component of host defense activation in case of microbial infections as well as non-infectious pulmonary disorders such as interstitial lung disease, acute lung injury and airways disease, such as COPD and asthma. They also play an equally important role in lung cancer. Targeting the TLR signalling network would pave ways to the design of more reliable and effective vaccines against infectious agents and control deadly infections, desensitize allergens and reduce inflammation. Moreover, TLR agonists may act as adjuvants by increasing the efficiency of cancer vaccines, thereby contributing their role in treatment of lung cancer too. Overall, TLRs present a compelling and expeditiously bolstered area of research and addressing their signalling events would be of significant use in pulmonary diseases.
- 26West, J. A.; Gregory, S. M.; Damania, B. Toll-like Receptor Sensing of Human Herpesvirus Infection. Front. Cell. Infect. Microbiol. 2012, 2, 122, DOI: 10.3389/fcimb.2012.00122[Crossref], [PubMed], [CAS], Google Scholar26https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC3s%252Fks12nsA%253D%253D&md5=c956436179c276675547ffa7854bc7f9Toll-like receptor sensing of human herpesvirus infectionWest John A; Gregory Sean M; Damania BlossomFrontiers in cellular and infection microbiology (2012), 2 (), 122 ISSN:.Toll-like receptors (TLRs) are evolutionarily conserved pathogen sensors that constitute the first line of defense in the human immune system. Herpesviruses are prevalent throughout the world and cause significant disease in the human population. Sensing of herpesviruses via TLRs has only been documented in the last 10 years and our understanding of the relationship between these sentinels of the immune system and herpesvirus infection has already provided great insight into how the host cell responds to viral infection. This report will summarize the activation and modulation of TLR signaling in the context of human herpesvirus infections.
- 27Li, Y.; Qu, C.; Yu, P.; Ou, X.; Pan, Q.; Wang, W. The Interplay between Host Innate Immunity and Hepatitis E Virus. Viruses 2019, 11 (6), 541, DOI: 10.3390/v11060541[Crossref], [CAS], Google Scholar27https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXksFSh&md5=37ad6195d06b233341f536f12264a5e6The interplay between host innate immunity and hepatitis E virusLi, Yang; Qu, Changbo; Yu, Peifa; Ou, Xumin; Pan, Qiuwei; Wang, WenshiViruses (2019), 11 (6), 541CODEN: VIRUBR; ISSN:1999-4915. (MDPI AG)A review. Hepatitis E virus (HEV) infection represents an emerging global health issue, whereas the clin. outcomes vary dramatically among different populations. The host innate immune system provides a first-line defense against the infection, but dysregulation may partially contribute to severe pathogenesis. A growing body of evidence has indicated the active response of the host innate immunity to HEV infection both in exptl. models and in patients. In turn, HEV has developed sophisticated strategies to counteract the host immune system. In this review, we aim to comprehensively decipher the processes of pathogen recognition, interferon, and inflammatory responses, and the involvement of innate immune cells in HEV infection. We further discuss their implications in understanding the pathogenic mechanisms and developing antiviral therapies.
- 28Said, E. A.; Tremblay, N.; Al-Balushi, M. S.; Al-Jabri, A. A.; Lamarre, D. Viruses Seen by Our Cells: The Role of Viral RNA Sensors. J. Immunol. Res. 2018, 2018, 9480497, DOI: 10.1155/2018/9480497[Crossref], [PubMed], [CAS], Google Scholar28https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC1MbisFOgug%253D%253D&md5=399019aaac05c5f283890c19ba2faec6Viruses Seen by Our Cells: The Role of Viral RNA SensorsSaid Elias A; Al-Balushi Mohammed S; Al-Jabri Ali A; Tremblay Nicolas; Lamarre DanielJournal of immunology research (2018), 2018 (), 9480497 ISSN:.The role of the innate immune response in detecting RNA viruses is crucial for the establishment of proper inflammatory and antiviral responses. Different receptors, known as pattern recognition receptors (PRRs), are present in the cytoplasm, endosomes, and on the cellular surface. These receptors have the capacity to sense the presence of viral nucleic acids as pathogen-associated molecular patterns (PAMPs). This recognition leads to the induction of type 1 interferons (IFNs) as well as inflammatory cytokines and chemokines. In this review, we provide an overview of the significant involvement of cellular RNA helicases and Toll-like receptors (TLRs) 3, 7, and 8 in antiviral immune defenses.
- 29Verma, R.; Bharti, K. Toll like Receptor 3 and Viral Infections of Nervous System. J. Neurol. Sci. 2017, 372, 40– 48, DOI: 10.1016/j.jns.2016.11.034[Crossref], [PubMed], [CAS], Google Scholar29https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XhvFCjtb%252FM&md5=a60241a8d0871c997fa0adf05e658ee1Toll like receptor 3 and viral infections of nervous systemVerma, Rajesh; Bharti, KavitaJournal of the Neurological Sciences (2017), 372 (), 40-48CODEN: JNSCAG; ISSN:0022-510X. (Elsevier B.V.)Members of the toll-like receptor (TLR) family are pathogen recognition receptors that recognize pathogen-assocd. mol. patterns. TLRs mediate the modulation of innate immune responses and influence the development of adaptive immunity. TLR3 is the first identified antiviral TLR that recognizes dsRNA. TLR3 plays a central role in the activation of host immune responses to viral infections and shows detrimental or protective effects against various viral infections. Several viruses are neurotropic and can infect the central nervous system, leading to neuropathologies such as encephalitis, encephalopathy, meningitis, and neuritis. Single nucleotide polymorphism (SNP) in the TLR3 gene is assocd. with the susceptibility to a spectrum of nervous system viral infections. In this review, we discussed the existing knowledge of TLR3 immune responses on the basis of the exptl. evidence and coherent picture of the SNP in TLR3 that is assocd. with various neurotropic virus infections.
- 30Lee, I.; Bos, S.; Li, G.; Wang, S.; Gadea, G.; Desprès, P.; Zhao, R. Y. Probing Molecular Insights into Zika Virus–Host Interactions. Viruses 2018, 10 (5), 233, DOI: 10.3390/v10050233[Crossref], [CAS], Google Scholar30https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXisVans77N&md5=87a8c8ad656a86eaf52e299902476631Probing molecular insights into zika virus-host interactionsLee, Ina; Bos, Sandra; Li, Ge; Wang, Shusheng; Gadea, Gilles; Despres, Philippe; Zhao, Richard Y.Viruses (2018), 10 (5), 233/1-233/26CODEN: VIRUBR; ISSN:1999-4915. (MDPI AG)The recent Zika virus (ZIKV) outbreak in the Americas surprised all of us because of its rapid spread and assocn. with neurol. disorders including fetal microcephaly, brain and ocular anomalies, and Guillain-Barr´e syndrome. In response to this global health crisis, unprecedented and world-wide efforts are taking place to study the ZIKV-related human diseases. Much has been learned about this virus in the areas of epidemiol., genetic diversity, protein structures, and clin. manifestations, such as consequences of ZIKV infection on fetal brain development. However, progress on understanding the mol. mechanism underlying ZIKV-assocd. neurol. disorders remains elusive. To date, we still lack a good understanding of; (1) what virol. factors are involved in the ZIKV-assocd. human diseases; (2) which ZIKV protein(s) contributes to the enhanced viral pathogenicity; and (3) how do the newly adapted and pandemic ZIKV strains alter their interactions with the host cells leading to neurol. defects. The goal of this review is to explore the mol. insights into the ZIKV-host interactions with an emphasis on host cell receptor usage for viral entry, cell innate immunity to ZIKV, and the ability of ZIKV to subvert antiviral responses and to cause cytopathic effects. We hope this literature review will inspire addnl. mol. studies focusing on ZIKV-host Interactions.
- 31Mukherjee, S.; Huda, S.; Sinha Babu, S. P. Toll-like Receptor Polymorphism in Host Immune Response to Infectious Diseases: A Review. Scand. J. Immunol. 2019, 90 (1), e12771, DOI: 10.1111/sji.12771
- 32Gambuzza, M. E.; Soraci, L.; Sofo, V. A New Era for Immunotherapeutic Approaches in Multiple Sclerosis Treatment. J. Clin. Trials 2016, 6 (1), 10– 12, DOI: 10.4172/2167-0870.1000253
- 33Piret, J.; Boivin, G. Innate Immune Response during Herpes Simplex Virus Encephalitis and Development of Immunomodulatory Strategies. Rev. Med. Virol. 2015, 25 (5), 300– 319, DOI: 10.1002/rmv.1848[Crossref], [PubMed], [CAS], Google Scholar33https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC28%252FlvFSrsQ%253D%253D&md5=11a809d40c0f11ab9d9bda51ab6e74fdInnate immune response during herpes simplex virus encephalitis and development of immunomodulatory strategiesPiret Jocelyne; Boivin GuyReviews in medical virology (2015), 25 (5), 300-19 ISSN:.Herpes simplex viruses are large double-stranded DNA viruses. These viruses have the ability to establish a lifelong latency in sensory ganglia and to invade and replicate in the CNS. Apart from relatively benign mucosal infections, HSV is responsible for severe illnesses including HSV encephalitis (HSE). HSE is the most common cause of sporadic, potentially fatal viral encephalitis in Western countries. If left untreated, the mortality rate associated with HSE is approximately 70%. Despite antiviral therapy, the mortality is still higher than 30%, and almost 60% of surviving individuals develop neurological sequelae. It is suggested that direct virus-related and indirect immune-mediated mechanisms contribute to the damages occurring in the CNS during HSE. In this manuscript, we describe the innate immune response to HSV, the development of HSE in mice knock-out for proteins of the innate immune system as well as inherited deficiencies in key components of the signaling pathways involved in the production of type I interferon that could predispose individuals to develop HSE. Finally, we review several immunomodulatory strategies aimed at modulating the innate immune response at a critical time after infection that were evaluated in mouse models and could be combined with antiviral therapy to improve the prognosis of HSE. In conclusion, the cerebral innate immune response that develops during HSE is a "double-edged sword" as it is critical to control viral replication in the brain early after infection, but, if left uncontrolled, may also result in an exaggerated inflammatory response that could be detrimental to the host.
- 34Mousavi, T.; Sattari Saravi, S.; Valadan, R.; Haghshenas, M. R.; Rafiei, A.; Jafarpour, H.; Shamshirian, A. Different Types of Adjuvants in Prophylactic and Therapeutic Human Papillomavirus Vaccines in Laboratory Animals: A Systematic Review. Arch. Virol. 2020, 165 (2), 263– 284, DOI: 10.1007/s00705-019-04479-4[Crossref], [PubMed], [CAS], Google Scholar34https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXitlSqurfF&md5=0b175fa571ae07fb84249d0f58d1e7aeDifferent types of adjuvants in prophylactic and therapeutic human papillomavirus vaccines in laboratory animals: a systematic reviewMousavi, Tahoora; Sattari Saravi, Sogol; Valadan, Reza; Haghshenas, Mohammad Reza; Rafiei, Alireza; Jafarpour, Hamed; Shamshirian, AmirArchives of Virology (2020), 165 (2), 263-284CODEN: ARVIDF; ISSN:0304-8608. (Springer-Verlag GmbH)A review. Human papillomavirus (HPV) causes cervical carcinoma, which and is the third most common cancer, accounting for 275,000 deaths annually worldwide. Adjuvants have a key role in promotion of vaccine efficacy; therefore, using prophylactic and therapeutic vaccines combined with adjuvant could be of great benefit in prevention and treatment of cervical cancer. There are different types of adjuvants, including MF59TM adjuvants, RNA-based, JY (interleukin2/chitosan), cholera toxin (CT), heat-labile enterotoxin (LT), Freund's adjuvant, alum, SA-4-1BBL, λ-carrageenan (λ-CGN), heat shock proteins (HSPs), juzen-taiho-to (JTT) and hochu-ekki-to (HET), ISCOM and ISCOMATRIX, very small size proteoliposomes (VSSPs), granulocyte macrophage colony-stimulating factor (GM-CSF), and Toll-like receptors (TLRs). Adjuvants have various functions, esp. in therapeutic vaccines, and they lead to an increase in cytotoxic T lymphocytes (CTLs), so they are important in the design of vaccines. Here, we review the currently used adjuvants and their combinations with HPV protein vaccines in order to introduce an appropriate adjuvant for HPV vaccines.
- 35Bardel, E.; Doucet-Ladeveze, R.; Mathieu, C.; Harandi, A. M.; Dubois, B.; Kaiserlian, D. Intradermal Immunisation Using the TLR3-Ligand Poly (I:C) as Adjuvant Induces Mucosal Antibody Responses and Protects against Genital HSV-2 Infection. npj Vaccines 2016, 1, 16010, DOI: 10.1038/npjvaccines.2016.10[Crossref], [PubMed], [CAS], Google Scholar35https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC1MzjslGmsw%253D%253D&md5=9331c7ac99ae98f55135fe9498565123Intradermal immunisation using the TLR3-ligand Poly (I:C) as adjuvant induces mucosal antibody responses and protects against genital HSV-2 infectionBardel Emilie; Doucet-Ladeveze Remi; Dubois Bertrand; Kaiserlian Dominique; Mathieu Cyrille; Harandi Ali MNPJ vaccines (2016), 1 (), 16010 ISSN:2059-0105.Development of vaccines able to induce mucosal immunity in the genital and gastrointestinal tracts is a major challenge to counter sexually transmitted pathogens such as HIV-1 and HSV-2. Herein, we showed that intradermal (ID) immunisation with sub-unit vaccine antigens (i.e., HIV-1 gp140 and HSV-2 gD) delivered with Poly(I:C) or CpG1668 as adjuvant induces long-lasting virus-specific immunoglobulin (Ig)-G and IgA antibodies in the vagina and feces. Poly(I:C)-supplemented sub-unit viral vaccines caused minimal skin reactogenicity at variance to those containing CpG1668, promoted a delayed-type hypersensitivity (DTH) to the vaccine and protected mice from genital and neurological symptoms after a lethal vaginal HSV-2 challenge. Interestingly, Poly(I:C12U) (Ampligen), a Poly(I:C) structural analogue that binds to TLR3 but not MDA-5, promoted robust mucosal and systemic IgG antibodies, a weak skin DTH to the vaccine but not IgA responses and failed to confer protection against HSV-2 infection. Moreover, Poly(I:C) was far superior to Poly(I:C12U) at inducing prompt and robust upregulation of IFNss transcripts in lymph nodes draining the injection site. These data illustrate that ID vaccination with glycoproteins and Poly(I:C) as adjuvant promotes long-lasting mucosal immunity and protection from genital HSV-2 infection, with an acceptable skin reactogenicity profile. The ID route thus appears to be an unexpected inductive site for mucosal immunity and anti-viral protection suitable for sub-unit vaccines. This works further highlights that TLR3/MDA5 agonists such as Poly(I:C) may be valuable adjuvants for ID vaccination against sexually transmitted diseases.
- 36Saxena, M.; Sabado, R. L.; La Mar, M.; Mohri, H.; Salazar, A. M.; Dong, H.; Correa Da Rosa, J.; Markowitz, M.; Bhardwaj, N.; Miller, E. Poly-ICLC, a TLR3 Agonist, Induces Transient Innate Immune Responses in Patients with Treated HIV-Infection: A Randomized Double-Blinded Placebo Controlled Trial. Front. Immunol. 2019, 10, 725, DOI: 10.3389/fimmu.2019.00725[Crossref], [PubMed], [CAS], Google Scholar36https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhsVSgtLrM&md5=4ac5028745bf43314f50a5c58c205ed0Poly-ICLC, a TLR3 agonist, induces transient innate immune responses in patients with treated HIV-infection: a randomized double-blinded placebo controlled trialSaxena, Mansi; Sabado, Rachel L.; Mar, Melissa La; Mohri, Hiroshi; Salazar, Andres M.; Dong, Hanqing; Da Rosa, Joel Correa; Markowitz, Martin; Bhardwaj, Nina; Miller, ElizabethFrontiers in Immunology (2019), 10 (), 725CODEN: FIRMCW; ISSN:1664-3224. (Frontiers Media S.A.)Objective: Toll-like receptor-3 agonist Poly-ICLC has been known to activate immune cells and induce HIV replication in pre-clin. expts. In this study we investigated if Poly-ICLC could be used for disrupting HIV latency while simultaneously enhancing innate immune responses. Design: This was a randomized, placebo-controlled, double-blinded trial in aviremic, cART-treated HIV-infected subjects. Participants (n = 15) were randomized 3:1 to receive two consecutive daily doses of Poly-ICLC (1.4 mg s.c.) vs. placebo. Subjects were obsd. for adverse events, immune activation, and viral replication. Methods: Besides primary outcomes of safety and tolerability, several longitudinal immune parameters were evaluated including immune cell phenotype and function via flowcytometry, ELISA, and transcriptional profiling. PCR assays for plasma HIV-1 RNA, CD4+ T cell-assocd. HIV-1 RNA, and proviral DNA were performed to measure HIV reservoirs and latency. Results: Poly-ICLC was overall safe and well-tolerated. Poly-ICLC-related adverse events were Grade 1/2, with the exception of one Grade 3 neutropenia which was short-lived. Mild Injection site reactions were obsd. in nearly all participants in the Poly-ICLC arm. Transcriptional analyses revealed upregulation of innate immune pathways in PBMCs following Poly-ICLC treatment, including strong interferon signaling accompanied by transient increases in circulating IP-10 (CXCL10) levels. These responses generally peaked by 24-48 h after the first injection and returned to baseline by day 8. CD4+ T cell no. and phenotype were unchanged, plasma viral control was maintained and no significant effect on HIV reservoirs was obsd. Conclusions: These finding suggest that Poly-ICLC could be safely used for inducing transient innate immune responses in treated HIV+ subjects indicating promise as an adjuvant for HIV therapeutic vaccines.
- 37Zhang, Y.; Zhang, S.; Li, W.; Hu, Y.; Zhao, J.; Liu, F.; Lin, H.; Liu, Y.; Wang, L.; Xu, S.; Hu, R.; Shao, H.; Li, L. A Novel Rabies Vaccine Based-on Toll-like Receptor 3 (TLR3) Agonist PIKA Adjuvant Exhibiting Excellent Safety and Efficacy in Animal Studies. Virology 2016, 489, 165– 172, DOI: 10.1016/j.virol.2015.10.029[Crossref], [PubMed], [CAS], Google Scholar37https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXhvVSks7rM&md5=1b041a27c1b45ee7803885be36025877A novel rabies vaccine based-on toll-like receptor 3 (TLR3) agonist PIKA adjuvant exhibiting excellent safety and efficacy in animal studiesZhang, Yi; Zhang, Shoufeng; Li, Wei; Hu, Yuchi; Zhao, Jinyan; Liu, Fang; Lin, Haixiang; Liu, Yuan; Wang, Liliang; Xu, Shu; Hu, Rongliang; Shao, Hui; Li, LietaoVirology (2016), 489 (), 165-172CODEN: VIRLAX; ISSN:0042-6822. (Elsevier B.V.)Vaccination alone is not sufficiently effective to protect human from post-exposure rabies virus infection due to delayed generation of rabies virus neutralizing antibodies and weak cellular immunity. Therefore, it is vital to develop safer and more efficacious vaccine against rabies. PIKA, a stabilized chem. analog of double-stranded RNA that interacts with TLR3, was employed as adjuvant of rabies vaccine. The efficacy and safety of PIKA rabies vaccine were evaluated. The results showed that PIKA rabies vaccine enhanced both humoral and cellular immunity. After viral challenge, PIKA rabies vaccine protected 70-80% of animals, while the survival rate of non-adjuvant vaccine group (control) was 20-30%. According to the results of toxicity tests, PIKA and PIKA rabies vaccine are shown to be well tolerated in mice. Thus, this study indicates that PIKA rabies vaccine is an effective and safe vaccine which has the potential to develop next-generation rabies vaccine and encourage the start of clin. studies.
- 38Guo, F.; Mead, J.; Aliya, N.; Wang, L.; Cuconati, A.; Wei, L.; Li, K.; Block, T. M.; Guo, J. T.; Chang, J. RO 90–7501 Enhances TLR3 and RLR Agonist Induced Antiviral Response. PLoS One 2012, 7 (10), e42583, DOI: 10.1371/journal.pone.0042583[Crossref], [PubMed], [CAS], Google Scholar38https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC38XhsFWgsb%252FL&md5=eb7441f3bcd814c1f243ba36655c1649RO 90-7501 enhances TLR3 and RLR agonist induced antiviral responseGuo, Fang; Mead, Jennifer; Aliya, Nishat; Wang, Lijuan; Cuconati, Andrea; Wei, Lai; Li, Kui; Block, Timothy M.; Guo, Ju-Tao; Chang, JinhongPLoS One (2012), 7 (10), e42583CODEN: POLNCL; ISSN:1932-6203. (Public Library of Science)Recognition of virus infection by innate pattern recognition receptors (PRRs), including membrane-assocd. toll-like receptors (TLR) and cytoplasmic RIG-I-like receptors (RLR), activates cascades of signal transduction pathways leading to prodn. of type I interferons (IFN) and proinflammatory cytokines that orchestrate the elimination of the viruses. Although it has been demonstrated that PRR-mediated innate immunity plays an essential role in defending virus from infection, it also occasionally results in overwhelming prodn. of proinflammatory cytokines that cause severe inflammation, blood vessel leakage and tissue damage. In our efforts to identify small mols. that selectively enhance PRR-mediated antiviral, but not the detrimental inflammatory response, we discovered a compd., RO 90-7501 ('2'-(4-Aminophenyl)-[2,5'-bi-1H-benzimidazol]-5-amine),that significantly promoted both TLR3 and RLR ligand-induced IFN-β gene expression and antiviral response, most likely via selective activation of p38 mitogen-activated protein kinase (MAPK) pathway. Our results thus imply that pharmacol. modulation of PRR signal transduction pathways in favor of the induction of a beneficial antiviral response can be a novel therapeutic strategy.
- 39Peri, F.; Calabrese, V. Toll-like Receptor 4 (TLR4) Modulation by Synthetic and Natural Compounds: An Update. J. Med. Chem. 2014, 57 (9), 3612– 3622, DOI: 10.1021/jm401006s[ACS Full Text], [CAS], Google Scholar39https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXhslaksLnN&md5=dce69e6a3b1a44e148c14212ef82327bToll-like Receptor 4 (TLR4) Modulation by Synthetic and Natural Compounds: An UpdatePeri, Francesco; Calabrese, ValentinaJournal of Medicinal Chemistry (2014), 57 (9), 3612-3622CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)A review. Toll-like receptor 4 (TLR4), together with MD-2, binds bacterial endotoxins (E) with high affinity, triggering formation of the activated homodimer (E.MD-2.TLR4)2. Activated TLR4 induces intracellular signaling leading to activation of transcription factors that result in cytokine and chemokine prodn. and initiation of inflammatory and immune responses. TLR4 also responds to endogenous ligands called danger assocd. mol. patterns (DAMPs). Increased sensitivity to infection and a variety of immune pathologies have been assocd. with either too little or too much TLR4 activation. We review here the mol. mechanisms of TLR4 activation (agonism) or inhibition (antagonism) by small org. mols. of both natural and synthetic origin. The role of co-receptors MD-2 and CD14 in the TLR4 modulation process is also discussed. Recent achievements in the field of chem. TLR4 modulation are reviewed, with special focus on nonclassical TLR4 ligands with a chem. structure different from that of lipid A.
- 40Olejnik, J.; Hume, A. J.; Mühlberger, E. Toll-like Receptor 4 in Acute Viral Infection: Too Much of a Good Thing. PLoS Pathog. 2018, 14 (12), e1007390, DOI: 10.1371/journal.ppat.1007390[Crossref], [PubMed], [CAS], Google Scholar40https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXot1Kltrc%253D&md5=0d74a955c03336d9049a2182d695c216Toll-like receptor 4 in acute viral infection: Too much of a good thingOlejnik, Judith; Hume, Adam J.; Muehlberger, ElkePLoS Pathogens (2018), 14 (12), e1007390/1-e1007390/7CODEN: PPLACN; ISSN:1553-7374. (Public Library of Science)Although a well-regulated inflammatory response is a vital defense mechanism against viral infection, too much inflammation can be detrimental. Excessive inflammatory responses, which are characterized by elevated levels of a broad array of pro-inflammatory cytokines and chemokines, have been obsd. in a wide variety of viral diseases assocd. with serious morbidity and mortality. Examples of this include acute lung injury caused by infections with respiratory syncytial virus (RSV), influenza A virus (IAV), or severe acute respiratory syndrome coronavirus (SARS-CoV). Excessive inflammatory responses induced by viral infections are not restricted to the lung but can be systemic, as reported for Ebola virus (EBOV) disease and severe dengue. The reasons leading to an unbalanced inflammatory response in certain viral infections are not well understood and are most likely multifactorial. Here, we explore the role of toll-like receptor 4 (TLR4) in the induction of damaging inflammatory responses during acute viral infections.
- 41Abouelasrar Salama, S.; Lavie, M.; De Buck, M.; Van Damme, J.; Struyf, S. Cytokines and Serum Amyloid A in the Pathogenesis of Hepatitis C Virus Infection. Cytokine Growth Factor Rev. 2019, 50, 29– 42, DOI: 10.1016/j.cytogfr.2019.10.006[Crossref], [PubMed], [CAS], Google Scholar41https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXitFGju7fL&md5=911a040e23c4e7760818661030fc77b9Cytokines and serum amyloid A in the pathogenesis of hepatitis C virus infectionAbouelasrar Salama, Sara; Lavie, Muriel; De Buck, Mieke; Van Damme, Jo; Struyf, SofieCytokine & Growth Factor Reviews (2019), 50 (), 29-42CODEN: CGFRFB; ISSN:1359-6101. (Elsevier Ltd.)A review. Expression of the acute phase protein serum amyloid A (SAA) is dependent on the release of the pro-inflammatory cytokines IL-1, IL-6 and TNF-α during infection and inflammation. Hepatitis C virus (HCV) upregulates SAA-inducing cytokines. In line with this, a segment of chronically infected individuals display increased circulating levels of SAA. SAA has even been proposed to be a potential biomarker to evaluate treatment efficiency and the course of disease. SAA possesses antiviral activity against HCV via direct interaction with the viral particle, but might also divert infectivity through its function as an apolipoprotein. On the other hand, SAA shares inflammatory and angiogenic activity with chemotactic cytokines by activating the G protein-coupled receptor, formyl peptide receptor 2. These latter properties might promote chronic inflammation and hepatic injury. Indeed, up to 80 % of infected individuals develop chronic disease because they cannot completely clear the infection, due to diversion of the immune response. In this review, we summarize the interconnection between SAA and cytokines in the context of HCV infection and highlight the dual role SAA could play in this disease. Nevertheless, more research is needed to establish whether the balance between those opposing activities can be tilted in favor of the host defense.
- 42Hendrickx, R.; Stichling, N.; Koelen, J.; Kuryk, L.; Lipiec, A.; Greber, U. F. Innate Immunity to Adenovirus. Hum. Gene Ther. 2014, 25 (4), 265– 284, DOI: 10.1089/hum.2014.001[Crossref], [PubMed], [CAS], Google Scholar42https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXmsFWlsbc%253D&md5=0e6742432ac612b0c347ecd7a5bff19bInnate Immunity to AdenovirusHendrickx, Rodinde; Stichling, Nicole; Koelen, Jorien; Kuryk, Lukasz; Lipiec, Agnieszka; Greber, Urs F.Human Gene Therapy (2014), 25 (4), 265-284CODEN: HGTHE3; ISSN:1043-0342. (Mary Ann Liebert, Inc.)A review. Human adenoviruses are the most widely used vectors in gene medicine, with applications ranging from oncolytic therapies to vaccinations, but adenovirus vectors are not without side effects. In addn., natural adenoviruses pose severe risks for immunocompromised people, yet infections are usually mild and self-limiting in immunocompetent individuals. Here we describe how adenoviruses are recognized by the host innate defense system during entry and replication in immune and nonimmune cells. Innate defense protects the host and represents a major barrier to using adenoviruses as therapeutic interventions in humans. Innate response against adenoviruses involves intrinsic factors present at const. levels, and innate factors mounted by the host cell upon viral challenge. These factors exert antiviral effects by directly binding to viruses or viral components, or shield the virus, for example, sol. factors, such as blood clotting components, the complement system, preexisting Igs, or defensins. In addn., Toll-like receptors and lectins in the plasma membrane and endosomes are intrinsic factors against adenoviruses. Important innate factors restricting adenovirus in the cytosol are tripartite motif-contg. proteins, nucleotide-binding oligomerization domain-like inflammatory receptors, and DNA sensors triggering interferon, such as DEAD (Asp-Glu-Ala-Asp) box polypeptide 41 and cyclic guanosine monophosphate-adenosine monophosphate synthase. Adenovirus tunes the function of antiviral autophagy, and counters innate defense by virtue of its early proteins E1A, E1B, E3, and E4 and two virus-assocd. noncoding RNAs VA-I and VA-II. We conclude by discussing strategies to engineer adenovirus vectors with attenuated innate responses and enhanced delivery features.
- 43Chen, K. R.; Ling, P. Interplays between Enterovirus A71 and the Innate Immune System. J. Biomed. Sci. 2019, 26 (1), 95, DOI: 10.1186/s12929-019-0596-8[Crossref], [PubMed], [CAS], Google Scholar43https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXisVykt7vI&md5=ac7abae9b0b4579ce63bc17b72b429e9Interplays between Enterovirus A71 and the innate immune systemChen, Kuan-Ru; Ling, PinJournal of Biomedical Science (London, United Kingdom) (2019), 26 (1), 95CODEN: JBCIEA; ISSN:1423-0127. (BioMed Central Ltd.)A review. Enterovirus A71 (EV-A71) is a growing threat to public health, particularly in the Asia-Pacific region. EV-A71 infection is most prevalent in infants and children and causes a wide spectrum of clin. complications, including hand-foot-and-mouth disease (HFMD), pulmonary and neurol. disorders. The pathogenesis of EV-A71 infection is poorly understood at present. It is likely that viral factors and host immunity, and their interplay, affect the pathogenesis and outcome of EV-A71 infection. The mammalian innate immune system forms the first layer of defense against viral infections and triggers activation of adaptive immunity leading to full protection. In this review, we discuss recent advances in our understanding of the interaction between EV-A71 and the innate immune system. We discuss the role of pattern-recognition receptors (PRRs), including Toll-like receptors (TLRs), RIG-I-like receptors (RLRs), and inflammasomes, in the detection of EV-A71 infection and induction of antiviral immunity. As a counteraction, EV-A71 viral proteins target multiple innate immune pathways to facilitate viral replication in host cells. These novel insights at the virus-host interphase may support the future development of vaccines and therapeutics against EV-A71 infection.
- 44Bahramabadi, R.; Dabiri, S.; Iranpour, M.; Kazemi Arababadi, M. TLR4: An Important Molecule Participating in Either Anti-Human Papillomavirus Immune Responses or Development of Its Related Cancers. Viral Immunol. 2019, 32 (10), 417– 423, DOI: 10.1089/vim.2019.0061[Crossref], [PubMed], [CAS], Google Scholar44https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXitlGitrzJ&md5=78dd525ce44091f80d2d3cf74031f8cdTLR4: An Important Molecule Participating in Either Anti-Human Papillomavirus Immune Responses or Development of Its Related CancersBahramabadi, Reza; Dabiri, Shahriar; Iranpour, Maryam; Arabadadi, Mohammed KazemiViral Immunology (2019), 32 (10), 417-423CODEN: VIIMET; ISSN:0882-8245. (Mary Ann Liebert, Inc.)A review. It has been reported that human papillomavirus (HPV) is a main cause of cervical cancer. Immune system plays key roles in the HPV infection clearance. Addnl., the roles played by immune responses in development of cancers have been documented previously. Toll-like receptors (TLRs) are the main surface or intravesicular receptors driving innate immunity, which either participate in the fight against infectious agents or participate in the progression of cancers. Thus, it has been hypothesized that the mols. may be part of the HPV/cancers puzzle. TLR4 is a unique member of TLRs family that uses both well-known TLRs related intracellular signaling pathways. Furthermore, the roles played by TLR4 against several viruses and also their related complications, such as tumors, have been demonstrated. Thus, it has been hypothesized that TLR4 may play a key role in HPV infection and its related complications. This review article collected the information regarding the mentioned plausible roles by TLR4.
- 45Tantawy, E. A.; El-Beyali, A. A.; Gohar, M. K.; Ibrahim, Z. S.; Nasr, M.; Marei, A. Association of TLR2 and TLR4 Gene Polymorphism with Susceptibility to Wart Infections and Their Response to Candida Antigen Immunotherapy. J. Dermatol. Treat. 2020, DOI: 10.1080/09546634.2020.1732285
- 46Vasou, A.; Sultanoglu, N.; Goodbourn, S.; Randall, R. E.; Kostrikis, L. G. Targeting Pattern Recognition Receptors (PRR) for Vaccine Adjuvantation: From Synthetic PRR Agonists to the Potential of Defective Interfering Particles of Viruses. Viruses 2017, 9 (7), 186, DOI: 10.3390/v9070186[Crossref], [CAS], Google Scholar46https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXitVGgtbnK&md5=7a0f9fd39055af691cbac5a7bf126ba2Targeting pattern recognition receptors (PRR) for vaccine adjuvantation: from synthetic PRR agonists to the potential of defective interfering particles of virusesVasou, Andri; Sultanoglu, Nazife; Goodbourn, Stephen; Randall, Richard E.; Kostrikis, Leondios G.Viruses (2017), 9 (7), 186/1-186/17CODEN: VIRUBR; ISSN:1999-4915. (MDPI AG)Modern vaccinol. has increasingly focused on non-living vaccines, which are more stable than live-attenuated vaccines but often show limited immunogenicity. Immunostimulatory substances, known as adjuvants, are traditionally used to increase the magnitude of protective adaptive immunity in response to a pathogen-assocd. antigen. Recently developed adjuvants often include substances that stimulate pattern recognition receptors (PRRs), essential components of innate immunity required for the activation of antigen-presenting cells (APCs), which serve as a bridge between innate and adaptive immunity. Nearly all PRRs are potential targets for adjuvants. Given the recent success of toll-like receptor (TLR) agonists in vaccine development, mols. with similar, but addnl., immunostimulatory activity, such as defective interfering particles (DIPs) of viruses, represent attractive candidates for vaccine adjuvants. This review outlines some of the recent advances in vaccine development related to the use of TLR agonists, summarizes the current knowledge regarding DIP immunogenicity, and discusses the potential applications of DIPs in vaccine adjuvantation.
- 47Chan, M.; Hayashi, T.; Mathewson, R. D.; Nour, A.; Hayashi, Y.; Yao, S.; Tawatao, R. I.; Crain, B.; Tsigelny, I. F.; Kouznetsova, V. L.; Messer, K.; Pu, M.; Corr, M.; Carson, D. A.; Cottam, H. B. Identification of Substituted Pyrimido[5,4-b]Indoles as Selective Toll-like Receptor 4 Ligands. J. Med. Chem. 2013, 56 (11), 4206– 4223, DOI: 10.1021/jm301694x[ACS Full Text], [CAS], Google Scholar47https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXnsVWisrc%253D&md5=2364a43919b69819783b22c8fe9ab247Identification of Substituted Pyrimido[5,4-b]indoles as Selective Toll-Like Receptor 4 LigandsChan, Michael; Hayashi, Tomoko; Mathewson, Richard D.; Nour, Afshin; Hayashi, Yuki; Yao, Shiyin; Tawatao, Rommel I.; Crain, Brian; Tsigelny, Igor F.; Kouznetsova, Valentina L.; Messer, Karen; Pu, Minya; Corr, Maripat; Carson, Dennis A.; Cottam, Howard B.Journal of Medicinal Chemistry (2013), 56 (11), 4206-4223CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)A cell-based high-throughput screen to identify small mol. wt. stimulators of the innate immune system revealed substituted pyrimido[5,4-b]indoles as potent NFκB activators. The most potent hit compd. selectively stimulated Toll-like receptor 4 (TLR4) in human and mouse cells. Synthetic modifications of the pyrimido[5,4-b]indole scaffold at the carboxamide, N-3, and N-5 positions revealed differential TLR4 dependent prodn. of NFκB and type I interferon assocd. cytokines, IL-6 and interferon γ-induced protein 10 (IP-10) resp. Specifically, a subset of compds. bearing Ph and substituted Ph carboxamides induced lower IL-6 release while maintaining higher IP-10 prodn., skewing toward the type I interferon pathway. Substitution at N-5 with short alkyl substituents reduced the cytotoxicity of the leading hit compd. Computational studies supported that active compds. appeared to bind primarily to MD-2 in the TLR4/MD-2 complex. These small mols., which stimulate innate immune cells with minimal toxicity, could potentially be used as adjuvants or immune modulators.
- 48Hayashi, T.; Crain, B.; Yao, S.; Caneda, C. D.; Cottam, H. B.; Chan, M.; Corr, M.; Carson, D. A. Novel Synthetic Toll-Like Receptor 4/MD2 Ligands Attenuate Sterile Inflammation. J. Pharmacol. Exp. Ther. 2014, 350 (2), 330– 340, DOI: 10.1124/jpet.114.214312[Crossref], [PubMed], [CAS], Google Scholar48https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXhs1WqsbzM&md5=160c06cb612fdd67c18e1f15ec8ea315Novel synthetic toll-like receptor 4/MD2 ligands attenuate sterile inflammationHayashi, Tomoko; Crain, Brian; Yao, Shiyin; Caneda, Christa D.; Cottam, Howard B.; Chan, Michael; Corr, Maripat; Carson, Dennis A.Journal of Pharmacology and Experimental Therapeutics (2014), 350 (2), 330-340, 11 pp.CODEN: JPETAB; ISSN:1521-0103. (American Society for Pharmacology and Experimental Therapeutics)Toll-like receptor (TLR) stimulation has been implicated as a major contributor to chronic inflammation. Among these receptors, TLR4 has been described as a key regulator of endogenous inflammation and has been proposed as a therapeutic target. Previously, we discovered by high-throughput screening a group of substituted pyrimido[5,4-b]indoles that activated a nuclear factor-κB reporter in THP-1 human monocytic cells. A biol. active hit compd. was resynthesized, and derivs. were prepd. to assess structure-activity relationships. The derived compds. activated cells in a TLR4/myeloid differentiation protein 2 (MD2)-dependent and CD14-independent manner, using the myeloid differentiation primary response 88 and Toll/IL-1 receptor domain-contg. adapter-inducing interferon-β pathways. Two lead compds., 1Z105 and 1Z88, were selected for further anal. based on favorable biol. properties and lack of toxicity. In vivo pharmacokinetics indicated that 1Z105 was orally bioavailable, whereas 1Z88 was not. Oral or parenteral doses of 1Z105 and 1Z88 induced undetectable or negligible levels of circulating cytokines and did not induce hepatotoxicity when administered to galactosamine-conditioned mice, indicating good safety profiles. Both compds. were very effective in preventing lethal liver damage in lipopolysaccharide treated galatosamine-conditioned mice. Orally administered 1Z105 and parenteral 1Z88 prevented arthritis in an autoantibody-driven murine model. Hence, these low mol. wt. mols. that target TLR4/MD2 were well tolerated and effective in reducing target organ damage in two different mouse models of sterile inflammation.
- 49Goff, P. H.; Hayashi, T.; Martínez-Gil, L.; Corr, M.; Crain, B.; Yao, S.; Cottam, H. B.; Chan, M.; Ramos, I.; Eggink, D.; Heshmati, M.; Krammer, F.; Messer, K.; Pu, M.; Fernandez-Sesma, A.; Palese, P.; Carson, D. A. Synthetic Toll-Like Receptor 4 (TLR4) and TLR7 Ligands as Influenza Virus Vaccine Adjuvants Induce Rapid, Sustained, and Broadly Protective Responses. J. Virol. 2015, 89 (6), 3221– 3235, DOI: 10.1128/JVI.03337-14[Crossref], [PubMed], [CAS], Google Scholar49https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXktF2ntbk%253D&md5=f10034ebe5385e0dd4a27e5384cd68dfSynthetic Toll-like receptor 4 (TLR4) and TLR7 ligands as influenza virus vaccine adjuvants induce rapid, tained, and broadly protective responsesGoff, Peter H.; Hayashi, Tomoko; Martinez-Gil, Luis; Corr, Maripat; Crain, Brian; Yao, Shiyin; Cottam, Howard B.; Chan, Michael; Ramos, Irene; Eggink, Dirk; Heshmati, Mitra; Krammer, Florian; Messer, Karen; Pu, Minya; Fernandez-Sesma, Ana; Palese, Peter; Carson, Dennis A.Journal of Virology (2015), 89 (6), 3221-3235CODEN: JOVIAM; ISSN:1098-5514. (American Society for Microbiology)Current vaccines against influenza virus infection rely on the induction of neutralizing antibodies targeting the globular head of the viral hemagglutinin (HA). Protection against seasonal antigenic drift or sporadic pandemic outbreaks requires further vaccine development to induce cross-protective humoral responses, potentially to the more conserved HA stalk region. Here, we present a novel viral vaccine adjuvant comprised of two synthetic ligands for Toll-like receptor 4 (TLR4) and TLR7. 1Z105 is a substituted pyrimido[5,4-b]indole specific for the TLR4-MD2 complex, and 1V270 is a phospholipid-conjugated TLR7 agonist. Sep., 1Z105 induces rapid Th2-assocd. IgG1 responses, and 1V270 potently generates Th1 cellular immunity. 1Z105 and 1V270 in combination with recombinant HA from the A/Puerto Rico/8/1934 strain (rPR/8 HA) effectively induces rapid and sustained humoral immunity that is protective against lethal challenge with a homologous virus. More importantly, immunization with the combined adjuvant and rPR/8 HA, a com. available split vaccine, or chimeric rHA antigens significantly improves protection against both heterologous and heterosubtypic challenge viruses. Heterosubtypic protection is assocd. with broadly reactive antibodies to HA stalk epitopes. Histol. examn. and cytokine profiling reveal that i.m. (i.m.) administration of 1Z105 and 1V270 is less reactogenic than a squalene-based adjuvant, AddaVax. In summary, the combination of 1Z105 and 1V270 with a recombinant HA induces rapid, long-lasting, and balanced Th1- and Th2-type immunity; demonstrates efficacy in a variety of murine influenza virus vaccine models assaying homologous, heterologous, and heterosubtypic challenge viruses; and has an excellent safety profile.
- 50Rodríguez-Valentín, M.; López, S.; Rivera, M.; Ríos-Olivares, E.; Cubano, L.; Boukli, N. M. Naturally Derived Anti-HIV Polysaccharide Peptide (PSP) Triggers a Toll-like Receptor 4-Dependent Antiviral Immune Response. J. Immunol. Res. 2018, 2018, 8741698, DOI: 10.1155/2018/8741698[Crossref], [PubMed], [CAS], Google Scholar50https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB3c7ptVSiug%253D%253D&md5=f76b0cbf8fd61b6e7abf80f3319d24eeNaturally Derived Anti-HIV Polysaccharide Peptide (PSP) Triggers a Toll-Like Receptor 4-Dependent Antiviral Immune ResponseRodriguez-Valentin Madeline; Lopez Sheila; Rivera Mariela; Rios-Olivares Eddy; Cubano Luis; Boukli Nawal MJournal of immunology research (2018), 2018 (), 8741698 ISSN:.Aim: Intense interest remains in the identification of compounds to reduce human immunodeficiency virus type 1 (HIV-1) replication. Coriolus versicolor's polysaccharide peptide (PSP) has been demonstrated to possess immunomodulatory properties with the ability to activate an innate immune response through Toll-like receptor 4 (TLR4) showing insignificant toxicity. This study sought to determine the potential use of PSP as an anti-HIV agent and whether its antiviral immune response was TLR4 dependent. Materials and Methods: HIV-1 p24 and anti-HIV chemokine release was assessed in HIV-positive (HIV+) THP1 cells and validated in HIV+ peripheral blood mononuclear cells (PBMCs), to determine PSP antiviral activity. The involvement of TLR4 activation in PSP anti-HIV activity was evaluated by inhibition. Results: PSP showed a promising potential as an anti-HIV agent, by downregulating viral replication and promoting the upregulation of specific antiviral chemokines (RANTES, MIP-1α/β, and SDF-1α) known to block HIV-1 coreceptors in THP1 cells and human PBMCs. PSP produced a 61% viral inhibition after PSP treatment in HIV-1-infected THP1 cells. Additionally, PSP upregulated the expression of TLR4 and TLR4 inhibition led to countereffects in chemokine expression and HIV-1 replication. Conclusion: Taken together, these findings put forward the first evidence that PSP exerts an anti-HIV activity mediated by TLR4 and key antiviral chemokines. Elucidating these new molecular mediators may reveal additional drug targets and open novel therapeutic avenues for HIV-1 infection.
- 51Li, M.; Jiang, Y.; Gong, T.; Zhang, Z.; Sun, X. Intranasal Vaccination against HIV-1 with Adenoviral Vector-Based Nanocomplex Using Synthetic TLR-4 Agonist Peptide as Adjuvant. Mol. Pharmaceutics 2016, 13 (3), 885– 894, DOI: 10.1021/acs.molpharmaceut.5b00802[ACS Full Text], [CAS], Google Scholar51https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28Xhs1Whurg%253D&md5=79e0b45edab946a33568e073313b5611Intranasal Vaccination against HIV-1 with Adenoviral Vector-Based Nanocomplex Using Synthetic TLR-4 Agonist Peptide as AdjuvantLi, Man; Jiang, Yuhong; Gong, Tao; Zhang, Zhirong; Sun, XunMolecular Pharmaceutics (2016), 13 (3), 885-894CODEN: MPOHBP; ISSN:1543-8384. (American Chemical Society)Recombinant type 5 adenovirus (rAd5) vaccines hold the promise to prevent HIV-1 infections. Intranasal vaccination not only stimulates systemic immunity but also elicits mucosal immunity that provides first defense for mucosally transmitted diseases like HIV-1. Adjuvants such as TLR agonists are usually codelivered with antigens to enhance the immunogenicity of vaccines. Here, we present a rAd5 vaccine delivery system using DEG-PEI as the carrier. Adenovirus encoding HIV gag was used as antigen, and was complexed with DEG-PEI polymer via electrostatic interaction. A novel synthetic TLR-4 agonist, RS09, was either chem. linked with DEG-PEI (DP-RS09) or phys. mixed with it(DP/RS09) to enhance the immunogenticity of rAd5 vaccine. After intranasal immunization, the systemic antigen-specific immune responses and cytotoxicity T lymphocytes responses induced by DP-RS09-rAd5 and DP/RS09-rAd5 were analyzed. The mucosal secretory IgA level was detected in both nasal and vaginal washes to det. the mucosal immunity. Furthermore, cytokine productions on RAW264.7 cells were tested after preincubation with TLR-4 pathway inhibitors. The results indicated that DEG-PEI could facilitate the intranasal delivery of rAd5 vaccine. Both chem. linked (DP-RS09) and phys. mixed RS09 (DP/RS09) could further enhance the mucosal immunity of rAd5 vaccine via TLR-4 pathway. This RS09 adjuvanted DEG-PEI polymer represents a potential intranasal vaccine delivery system and may have a wider application for other viral vectors.
- 52Abdul-Careem, M. F.; Firoz Mian, M.; Gillgrass, A. E.; Chenoweth, M. J.; Barra, N. G.; Chan, T.; Al-Garawi, A. A.; Chew, M. V.; Yue, G.; van Roojen, N.; Xing, Z.; Ashkar, A. A. FimH, a TLR4 Ligand, Induces Innate Antiviral Responses in the Lung Leading to Protection against Lethal Influenza Infection in Mice. Antiviral Res. 2011, 92 (2), 346– 355, DOI: 10.1016/j.antiviral.2011.09.004[Crossref], [PubMed], [CAS], Google Scholar52https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3MXhtlKku7vI&md5=707285d97e31862f6eed1078e6cfa65bFimH, a TLR4 ligand, induces innate antiviral responses in the lung leading to protection against lethal influenza infection in miceAbdul-Careem, Mohamed F.; Mian, M. Firoz; Gillgrass, Amy E.; Chenoweth, Meghan J.; Barra, Nicole G.; Chan, Tiffany; Al-Garawi, Amal A.; Chew, Marianne V.; Yue, Geoffry; van Roojen, Nico; Xing, Zhou; Ashkar, Ali A.Antiviral Research (2011), 92 (2), 346-355CODEN: ARSRDR; ISSN:0166-3542. (Elsevier B.V.)Fimbriae H protein (FimH) is a novel TLR4 ligand that has been shown to stimulate the innate immune system and elicits protective responses against bacterial and viral infections. Here, we evaluated the protective role of local delivery of FimH against influenza A infection in a mouse model. We show that intranasal delivery of FimH prior to lethal challenge with influenza A virus, resulted in decreased morbidity and mortality in wild-type, but not TLR4-/-, mice. Importantly, FimH was able to reduce the early viral burden in the lung leading to minimal cell infiltration into the airway lumen and reduced pulmonary pathol. following infection in wild type mice compared to TLR4-/- mice. Local delivery of FimH to C57BL/6, not TLR4-/-, mice in a prophylactic manner increased the IL-12 and RANTES responses as well as neutrophil recruitment into the airway lumen. These effects correlate to the course of influenza infection. The FimH-mediated antiviral response against influenza virus appears to be partially dependent on alveolar macrophages. The antiviral effects are likely mediated by the innate mediators (TNF-α, IL-12 or RANTES) and/or by activation of a feedback inhibition loop to curtail the pulmonary inflammation possibly be the potential mechanisms involved in FimH-mediated protection. FimH thus holds promise to be a possible prophylactic mean of control against influenza viral infection.
- 53Fan, X.; Yue, Y.; Xiong, S. Incorporation of a Bi-Functional Protein FimH Enhances the Immunoprotection of Chitosan-PVP1 Vaccine against Coxsackievirus B3-Induced Myocarditis. Antiviral Res. 2017, 140, 121– 132, DOI: 10.1016/j.antiviral.2017.01.020[Crossref], [PubMed], [CAS], Google Scholar53https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXit1Chtbs%253D&md5=96e7ed787ed1af2b50029e06f338ae69Incorporation of a bi-functional protein FimH enhances the immunoprotection of chitosan-pVP1 vaccine against coxsackievirus B3-induced myocarditisFan, Xiangmei; Yue, Yan; Xiong, SidongAntiviral Research (2017), 140 (), 121-132CODEN: ARSRDR; ISSN:0166-3542. (Elsevier B.V.)Viral myocarditis is a common clin. cardiovascular disease mainly induced by coxsackievirus B3 (CVB3) with no effective therapeutic measures. Induction of efficient mucosal immune responses is very crit. against CVB3-induced myocarditis. FimH is an Escherichia coli (E. coli)-derived protein, which possesses an M cell-targeting property and functions as a TLR4 agonist. In this study, we introduced the recombinant FimH protein, into our previously developed CVB3 mucosal vaccine chitosan (CS)-pVP1, aiming to provoke more efficient mucosal immune responses and immunoprotection against CVB3-induced myocarditis. Compared with the CS-pVP1 vaccine, immunization with FimH-CS-pVP1 remarkably increased the levels and neutralizing titers of CVB3-specific protective secretory IgA (sIgA), enhanced the frequency of CVB3-specific IgA-producing B cells and amplified mucosal T-cell immune responses in mesenteric lymph nodes (MLNs), although failing to significantly amplify CVB3-specific systemic immune responses. Consistently, FimH-CS-pVP1 group showed the enhanced immunoprotection against CVB3-induced myocarditis, evidenced by the indexes of limited myocardial injury, reduced viral loads and enhanced survival rate. Further study showed that this enhanced immunoprotection was not only ascribed to its M cell-targeting property, which led to the enhanced mucosal antigen VP1 expression, but also assocd. with the mucosal adjuvant effect of FimH, which facilitated the formation of germinal centers (GCs), prodn. of IgA-inducing factors and maturation of antigen-presenting cells (APCs). Taken together, here we developed a bi-functional mucosal vaccine FimH-CS-pVP1, which simultaneously possessed the M cell-targeting property and mucosal adjuvant ability, and we showed that FimH-CS-pVP1 could efficiently induce the higher levels of CVB3-specific protective mucosal immune responses and provide better prophylactic effects against CVB3-induced myocarditis than CS-pVP1.
- 54Salyer, A. C. D.; Caruso, G.; Khetani, K. K.; Fox, L. M.; Malladi, S. S.; David, S. A. Identification of Adjuvantic Activity of Amphotericin B in a Novel, Multiplexed, Poly-TLR/NLR High-Throughput Screen. PLoS One 2016, 11 (2), e0149848, DOI: 10.1371/journal.pone.0149848[Crossref], [PubMed], [CAS], Google Scholar54https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XhsV2nsbrP&md5=a1601245369c4a21ede172c55dd61e9dIdentification of adjuvantic activity of amphotericin B in a novel, multiplexed, poly-TLR/NLR high-throughput screenSalyer, Alex C. D.; Caruso, Giuseppe; Khetani, Karishma K.; Fox, Lauren M.; Malladi, Subbalakshmi S.; David, Sunil A.PLoS One (2016), 11 (2), e0149848/1-e0149848/17CODEN: POLNCL; ISSN:1932-6203. (Public Library of Science)Small-mol. agonists have been identified for TLR7, TLR8, TLR4 and TLR2 thus far, and chemotypes other than those of canonical ligands are yet to be explored for a no. of innate immune receptors. The discovery of novel immunostimulatory mols. would enhance the repertoire of tools available for interrogating innate immune effector mechanisms, and provide addnl. venues for vaccine adjuvant development. A multiplexed, reporter gene-based high-throughput assay capable of detecting agonists of TLR2, TLR3, TLR4, TLR5, TLR7, TLR8, TLR9, NOD1 and NOD2 was utilized in screening 123,943 compds., in which amphotericin B (AmpB) and nystatin were identified as prominent hits. The polyene antifungal agents act as TLR2- and TLR4-agonists. The TLR4-stimulatory activity of AmpB was similar to that of monophosphoryl lipid A, suggestive of TRIF-biased signaling. The adjuvantic activity of AmpB, at a dose of 100 μg, was comparable to several other candidate adjuvants in rabbit models of immunization. These results point to its potential applicability as a safe and effective adjuvant for human vaccines.
- 55Shirey, K. A.; Lai, W.; Scott, A. J.; Lipsky, M.; Mistry, P.; Pletneva, L. M.; Karp, C. L.; McAlees, J.; Gioannini, T. L.; Weiss, J.; Chen, W. H.; Ernst, R. K.; Rossignol, D. P.; Gusovsky, F.; Blanco, J. C. G.; Vogel, S. N. The TLR4 Antagonist Eritoran Protects Mice from Lethal Influenza Infection. Nature 2013, 497 (7450), 498– 502, DOI: 10.1038/nature12118[Crossref], [PubMed], [CAS], Google Scholar55https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXmvFyhsLg%253D&md5=4dc373c1f51cfb3469c020a6448bff16The TLR4 antagonist Eritoran protects mice from lethal influenza infectionShirey, Kari Ann; Lai, Wendy; Scott, Alison J.; Lipsky, Michael; Mistry, Pragnesh; Pletneva, Lioubov M.; Karp, Christopher L.; McAlees, Jaclyn; Gioannini, Theresa L.; Weiss, Jerrold; Chen, Wilbur H.; Ernst, Robert K.; Rossignol, Daniel P.; Gusovsky, Fabian; Blanco, Jorge C. G.; Vogel, Stefanie N.Nature (London, United Kingdom) (2013), 497 (7450), 498-502CODEN: NATUAS; ISSN:0028-0836. (Nature Publishing Group)There is a pressing need to develop alternatives to annual influenza vaccines and antiviral agents licensed for mitigating influenza infection. Previous studies reported that acute lung injury caused by chem. or microbial insults is secondary to the generation of host-derived, oxidized phospholipid that potently stimulates Toll-like receptor 4 (TLR4)-dependent inflammation. Subsequently, we reported that Tlr4-/- mice are highly refractory to influenza-induced lethality, and proposed that therapeutic antagonism of TLR4 signaling would protect against influenza-induced acute lung injury. Here we report that therapeutic administration of Eritoran (also known as E5564)-a potent, well-tolerated, synthetic TLR4 antagonist-blocks influenza-induced lethality in mice, as well as lung pathol., clin. symptoms, cytokine and oxidized phospholipid expression, and decreases viral titers. CD14 and TLR2 are also required for Eritoran-mediated protection, and CD14 directly binds Eritoran and inhibits ligand binding to MD2. Thus, Eritoran blockade of TLR signaling represents a novel therapeutic approach for inflammation assocd. with influenza, and possibly other infections.
- 56Prantner, D.; Shirey, K. A.; Lai, W.; Lu, W.; Cole, A. M.; Vogel, S. N.; Garzino-Demo, A. The θ-Defensin Retrocyclin 101 Inhibits TLR4- and TLR2-Dependent Signaling and Protects Mice against Influenza Infection. J. Leukocyte Biol. 2017, 102 (4), 1103– 1113, DOI: 10.1189/jlb.2A1215-567RR[Crossref], [PubMed], [CAS], Google Scholar56https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXot1Gruw%253D%253D&md5=03911774d1745b51f3bbaab864d0d2a8The θ-defensin retrocyclin 101 inhibits TLR4-and TLR2-dependent signaling and protects mice against influenza infectionPrantner, Daniel; Shirey, Kari Ann; Lai, Wendy; Lu, Wuyuan; Cole, Alexander M.; Vogel, Stefanie N.; Garzino-Demo, AlfredoJournal of Leukocyte Biology (2017), 102 (4), 1103-1113CODEN: JLBIE7; ISSN:0741-5400. (Society for Leukocyte Biology)Despite widespread use of annual influenza vaccines, seasonal influenza-assocd. deaths no. in the thousands each year, in part because of exacerbating bacterial superinfections. Therefore, discovering addnl. therapeutic options would be a valuable aid to public health. Recently, TLR4 inhibition has emerged as a possible mechanism for protection against influenzaassocd. lethality and acute lung injury. Based on recent data showing that rhesus macaque θ-defensins could inhibit TLR4-dependent gene expression, we tested the hypothesis that a novel θ-defensin, retrocyclin (RC)-101, could disrupt TLR4-dependent signaling and protect against viral infection. In this study, RC-101, a variant of the humanized θ-defensin RC-1, blocked TLR4- mediated gene expression in mouse and human macrophages in response to LPS, targeting both MyD88- and TRIF-dependent pathways. In a cell-free assay, RC-101 neutralized the biol. activity of LPS at doses ranging from 0.5 to 50 EU/mL, consistent with data showing that RC-101 binds biotinylated LPS. The action of RC-101 was not limited to the TLR4 pathway because RC-101 treatment of macrophages also inhibited gene expression in response to a TLR2 agonist, Pam3CSK4, but failed to bind that biotinylated agonist. Cumulatively, our data demonstrate that RC-101 exhibits therapeutic potential for the mitigation of influenza-related morbidity and mortality, potentially acting through TLR-dependent and TLR-independent mechanisms.
- 57Hossain, M. S.; Ramachandiran, S.; Gewirtz, A. T.; Waller, E. K. Recombinant TLR5 Agonist CBLB502 Promotes NK Cell-Mediated Anti-CMV Immunity in Mice. PLoS One 2014, 9 (5), e96165, DOI: 10.1371/journal.pone.0096165[Crossref], [PubMed], [CAS], Google Scholar57https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXhsVKgs7rE&md5=a83381fc9c48a63aa3003412add0af6cRecombinant TLR5 agonist CBLB502 promotes NK cell-mediated anti-CMV immunity in miceHossain, Mohammad S.; Ramachandiran, Sampath; Gewirtz, Andrew T.; Waller, Edmund K.PLoS One (2014), 9 (5), e96165/1-e96165/12, 12 pp.CODEN: POLNCL; ISSN:1932-6203. (Public Library of Science)Prior work using allogeneic bone marrow transplantation (allo-BMT) models showed that peritransplant administration of flagellin, a toll-like receptor 5 (TLR5) agonist protected murine allo-BMT recipients from CMV infection while limiting graft-vs-host disease (GvHD). However, the mechanism by which flagellin-TLR5 interaction promotes anti-CMV immunity was not defined. Here, we investigated the anti-CMV immunity of NK cells in C57BL/6 (B6) mice treated with a highly purified cGMP grade recombinant flagellin variant CBLB502 (rflagellin) followed by murine CMV (mCMV) infection. A single dose of rflagellin administered to mice between 48 to 72 h prior to MCMV infection resulted in optimal protection from mCMV lethality. Anti-mCMV immunity in rflagellin-treated mice correlated with a significantly reduced liver viral load and increased nos. of Ly49H+ and Ly49D+ activated cytotoxic NK cells. Addnl., the increased anti-mCMV immunity of NK cells was directly correlated with increased nos. of IFN-γ, granzyme B- and CD107a producing NK cells following mCMV infection. rFlagellin-induced anti-mCMV immunity was TLR5-dependent as rflagellin-treated TLR5 KO mice had ∼10-fold increased liver viral load compared with rflagellin-treated WT B6 mice. However, the increased anti-mCMV immunity of NK cells in rflagellin-treated mice is regulated indirectly as mouse NK cells do not express TLR5. Collectively, these data suggest that rflagellin treatment indirectly leads to activation of NK cells, which may be an important adjunct benefit of administering rflagellin in allo-BMT recipients.
- 58Jahanban-Esfahlan, R.; Seidi, K.; Majidinia, M.; Karimian, A.; Yousefi, B.; Nabavi, S. M.; Astani, A.; Berindan-Neagoe, I.; Gulei, D.; Fallarino, F.; Gargaro, M.; Manni, G.; Pirro, M.; Xu, S.; Sadeghi, M.; Nabavi, S. F.; Shirooie, S. Toll-like Receptors as Novel Therapeutic Targets for Herpes Simplex Virus Infection. Rev. Med. Virol. 2019, 29 (4), e2048, DOI: 10.1002/rmv.2048
- 59Pickens, J. A.; Tripp, R. A. Verdinexor Targeting of CRM1 Is a Promising Therapeutic Approach against RSV and Influenza Viruses. Viruses 2018, 10 (1), 48, DOI: 10.3390/v10010048[Crossref], [CAS], Google Scholar59https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXitFyqu7vL&md5=c920202b091fb5ef1aa76d9c77472774Verdinexor targeting of CRM1 is a promising therapeutic approach against RSV and influenza virusesPickens, Jennifer A.; Tripp, Ralph A.Viruses (2018), 10 (1), 48/1-48/24CODEN: VIRUBR; ISSN:1999-4915. (MDPI AG)Two primary causes of respiratory tract infections are respiratory syncytial virus (RSV) and influenza viruses, both of which remain major public health concerns. There are a limited no. of antiviral drugs available for the treatment of RSV and influenza, each having limited effectiveness and each driving selective pressure for the emergence of drug-resistant viruses. Novel broad-spectrum antivirals are needed to circumvent problems with current disease intervention strategies, while improving the cytokine-induced immunopathol. assocd. with RSV and influenza infections. In this review, we examine the use of Verdinexor (KPT-335, a novel orally bioavailable drug that functions as a selective inhibitor of nuclear export, SINE), as an antiviral with multifaceted therapeutic potential. KPT-335 works to (1) block CRM1 (i.e., Chromosome Region Maintenance 1; exportin 1 or XPO1) mediated export of viral proteins crit. for RSV and influenza pathogenesis; and (2) repress nuclear factor κB (NF-κB) activation, thus reducing cytokine prodn. and eliminating virus-assocd. immunopathol. The repurposing of SINE compds. as antivirals shows promise not only against RSV and influenza virus but also against other viruses that exploit the nucleus as part of their viral life cycle.
- 60Matz, K. M.; Guzman, R. M.; Goodman, A. G. The Role of Nucleic Acid Sensing in Controlling Microbial and Autoimmune Disorders. In International Review of Cell and Molecular Biology, Vol. 345; Elsevier, 2019; Chapter 2, pp 35– 136, DOI: 10.1016/bs.ircmb.2018.08.002 .
- 61Uppal, T.; Sarkar, R.; Dhelaria, R.; Verma, S. C. Role of Pattern Recognition Receptors in KSHV Infection. Cancers 2018, 10 (3), 85, DOI: 10.3390/cancers10030085[Crossref], [CAS], Google Scholar61https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhtV2htb7N&md5=b4da634d774738158e9678f239e05e5aRole of pattern recognition receptors in KSHV infectionUppal, Timsy; Sarkar, Roni; Dhelaria, Ranjit; Verma, Subhash C.Cancers (2018), 10 (3), 85/1-85/21CODEN: CANCCT; ISSN:2072-6694. (MDPI AG)Kaposi's sarcoma-assocd. herpesvirus or Human herpesvirus-8 (KSHV/HHV-8), an oncogenic human herpesvirus and the leading cause of cancer in HIV-infected individuals, is a major public health concern with recurring reports of epidemics on a global level. The early detection of KSHV virus and subsequent activation of the antiviral immune response by the host's immune system are crucial to prevent KSHV infection. The host's immune system is an evolutionary conserved system that provides the most important line of defense against invading microbial pathogens, including viruses. Viruses are initially detected by the cells of the host innate immune system, which evoke concerted antiviral responses via the secretion of interferons (IFNs) and inflammatory cytokines/chemokines for elimination of the invaders. Type I IFN and cytokine gene expression are regulated by multiple intracellular signaling pathways that are activated by germline-encoded host sensors, i.e., pattern recognition receptors (PRRs) that recognize a conserved set of ligands, known as 'pathogen-assocd. mol. patterns (PAMPs)'. On the contrary, persistent and dysregulated signaling of PRRs promotes numerous tumor-causing inflammatory events in various human cancers. Being an integral component of the mammalian innate immune response and due to their constitutive activation in tumor cells, targeting PRRs appears to be an effective strategy for tumor prevention and/or treatment. Cellular PRRs are known to respond to KSHV infection, and KSHV has been shown to be armed with an array of strategies to selectively inhibit cellular PRR-based immune sensing to its benefit. In particular, KSHV has acquired specific immunomodulatory genes to effectively subvert PRR responses during the early stages of primary infection, lytic reactivation and latency, for a successful establishment of a life-long persistent infection. The current review aims to comprehensively summarize the latest advances in our knowledge of role of PRRs in KSHV infections.
- 62Guo, H. Y.; Zhang, X. C.; Jia, R. Y. Toll-like Receptors and RIG-I-like Receptors Play Important Roles in Resisting Flavivirus. J. Immunol. Res. 2018, 2018, 6106582, DOI: 10.1155/2018/6106582[Crossref], [PubMed], [CAS], Google Scholar62https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC1MblvFSqsw%253D%253D&md5=44a91ed8e853ca0f5abc6119dae1d8c7Toll-Like Receptors and RIG-I-Like Receptors Play Important Roles in Resisting FlavivirusGuo Hong-Yan; Zhang Xing-Cui; Jia Ren-Yong; Guo Hong-Yan; Zhang Xing-Cui; Jia Ren-Yong; Guo Hong-Yan; Zhang Xing-Cui; Jia Ren-YongJournal of immunology research (2018), 2018 (), 6106582 ISSN:.Flaviviridae family is a class of single-stranded RNA virus, which is fatal to human and animals and mainly prevalent in subtropic and tropic countries. Even though people and animals are barraged with flavivirus infection every year, we have not invented either vaccines or antiviral for most flavivirus infections yet. Innate immunity is the first line of defense in resisting pathogen invasion, serving an important role in a resisting virus. Toll-like receptors (TLRs) and retinoic acid-inducible gene I- (RIG-I-) like receptors (RLRs) are crucial pattern recognition receptors (PRRs) that play essential roles in recognizing and clearing pathogens, including resisting flavivirus. In the present review, we provide a significant reference for further research on the function of innate immunity in resisting flavivirus.
- 63Macedo, A. B.; Novis, C. L.; Bosque, A. Targeting Cellular and Tissue HIV Reservoirs With Toll-Like Receptor Agonists. Front. Immunol. 2019, 10, 2450, DOI: 10.3389/fimmu.2019.02450[Crossref], [PubMed], [CAS], Google Scholar63https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXps1Gitbc%253D&md5=961ab621dfe62fdd4557ce84359d963cTargeting cellular and tissue HIV reservoirs with toll-like receptor agonistsMacedo, Amanda B.; Novis, Camille L.; Bosque, AlbertoFrontiers in Immunology (2019), 10 (), 2450CODEN: FIRMCW; ISSN:1664-3224. (Frontiers Media S.A.)A review. The elimination of both cellular and tissue latent reservoirs is a challenge toward a successful HIV cure. "Shock and Kill" are among the therapeutic strategies that have been more extensively studied to target these reservoirs. These strategies are aimed toward the reactivation of the latent reservoir using a latency-reversal agent (LRA) with the subsequent killing of the reactivated cell either by the cytotoxic arm of the immune system, including NK and CD8 T cells, or by viral cytopathic mechanisms. Numerous LRAs are currently being investigated in vitro, ex vivo as well as in vivo for their ability to reactivate and reduce latent reservoirs. Among those, several toll-like receptor (TLR) agonists have been shown to reactivate latent HIV. In humans, there are 10 TLRs that recognize different pathogen-assocd. mol. patterns. TLRs are present in several cell types, including CD4 T cells, the cell compartment that harbors the majority of the latent reservoir. Besides their ability to reactivate latent HIV, TLR agonists also increase immune activation and promote an antiviral response. These combined properties make TLR agonists unique among the different LRAs characterized to date. Addnl., some of these agonists have shown promise toward finding an HIV cure in animal models. When in combination with broadly neutralizing antibodies, TLR-7 agonists have shown to impact the SIV latent reservoir and delay viral rebound. Moreover, there are FDA-approved TLR agonists that are currently being investigated for cancer therapy and other diseases. All these has prompted clin. trials using TLR agonists either alone or in combination toward HIV eradication approaches. In this review, we provide an extensive characterization of the state-of-the-art of the use of TLR agonists toward HIV eradication strategies and the mechanism behind how TLR agonists target both cellular and tissue HIV reservoirs.
- 64Das, D.; Sengupta, I.; Sarkar, N.; Pal, A.; Saha, D.; Bandopadhyay, M.; Das, C.; Narayan, J.; Singh, S. P.; Chakrabarti, S.; Chakravarty, R. Anti-Hepatitis B Virus (HBV) Response of Imiquimod Based Toll like Receptor 7 Ligand in Hbv-Positive Human Hepatocelluar Carcinoma Cell Line. BMC Infect. Dis. 2017, 17 (1), 1– 12, DOI: 10.1186/s12879-017-2189-z
- 65Lebold, K. M.; Jacoby, D. B.; Drake, M. G. Toll-Like Receptor 7-Targeted Therapy in Respiratory Disease. Transfus. Med. Hemotherapy 2016, 43 (2), 114– 119, DOI: 10.1159/000445324[Crossref], [PubMed], [CAS], Google Scholar65https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC2s%252FjvVertw%253D%253D&md5=1c53ce28311f89d8315052a01c032ba3Toll-Like Receptor 7-Targeted Therapy in Respiratory DiseaseLebold Katie M; Jacoby David B; Drake Matthew GTransfusion medicine and hemotherapy : offizielles Organ der Deutschen Gesellschaft fur Transfusionsmedizin und Immunhamatologie (2016), 43 (2), 114-9 ISSN:1660-3796.Allergic asthma and allergic rhinitis are inflammatory diseases of the respiratory tract characterized by an excessive type-2 T helper cell (Th2) immune response. Toll-like receptor 7 (TLR7) is a single-stranded viral RNA receptor expressed in the airway that initiates a Th1 immune response and has garnered interest as a novel therapeutic target for treatment of allergic airway diseases. In animal models, synthetic TLR7 agonists reduce airway hyperreactivity, eosinophilic inflammation, and airway remodeling while decreasing Th2-associated cytokines. Furthermore, activation of TLR7 rapidly relaxes airway smooth muscle via production of nitric oxide. Thus, TLR7 has dual bronchodilator and anti-inflammatory effects. Two TLR7 ligands with promising pharmacologic profiles have entered clinical trials for the treatment of allergic rhinitis. Moreover, TLR7 agonists are potential antiviral therapies against respiratory viruses. TLR7 agonists enhance influenza vaccine efficacy and also reduce viral titers when given during an active airway infection. In this review, we examine the current data supporting TLR7 as a therapeutic target in allergic airway diseases.
- 66Vanwalscappel, B.; Tada, T.; Landau, N. R. Toll-like Receptor Agonist R848 Blocks Zika Virus Replication by Inducing the Antiviral Protein Viperin. Virology 2018, 522, 199– 208, DOI: 10.1016/j.virol.2018.07.014[Crossref], [PubMed], [CAS], Google Scholar66https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhtlKmur7P&md5=294a6661456935f303071befd5909353Toll-like receptor agonist R848 blocks Zika virus replication by inducing the antiviral protein viperinVanwalscappel, Benedicte; Tada, Takuya; Landau, Nathaniel R.Virology (2018), 522 (), 199-208CODEN: VIRLAX; ISSN:0042-6822. (Elsevier B.V.)Zika virus (ZIKV) is an emerging pathogen linked to neurol. disorders for which there is currently no targeted therapy. To identify host innate immune response proteins that restrict ZIKV replication, the authors treated monocytes and macrophages with toll-like receptor (TLR) agonists. Of those tested, the TLR7/8 agonist R848 (resiquimod) was the most potent inhibitor of ZIKV replication. RNA-seq anal. identified several genes strongly induced by R848 in monocytes. Testing of several of these for their ability to restrict ZIKV replication identified viperin, an interferon-induced gene active against several viruses. Transduction of microglial CHME3 cells with a viperin lentiviral expression vector rendered them resistant to ZIKV infection, preventing the synthesis of viral RNA and protein. CRISPR/Cas9 knock-out of viperin in macrophages relieved the block to infection, demonstrating that viperin is a major innate immune response protein able to block ZIKV replication. TLR agonists may be useful for the prophylactic or therapeutic treatment for ZIKV.
- 67Sui, Y.; Berzofsky, J. A. Myeloid Cell-Mediated Trained Innate Immunity in Mucosal AIDS Vaccine Development. Front. Immunol. 2020, 11, 315, DOI: 10.3389/fimmu.2020.00315[Crossref], [PubMed], [CAS], Google Scholar67https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhsVGitb%252FF&md5=3187eb55d2d0deb8c89e49213d916a5dMyeloid cell-mediated trained innate immunity in mucosal AIDS vaccine developmentSui, Yongjun; Berzofsky, Jay A.Frontiers in Immunology (2020), 11 (), 315CODEN: FIRMCW; ISSN:1664-3224. (Frontiers Media S.A.)A review. Trained innate immunity has recently emerged as a novel concept of innate immune cells, such as myeloid cells, exhibiting immune memory, and nonspecific heterologous immunity to protect against infections. The memory and specificity are mediated by epigenetic, metabolic, and functional reprogramming of the myeloid cells and myeloid progenitors (and/or NK cells) in the bone marrow and peripheral tissues such as gut and lung mucosa. A variety of agents, such as BCG, viruses, and their components, as well as TLR agonists, and cytokines have been shown to be involved in the induction of trained immunity. Since these agents have been widely used in AIDS vaccine development as antigen delivery vectors or adjuvants, myeloid cell mediated trained immunity might also play an important role in protecting against mucosal AIDS virus transmission or in control of virus replication in the major gut mucosal reservoir. Here we review the trained innate immunity induced by these vectors/adjuvants that have been used in AIDS vaccine studies and discuss their role in mucosal vaccine efficacy and possible utilization in AIDS vaccine development. Delineating the protective effect of the trained innate immunity mediated by myeloid cells will guide the design of novel AIDS vaccines.
- 68Miller, S. M.; Cybulski, V.; Whitacre, M.; Bess, L. S.; Livesay, M. T.; Walsh, L.; Burkhart, D.; Bazin, H. G.; Evans, J. T. Novel Lipidated Imidazoquinoline TLR7/8 Adjuvants Elicit Influenza-Specific Th1 Immune Responses and Protect Against Heterologous H3N2 Influenza Challenge in Mice. Front. Immunol. 2020, 11, 406, DOI: 10.3389/fimmu.2020.00406[Crossref], [PubMed], [CAS], Google Scholar68https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhsVGitLfN&md5=c7e282f0f2c4d7c58568fcbd4c2531e2Novel lipidated imidazoquinoline TLR7/8 adjuvants elicit influenza-specific Th1 immune responses and protect against heterologous H3N2 influenza challenge in miceMiller, Shannon M.; Cybulski, Van; Whitacre, Margaret; Bess, Laura S.; Livesay, Mark T.; Walsh, Lois; Burkhart, David; Bazin, Helene G.; Evans, Jay T.Frontiers in Immunology (2020), 11 (), 406CODEN: FIRMCW; ISSN:1664-3224. (Frontiers Media S.A.)Most licensed seasonal influenza vaccines are non-adjuvanted and rely primarily on vaccine-induced antibody titers for protection. As such, seasonal antigenic drift and suboptimal vaccine strain selection often results in reduced vaccine efficacy. Further, seasonal H3N2 influenza vaccines demonstrate poor efficacy compared to H1N1 and influenza type B vaccines. New vaccines, adjuvants, or delivery technologies that can induce broader or cross-seasonal protection against drifted influenza virus strains, likely through induction of protective T cell responses, are urgently needed. Here, we report novel lipidated TLR7/8 ligands that act as strong adjuvants to promote influenza-virus specific Th1-and Th17-polarized T cell responses and humoral responses in mice with no observable toxicity. Further, the adjuvanted influenza vaccine provided protection against a heterologous H3N2 influenza challenge in mice. These responses were further enhanced when combined with a synthetic TLR4 ligand adjuvant. Despite differences between human and mouse TLR7/8, these novel lipidated imidazoquinolines induced the prodn. of cytokines required to polarize a Th1 and Th17 immune response in human PBMCs providing addnl. support for further development of these compds. as novel adjuvants for the induction of broad supra-seasonal protection from influenza virus.
- 69Macedo, A. B.; Novis, C. L.; De Assis, C. M.; Sorensen, E. S.; Moszczynski, P.; Huang, S. H.; Ren, Y.; Spivak, A. M.; Jones, R. B.; Planelles, V.; Bosque, A. Dual TLR2 and TLR7 Agonists as HIV Latency-Reversing Agents. JCI insight 2018, 3 (19), e122673, DOI: 10.1172/jci.insight.122673
- 70Hu, Y.; Tang, L.; Zhu, Z.; Meng, H.; Chen, T.; Zhao, S.; Jin, Z.; Wang, Z.; Jin, G. A Novel TLR7 Agonist as Adjuvant to Stimulate High Quality HBsAg-Specific Immune Responses in an HBV Mouse Model. J. Transl. Med. 2020, 18 (1), 112, DOI: 10.1186/s12967-020-02275-2[Crossref], [PubMed], [CAS], Google Scholar70https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB387psVansQ%253D%253D&md5=79befa3840c23c8bcc22545c785d5931A novel TLR7 agonist as adjuvant to stimulate high quality HBsAg-specific immune responses in an HBV mouse modelHu Yunlong; Tang Li; Chen Tingting; Zhao Sheng; Jin Zhenchao; Wang Zhulin; Jin Guangyi; Hu Yunlong; Tang Li; Chen Tingting; Zhao Sheng; Jin Zhenchao; Wang Zhulin; Jin Guangyi; Hu Yunlong; Tang Li; Zhu Zhengyu; Meng HeJournal of translational medicine (2020), 18 (1), 112 ISSN:.BACKGROUND: The global burden of hepatitis B virus (HBV) infection in terms of morbidity and mortality is immense. Novel treatments that can induce a protective immune response are urgently needed to effectively control the HBV epidemic and eventually eradicate chronic HBV infection. METHODS: We designed and evaluated an HBV therapeutic vaccine consisting of a novel Toll-like receptor 7 (TLR7) agonist T7-EA, an Alum adjuvant and a recombinant HBsAg protein. We used RNA-seq, ELISA and hTLR7/8 reporting assays to characterize T7-EA in vitro and real-time PCR to evaluate the tissue-retention characteristics in vivo. To evaluate the adjuvant potential, we administrated T7-EA intraperitoneally in a formulation with an Alum adjuvant and HBsAg in normal and HBV mice, then, we evaluated the HBsAg-specific immune responses by ELISA and Elispot assays. RESULTS: T7-EA acted as an hTLR7-specific agonist and induced a similar gene expression pattern as an unmodified TLR7 ligand when Raw 264.7 cells were exposed to T7-EA; however, T7-EA was more potent than the unmodified TLR7 ligand. In vivo studies showed that T7-EA had tissue-retaining activity with stimulating local cytokine and chemokine expression for up to 7 days. T7-EA could induce Th1-type immune responses, as evidenced by an increased HBsAg-specific IgG2a titer and a T-cell response in normal mice compared to mice received traditional Alum-adjuvant HBV vaccine. Importantly, T7-EA could break immune tolerance and induce persistent HBsAg-specific antibody and T-cell responses in an HBV mouse model. CONCLUSIONS: T7-EA might be a candidate adjuvant in a prophylactic and therapeutic HBV vaccine.
- 71Chan, M.; Hayashi, T.; Kuy, C. S.; Gray, C. S.; Wu, C. C. N.; Corr, M.; Wrasidlo, W.; Cottam, H. B.; Carson, D. A. Synthesis and Immunological Characterization of Toll-Like Receptor 7 Agonistic Conjugates. Bioconjugate Chem. 2009, 20 (6), 1194– 1200, DOI: 10.1021/bc900054q[ACS Full Text], [CAS], Google Scholar71https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1MXlvFCrs7Y%253D&md5=945810b3e5d1a5ab14fc998ce1c0989dSynthesis and Immunological Characterization of Toll-Like Receptor 7 Agonistic ConjugatesChan, Michael; Hayashi, Tomoko; Kuy, Crystal S.; Gray, Christine S.; Wu, Christina C. N.; Corr, Maripat; Wrasidlo, Wolfgang; Cottam, Howard B.; Carson, Dennis A.Bioconjugate Chemistry (2009), 20 (6), 1194-1200CODEN: BCCHES; ISSN:1043-1802. (American Chemical Society)Activation of toll-like receptors (TLRs) on cells of the innate immune system initiates, amplifies, and directs the antigen-specific acquired immune response. Ligands that stimulate TLRs, therefore, represent potential immune adjuvants. In this study, a potent TLR7 agonist was conjugated to phospholipids, poly(ethylene glycol) (PEG), or phospholipid-PEG via a versatile benzoic acid functional group. Compared to the unmodified TLR7 agonist, each conjugate displayed a distinctive immunol. profile in vitro and in vivo. In mouse macrophages and human peripheral blood mononuclear cells, the phospholipid TLR7 agonist conjugate was at least 100-fold more potent than the free TLR7 ligands, while the potency of PEG-phospholipid conjugate was similar to that of the unmodified TLR7 agonist. When administered systemically in mice, the phospholipid and phospholipid-PEG TLR7 conjugates induced prolonged increases in the levels of proinflammatory cytokines in serum, compared to the unmodified TLR7 activator. When the conjugates were used as adjuvants during vaccination, only the phospholipid TLR7 agonist conjugates induced both Th1 and Th2 antigen-specific immune responses. These data show that the immunostimulatory activity of a TLR7 ligand can be amplified and focused by conjugation, thus broadening the potential therapeutic application of these agents.
- 72McGowan, D.; Herschke, F.; Pauwels, F.; Stoops, B.; Last, S.; Pieters, S.; Scholliers, A.; Thoné, T.; Van Schoubroeck, B.; De Pooter, D.; Mostmans, W.; Khamlichi, M. D.; Embrechts, W.; Dhuyvetter, D.; Smyej, I.; Arnoult, E.; Demin, S.; Borghys, H.; Fanning, G.; Vlach, J.; Raboisson, P. Novel Pyrimidine Toll-like Receptor 7 and 8 Dual Agonists to Treat Hepatitis B Virus. J. Med. Chem. 2016, 59 (17), 7936– 7949, DOI: 10.1021/acs.jmedchem.6b00747[ACS Full Text], [CAS], Google Scholar72https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28Xhtlamt7vF&md5=f98f5bf04418de548b34463b3ebf2c2eNovel Pyrimidine Toll-like Receptor 7 and 8 Dual Agonists to Treat Hepatitis B VirusMcGowan, David; Herschke, Florence; Pauwels, Frederik; Stoops, Bart; Last, Stefaan; Pieters, Serge; Scholliers, Annick; Thone, Tine; Van Schoubroeck, Bertrand; De Pooter, Dorien; Mostmans, Wendy; Khamlichi, Mourad Daoubi; Embrechts, Werner; Dhuyvetter, Deborah; Smyej, Ilham; Arnoult, Eric; Demin, Samuel; Borghys, Herman; Fanning, Gregory; Vlach, Jaromir; Raboisson, PierreJournal of Medicinal Chemistry (2016), 59 (17), 7936-7949CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)Toll-like receptor (TLR) 7 and 8 agonists can potentially be used in the treatment of viral infections and are particularly promising for chronic hepatitis B virus (HBV) infection. An internal screening effort identified a pyrimidine Toll-like receptor 7 and 8 dual agonist. This provided a novel alternative over the previously reported adenine and pteridone type of agonists. Structure-activity relationship, lead optimization, in silico docking, pharmacokinetics, and demonstration of ex vivo and in vivo cytokine prodn. of the lead compd. are presented.
- 73Embrechts, W.; Herschke, F.; Pauwels, F.; Stoops, B.; Last, S.; Pieters, S.; Pande, V.; Pille, G.; Amssoms, K.; Smyej, I.; Dhuyvetter, D.; Scholliers, A.; Mostmans, W.; Van Dijck, K.; Van Schoubroeck, B.; Thone, T.; De Pooter, D.; Fanning, G.; Jonckers, T. H. M.; Horton, H.; Raboisson, P.; McGowan, D. 2,4-Diaminoquinazolines as Dual Toll-like Receptor (TLR) 7/8 Modulators for the Treatment of Hepatitis B Virus. J. Med. Chem. 2018, 61 (14), 6236– 6246, DOI: 10.1021/acs.jmedchem.8b00643[ACS Full Text], [CAS], Google Scholar73https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXht1CqurvM&md5=7cc741c6b341d318798e26150ce7856c2,4-Diaminoquinazolines as Dual Toll-like Receptor (TLR) 7/8 Modulators for the Treatment of Hepatitis B VirusEmbrechts, Werner; Herschke, Florence; Pauwels, Frederik; Stoops, Bart; Last, Stefaan; Pieters, Serge; Pande, Vineet; Pille, Geert; Amssoms, Katie; Smyej, Ilham; Dhuyvetter, Deborah; Scholliers, Annick; Mostmans, Wendy; Van Dijck, Kris; Van Schoubroeck, Bertrand; Thone, Tine; De Pooter, Dorien; Fanning, Gregory; Jonckers, Tim H. M.; Horton, Helen; Raboisson, Pierre; McGowan, DavidJournal of Medicinal Chemistry (2018), 61 (14), 6236-6246CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)A novel series of 2,4-diaminoquinazolines was identified as potent dual Toll-like receptor (TLR) 7 and 8 agonists with reduced off-target activity. The stereochem. of the amino alc. was found to influence the TLR7/8 selectivity with the (R) isomer resulting in selective TLR8 agonism. Lead optimization toward a dual agonist afforded (S)-3-((2-amino-8-fluoroquinazolin-4-yl)amino)hexanol 31 as a potent analog, being structurally different from previously described dual agonists (McGowan J. Med. Chem. 2016, 59, 7936). Pharmacokinetic and pharmacodynamic (PK/PD) studies revealed the desired high first pass profile aimed at limiting systemic cytokine activation. In vivo pharmacodynamic studies with lead compd. 31 demonstrated prodn. of cytokines consistent with TLR7/8 activation in mice and cynomolgus monkeys and ex vivo inhibition of hepatitis B virus (HBV).
- 74McGowan, D. C.; Herschke, F.; Pauwels, F.; Stoops, B.; Smyej, I.; Last, S.; Pieters, S.; Embrechts, W.; Khamlichi, M. D.; Thoné, T.; Van Schoubroeck, B.; Mostmans, W.; Wuyts, D.; Verstappen, D.; Scholliers, A.; De Pooter, D.; Dhuyvetter, D.; Borghys, H.; Tuefferd, M.; Arnoult, E.; Hong, J.; Fanning, G.; Bollekens, J.; Urmaliya, V.; Teisman, A.; Horton, H.; Jonckers, T. H. M.; Raboisson, P. Identification and Optimization of Pyrrolo[3,2-d]Pyrimidine Toll-like Receptor 7 (TLR7) Selective Agonists for the Treatment of Hepatitis B. J. Med. Chem. 2017, 60 (14), 6137– 6151, DOI: 10.1021/acs.jmedchem.7b00365[ACS Full Text], [CAS], Google Scholar74https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXhtV2qsr%252FL&md5=6482b94555be9b33acf895dff88bd253Identification and Optimization of Pyrrolo[3,2-d]pyrimidine Toll-like Receptor 7 (TLR7) Selective Agonists for the Treatment of Hepatitis BMcGowan, David C.; Herschke, Florence; Pauwels, Frederik; Stoops, Bart; Smyej, Ilham; Last, Stefaan; Pieters, Serge; Embrechts, Werner; Khamlichi, Mourad Daoubi; Thone, Tine; Van Schoubroeck, Bertrand; Mostmans, Wendy; Wuyts, Debbie; Verstappen, Dorien; Scholliers, Annick; De Pooter, Dorien; Dhuyvetter, Deborah; Borghys, Herman; Tuefferd, Marianne; Arnoult, Eric; Hong, Jin; Fanning, Gregory; Bollekens, Jacques; Urmaliya, Vijay; Teisman, Ard; Horton, Helen; Jonckers, Tim H. M.; Raboisson, PierreJournal of Medicinal Chemistry (2017), 60 (14), 6137-6151CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)Pyrrolo[3,2-d]pyrimidines were identified as a new series of potent and selective TLR7 agonists. Compds. were optimized for their activity and selectivity over TLR8. This presents an advantage over recently described scaffolds that have residual TLR8 activity, which may be detrimental to the tolerability of the candidate drug. Oral administration of the lead compd. 54 effectively induced a transient interferon stimulated gene (ISG) response in mice and cynomolgus monkeys. We aimed for a high first pass effect, limiting cytokine induction systemically, and demonstrated the potential for the immunotherapy of viral hepatitis.
- 75Wang, H.-f.; Wang, S.-s.; Tang, Y.-J.; Chen, Y.; Zheng, M.; Tang, Y.-l.; Liang, X.-h. The Double-Edged Sword—How Human Papillomaviruses Interact with Immunity in Head and Neck Cancer. Front. Immunol. 2019, 10, 653, DOI: 10.3389/fimmu.2019.00653[Crossref], [PubMed], [CAS], Google Scholar75https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhtlyrsrfL&md5=b839b72f4a6016e9e888f0a29579efa8The double-edged sword-how human papillomaviruses interact with immunity in head and neck cancerWang, Hao-fan; Wang, Sha-sha; Tang, Ya-Jie; Chen, Yu; Zheng, Min; Tang, Ya-ling; Liang, Xin-huaFrontiers in Immunology (2019), 10 (), 653CODEN: FIRMCW; ISSN:1664-3224. (Frontiers Media S.A.)A review. Patients with human papilloma virus (HPV)-assocd. head and neck squamous cell carcinoma (HNSCC) have remarkably better prognosis, which differs from HPV-neg. oropharyngeal squamous cell carcinoma (OPSCC) with respect to clin., genomic, mol., and immunol. aspects, esp. having the characteristics of high levels of immune cell infiltration and high degrees of immunosuppression. This review will summarize immune evasion mechanisms in HPV-pos. HNSCC, analyze the host various immune responses to HPV and abundant nos. of infiltrating immune cell, and discuss the differences between HPV-pos. HNSCC with cervical cancer. A deeper understanding of the immune landscape will help new concepts to emerge in immune-checkpoint oncol., which might be a valuable add-on to established concepts.
- 76Martinelli, E.; Cicala, C.; Van Ryk, D.; Goode, D. J.; Macleod, K.; Arthos, J.; Fauci, A. S. HIV-1 Gp120 Inhibits TLR9-Mediated Activation and IFN-α Secretion in Plasmacytoid Dendritic Cells. Proc. Natl. Acad. Sci. U. S. A. 2007, 104 (9), 3396– 3401, DOI: 10.1073/pnas.0611353104[Crossref], [PubMed], [CAS], Google Scholar76https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2sXjtVWltL4%253D&md5=f5b850475a90af47c6fb89c30aa03a01HIV-1 gp120 inhibits TLR9-mediated activation and IFN-α secretion in plasmacytoid dendritic cellsMartinelli, Elena; Cicala, Claudia; Van Ryk, Donald; Goode, Diana J.; Macleod, Katilyn; Arthos, James; Fauci, Anthony S.Proceedings of the National Academy of Sciences of the United States of America (2007), 104 (9), 3396-3401CODEN: PNASA6; ISSN:0027-8424. (National Academy of Sciences)Plasmacytoid dendritic cells (pDCs) play a central role in innate and adaptive immune responses against viral infections. pDCs secrete type I IFNs and proinflammatory cytokines upon stimulation by either TLR7 or TLR9. Throughout the course of HIV infection, the prodn. of type-I IFNs is profoundly impaired, and total pDC cell counts in peripheral blood correlates inversely with viral load and pos. with CD4+ T cell count. The origin of these defects is unclear. PDCs express CD4, CCR5, and CXCR4, the primary receptor and coreceptors, resp., for the HIV envelope; yet little is known concerning the effects of the viral envelope on these cells. Here, the authors show that exposure of pDCs to gp120 results in the suppression of activation of these cells. This suppression is specific for TLR9-mediated responses, because TLR7-mediated responses are unaffected by gp120. Gp120 also suppressed TLR9-mediated induction of proinflammatory cytokines and expression of CD83, a marker of DC activation. Finally, gp120 suppressed pDC-induced cytolytic activity of natural killer cells. Taken together, these data demonstrate that the direct interaction of HIV-1 gp120 with pDCs interferes with TLR9 activation resulting in a decreased ability of pDCs to secrete antiviral and inflammatory factors that play a central role in initiating host immune responses against invading pathogens.
- 77Kaminski, J. J.; Schattgen, S. A.; Tzeng, T.; Bode, C.; Klinman, D. M.; Fitzgerald, K. A. Synthetic Oligodeoxynucleotides Containing Suppressive TTAGGG Motifs Inhibit AIM2 Inflammasome Activation. J. Immunol. 2013, 191 (7), 3876– 3883, DOI: 10.4049/jimmunol.1300530[Crossref], [PubMed], [CAS], Google Scholar77https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXhsV2nsLfO&md5=ac712232cd8eb5ce369aa622fc5869d3Synthetic Oligodeoxynucleotides Containing Suppressive TTAGGG Motifs Inhibit AIM2 Inflammasome ActivationKaminski, John J.; Schattgen, Stefan A.; Tzeng, Te-Chen; Bode, Christian; Klinman, Dennis M.; Fitzgerald, Katherine A.Journal of Immunology (2013), 191 (7), 3876-3883CODEN: JOIMA3; ISSN:0022-1767. (American Association of Immunologists)Synthetic oligodeoxynucleotides (ODNs) comprised of the immunosuppressive motif TTAGGG block TLR9 signaling, prevent STAT1 and STAT4 phosphorylation and attenuate a variety of inflammatory responses in vivo. In this study, we demonstrate that such suppressive ODN abrogate activation of cytosolic nucleic acid-sensing pathways. Pretreatment of dendritic cells and macrophages with the suppressive ODN-A151 abrogated type I IFN, TNF-α, and ISG induction in response to cytosolic dsDNA. In addn., A151 abrogated caspase-1-dependent IL-1β and IL-18 maturation in dendritic cells stimulated with dsDNA and murine CMV. Inhibition was dependent on A151's phosphorothioate backbone, whereas substitution of the guanosine residues for adenosine neg. affected potency. A151 mediates these effects by binding to AIM2 in a manner that is competitive with immune-stimulatory DNA and as a consequence prevents AIM2 inflammasome complex formation. Collectively, these findings reveal a new route by which suppressive ODNs modulate the immune system and unveil novel applications for suppressive ODNs in the treatment of infectious and autoimmune diseases.
- 78Noh, J. Y.; Yoon, S. R.; Kim, T. D.; Choi, I.; Jung, H. Toll-Like Receptors in Natural Killer Cells and Their Application for Immunotherapy. J. Immunol. Res. 2020, 2020, 2045860, DOI: 10.1155/2020/2045860[Crossref], [PubMed], [CAS], Google Scholar78https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB38vjvV2ltA%253D%253D&md5=5302aca03ac3981983ec6c2ea34fb84fToll-Like Receptors in Natural Killer Cells and Their Application for ImmunotherapyNoh Ji-Yoon; Yoon Suk Ran; Kim Tae-Don; Choi Inpyo; Jung Haiyoung; Yoon Suk Ran; Kim Tae-Don; Choi InpyoJournal of immunology research (2020), 2020 (), 2045860 ISSN:.Innate immunity represents the first barrier for host defense against microbial infection. Toll-like receptors (TLRs) are the most well-defined PRRs with respect to PAMP recognition and induction of innate immune responses. They recognize pathogen-associated molecular patterns (PAMPs) and trigger innate immune responses by inducing inflammatory cytokines, chemokines, antigen-presenting molecules, and costimulatory molecules. TLRs are expressed either on the cell surface or within endosomes of innate immune cells. NK cells are one of the innate immune cells and also express TLRs to recognize or respond to PAMPs. TLRs in NK cells induce the innate immune responses against bacterial and viral infections via inducing NK cytotoxicity and cytokine production. In this review, we will discuss the expression and cellular function of TLRs in NK cells and also introduce some therapeutic applications of TLR agonists for NK cell-mediated immunotherapy.
- 79Chen, L.; Yu, J. Modulation of Toll-like Receptor Signaling in Innate Immunity by Natural Products. Int. Immunopharmacol. 2016, 37, 65– 70, DOI: 10.1016/j.intimp.2016.02.005[Crossref], [PubMed], [CAS], Google Scholar79https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XisFyis78%253D&md5=263a3dc283d703e63f007c925af2fa67Modulation of Toll-like receptor signaling in innate immunity by natural productsChen, Luxi; Yu, JianhuaInternational Immunopharmacology (2016), 37 (), 65-70CODEN: IINMBA; ISSN:1567-5769. (Elsevier B.V.)For centuries, natural products and their derivs. have provided a rich source of compds. for the development of new immunotherapies in the treatment of human disease. Many of these compds. are currently undergoing clin. trials, particularly as anti-oxidative, anti-microbial, and anti-cancer agents. However, the function and mechanism of natural products in how they interact with our immune system has yet to be extensively explored. Natural immune modulators may provide the key to control and ultimately defeat disorders affecting the immune system. They can either up- or down-regulate the immune response with few undesired adverse effects. In this review, we summarize the recent advancements made in utilizing natural products for immunomodulation and their important mol. targets, members of the Toll-like receptor (TLR) family, in the innate immune system.
- 80Fraietta, J. A.; Mueller, Y. M.; Do, D. H.; Holmes, V. M.; Howett, M. K.; Lewis, M. G.; Boesteanu, A. C.; Alkan, S. S.; Katsikis, P. D. Phosphorothioate 2′ Deoxyribose Oligomers as Microbicides That Inhibit Human Immunodeficiency Virus Type 1 (HIV-1) Infection and Block Toll-like Receptor 7 (TLR7) and TLR9 Triggering by HIV-1. Antimicrob. Agents Chemother. 2010, 54 (10), 4064– 4073, DOI: 10.1128/AAC.00367-10[Crossref], [PubMed], [CAS], Google Scholar80https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3cXhtlegsbfN&md5=b48670ab862461c81d9b568fc6da616aPhosphorothioate 2' deoxyribose oligomers as microbicides that inhibit human immunodeficiency virus type 1 (HIV-1) infection and block Toll-like receptor 7 (TLR7) and TLR9 triggering by HIV-1Fraietta, Joseph A.; Mueller, Yvonne M.; Do, Duc H.; Holmes, Veronica M.; Howett, Mary K.; Lewis, Mark G.; Boesteanu, Alina C.; Alkan, Sefik S.; Katsikis, Peter D.Antimicrobial Agents and Chemotherapy (2010), 54 (10), 4064-4073CODEN: AMACCQ; ISSN:0066-4804. (American Society for Microbiology)Topical microbicides may prove to be an important strategy for preventing human immunodeficiency virus type 1 (HIV-1) transmission. We examd. the safety and efficacy of sequence-nonspecific phosphorothioate 2' deoxyribose oligomers as potential novel microbicides. A short, 13-mer poly(T) phosphorothioate oligodeoxynucleotide (OPB-T) significantly inhibited infection of primary peripheral blood mononuclear cells (PBMC) by high-titer HIV-1Ba-L and simian immunodeficiency virus mac251 (SIVmac251). Continuous exposure of human vaginal and foreskin tissue explants to OPB-T showed no toxicity. An abasic 14-mer phosphorothioate 2' deoxyribose backbone (PDB) demonstrated enhanced anti-HIV-1 activity relative to OPB-T and other homo-oligodeoxynucleotide analogs. When PDB was used to pretreat HIV-1, PDB was effective against R5 and X4 isolates at a half-maximal inhibitory concn. (IC50) of <1 μM in both PBMC and P4-R5 MAGI cell infections. PDB also reduced HIV-1 infectivity following the binding of virus to target cells. This novel topical microbicide candidate exhibited an excellent in vitro safety profile in human PBMC and endocervical epithelial cells. PDB also retained activity in hydroxyethylcellulose gel at pH 4.4 and after transition to a neutral pH and was stable in this formulation for 30 days at room temp. Furthermore, the compd. displayed potent antiviral activity following incubation with a Lactobacillus strain derived from normal vaginal flora. Most importantly, PDB can inhibit HIV-1-induced alpha interferon prodn. Phosphorothioate 2' deoxyribose oligomers may therefore be promising microbicide candidates that inhibit HIV-1 infection and also dampen the inflammation which is crit. for the initial spread of the virus.
- 81Udgata, A.; Dolasia, K.; Ghosh, S.; Mukhopadhyay, S. Dribbling through the Host Defence: Targeting the TLRs by Pathogens. Crit. Rev. Microbiol. 2019, 45 (3), 354– 368, DOI: 10.1080/1040841X.2019.1608904[Crossref], [PubMed], [CAS], Google Scholar81https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXht1Gis7bJ&md5=7590824d76dfc3fb5b180bc672b63a4dDribbling through the host defence: targeting the TLRs by pathogensUdgata, Atul; Dolasia, Komal; Ghosh, Sudip; Mukhopadhyay, SangitaCritical Reviews in Microbiology (2019), 45 (3), 354-368CODEN: CRVMAC; ISSN:1040-841X. (Taylor & Francis Ltd.)A review. The immune system is well-equipped with sensors that detect invading pathogens and dictate subsequent immune responses for clearing the infections. One such class of sensor is the toll-like receptor (TLR), that can sense diverse mols. of pathogen origin such as proteins, lipids, carbohydrate, DNA, RNA, and trigger suitable immune responses to prevent infections. However, successful pathogens have evolved strategies to bypass the TLR-driven host immune responses to enable their survival inside the host. In this review, we have discussed about the recent advances in TLR biol. and strategies adopted by various pathogens (bacteria, virus, and parasites) to subvert the TLR-signalling for evading host-immune attack. Further, we have discussed how TLRs are linked in augmenting infection burden and disease severity in host during co-infection. This information is likely to be helpful to design TLR-based immunotherapeutics to control various infections and pathophysiol. disorders.
- 82Oliveira-Nascimento, L.; Massari, P.; Wetzler, L. M. The Role of TLR2 in Infection and Immunity. Front. Immunol. 2012, 3, 1– 17, DOI: 10.3389/fimmu.2012.00079
- 83Vidya, M. K.; Kumar, V. G.; Sejian, V.; Bagath, M.; Krishnan, G.; Bhatta, R. Toll-like Receptors: Significance, Ligands, Signaling Pathways, and Functions in Mammals. Int. Rev. Immunol. 2018, 37 (1), 20– 36, DOI: 10.1080/08830185.2017.1380200[Crossref], [PubMed], [CAS], Google Scholar83https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXhs1Gks7fN&md5=5082ffcd87854b5c09da1e2483880536Toll-like receptors: Significance, ligands, signaling pathways, and functions in mammalsVidya, Mallenahally Kusha; Kumar, V. Girish; Sejian, Veerasamy; Bagath, Madiajagan; Krishnan, Govindan; Bhatta, RaghavendraInternational Reviews of Immunology (2018), 37 (1), 20-36CODEN: IRIMEH; ISSN:0883-0185. (Taylor & Francis Ltd.)This review attempts to cover the implication of the toll-like receptors (TLRs) in controlling immune functions with emphasis on their significance, function, regulation and expression patterns. The tripartite TLRs are type I integral transmembrane receptors that are involved in recognition and conveying of pathogens to the immune system. These paralogs are located on cell surfaces or within endosomes. The TLRs are found to be functionally involved in the recognition of self and non-self-antigens, maturation of DCs and initiation of antigen-specific adaptive immune responses as they bridge the innate and adaptive immunity. Interestingly, they also have a significant role in immunotherapy and vaccination. Signals generated by TLRs are transduced through NFκB signaling and MAP kinases pathway to recruit pro-inflammatory cytokines and co-stimulatory mols., which promote inflammatory responses. The excess prodn. of these cytokines leads to grave systemic disorders like tumor growth and autoimmune disorders. Hence, regulation of the TLR signaling pathway is necessary to keep the host system safe. Many mols. like LPS, SOCS1, IRAK1, NFκB, and TRAF3 are involved in modulating the TLR pathways to induce appropriate response. Though quantification of these TLRs helps in correlating the magnitude of immune response exhibited by the animal, there are several internal, external, genetic and animal factors that affect their expression patterns. So it can be concluded that any identification based on those expression profiles may lead to improper diagnosis during certain conditions.
- 84Fitzgerald, K. A.; Kagan, J. C. Toll-like Receptors and the Control of Immunity. Cell 2020, 180 (6), 1044– 1066, DOI: 10.1016/j.cell.2020.02.041[Crossref], [PubMed], [CAS], Google Scholar84https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXkvVeltbc%253D&md5=8d4428b11fd797f7e661c7f321193cccToll-like Receptors and the Control of ImmunityFitzgerald, Katherine A.; Kagan, Jonathan C.Cell (Cambridge, MA, United States) (2020), 180 (6), 1044-1066CODEN: CELLB5; ISSN:0092-8674. (Cell Press)A review. The study of innate immunity and its link to inflammation and host defense encompasses diverse areas of biol., ranging from genetics and biophysics to signal transduction and physiol. Central to our understanding of these events are the Toll-like receptors (TLRs), an evolutionarily ancient family of pattern recognition receptors. Herein, we describe the mechanisms and consequences of TLR-mediated signal transduction with a focus on themes identified in the TLR pathways that also explain the operation of other immune signaling pathways. These themes include the detection of conserved microbial structures to identify infectious agents and the use of supramol. organizing centers (SMOCs) as signaling organelles that ensure digital cellular responses. Further themes include mechanisms of inducible gene expression, the coordination of gene regulation and metab., and the influence of these activities on adaptive immunity. Studies in these areas have informed the development of next-generation therapeutics, thus ensuring a bright future for research in this area.
- 85Mifsud, E. J.; Tan, A. C. L.; Jackson, D. C. TLR Agonists as Modulators of the Innate Immune Response and Their Potential as Agents against Infectious Disease. Front. Immunol. 2014, 5, 79, DOI: 10.3389/fimmu.2014.00079[Crossref], [PubMed], [CAS], Google Scholar85https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC2cflslSjsg%253D%253D&md5=cf341d326f79a1c5a47d7efd5679a7beTLR Agonists as Modulators of the Innate Immune Response and Their Potential as Agents Against Infectious DiseaseMifsud Edin J; Tan Amabel C L; Jackson David CFrontiers in immunology (2014), 5 (), 79 ISSN:1664-3224.Immunotherapies that can either activate or suppress innate immune responses are being investigated as treatments against infectious diseases and the pathology they can cause. The objective of these therapies is to elicit protective immune responses thereby limiting the harm inflicted by the pathogen. The Toll-like receptor (TLR) signaling pathway plays critical roles in numerous host immune defenses and has been identified as an immunotherapeutic target against the consequences of infectious challenge. This review focuses on some of the recent advances being made in the development of TLR-ligands as potential prophylactic and/or therapeutic agents.
- 86Salunke, D. B.; Connelly, S. W.; Shukla, N. M.; Hermanson, A. R.; Fox, L. M.; David, S. A. Design and Development of Stable, Water-Soluble, Human Toll-like Receptor 2 Specific Monoacyl Lipopeptides as Candidate Vaccine Adjuvants. J. Med. Chem. 2013, 56 (14), 5885– 5900, DOI: 10.1021/jm400620g[ACS Full Text], [CAS], Google Scholar86https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXpvFans7s%253D&md5=cb0eb5192ab742a75d8a43edf7f5f20aDesign and Development of Stable, Water-Soluble, Human Toll-like Receptor 2 Specific Monoacyl Lipopeptides as Candidate Vaccine AdjuvantsSalunke, Deepak B.; Connelly, Seth W.; Shukla, Nikunj M.; Hermanson, Alec R.; Fox, Lauren M.; David, Sunil A.Journal of Medicinal Chemistry (2013), 56 (14), 5885-5900CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)Antigens in modern subunit vaccines are largely sol. and poorly immunogenic proteins inducing relatively short-lived immune responses. Appropriate adjuvants initiate early innate immune responses, amplifying subsequent adaptive immune responses. Agonists of Toll-like receptor 2 (TLR2) are devoid of significant proinflammatory activity in ex vivo human blood models and yet are potently adjuvantic, suggesting that this chemotype may be a safe and effective adjuvant. Our earlier work on the monoacyl lipopeptide class of TLR2 agonists led to the design of a highly potent lead but with negligible aq. soly., necessitating the reintroduction of aq. soly. We explored several strategies of introducing ionizable groups on the lipopeptide, as well as the systematic evaluation of chem. stable bioisosteres of the ester-linked palmitoyl group. These studies have led to a fully optimized, chem. stable, and highly water-sol. human TLR2-specific agonist, which was found to have an excellent safety profile and displayed prominent adjuvantic activities in rabbit models.
- 87Tan, A. C. L.; Deliyannis, G.; Bharadwaj, M.; Brown, L. E.; Zeng, W.; Jackson, D. C. The Design and Proof of Concept for a CD8+ T Cell-Based Vaccine Inducing Cross-Subtype Protection against Influenza A Virus. Immunol. Cell Biol. 2013, 91 (1), 96– 104, DOI: 10.1038/icb.2012.54[Crossref], [PubMed], [CAS], Google Scholar87https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXms12jtA%253D%253D&md5=fc1ebe7af4709ff25f25288f286de90dThe design and proof of concept for a CD8+ T cell-based vaccine inducing cross-subtype protection against influenza A virusTan, Amabel C. L.; Deliyannis, Georgia; Bharadwaj, Mandvi; Brown, Lorena E.; Zeng, Weiguang; Jackson, David C.Immunology & Cell Biology (2013), 91 (1), 96-104CODEN: ICBIEZ; ISSN:0818-9641. (NPG Nature Asia-Pacific)In this study, the authors examd. the reactivity of human peripheral blood mononuclear cells to a panel of influenza A virus (IAV) CD8+ T-cell epitopes that are recognized by the major human leukocyte antigen (HLA) groups represented in the human population. The authors examd. the level of recognition in a sample of the human population and the potential coverage that could be achieved if these were incorporated into a T-cell epitope-based vaccine. The authors then designed a candidate influenza vaccine that incorporated three of the examd. HLA-A2-restricted influenza epitopes into Pam2Cys-based lipopeptides. These lipopeptides do not require the addn. of an adjuvant and can be delivered directly to the respiratory mucosa enabling the generation of local memory cell populations that are crucial for clearance of influenza. Intranasal administration of a mixt. of three lipopeptides to HLA-A2 transgenic HHD mice elicited multiple CD8+ T-cell specificities in the spleen and lung that closely mimicked the response generated following natural infection with influenza. These CD8+ T cells were assocd. with viral redn. following H3N1 influenza virus challenge for as long as 3 mo after lipopeptide administration. In addn., lipopeptides contg. IAV-targeting epitopes conferred substantial benefit against death following infection with a virulent H1N1 strain. Because CD8+ T cell epitopes are often derived from highly conserved regions of influenza viruses, such vaccines need not be reformulated annually and unlike current antibody-inducing vaccines could provide cross-protective immunity against newly emerging pandemic viruses. Immunol. and Cell Biol. (2013) 91, 96-104; doi:10.1038/icb.2012.54; published online 13 Nov. 2012.
- 88Mifsud, E. J.; Tan, A. C.; Short, K. R.; Brown, L. E.; Chua, B. Y.; Jackson, D. C. Reducing the Impact of Influenza-Associated Secondary Pneumococcal Infections. Immunol. Cell Biol. 2016, 94 (1), 101– 108, DOI: 10.1038/icb.2015.71[Crossref], [PubMed], [CAS], Google Scholar88https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXht1Wqt7zK&md5=463e1e13037ecf03fc2202042c28de8dReducing the impact of influenza-associated secondary pneumococcal infectionsMifsud, Edin J.; Tan, Amabel C.; Short, Kirsty R.; Brown, Lorena E.; Chua, Brendon Y.; Jackson, David C.Immunology & Cell Biology (2016), 94 (1), 101-108CODEN: ICBIEZ; ISSN:0818-9641. (NPG Nature Asia-Pacific)When administered prophylactically, we show that the Toll-like receptor-2 (TLR-2) agonist PEG-Pam2Cys (pegylated-S-(2,3-bis(palmitoyloxy)propyl)cysteine) not only mediates potent anti-viral activity against influenza virus but also reduces the impact of secondary infections with Streptococcus pneumoniae (the pneumococcus) by reducing (i) pulmonary viral and bacterial burdens, (ii) the levels of proinflammatory cytokines that normally accompany influenza and S. pneumoniae secondary infections and (iii) the vascular permeability of the pulmonary tract that can allow bacterial invasion of the blood in mice. We also show that an inactivated detergent-disrupted influenza virus vaccine formulated with the Pam2Cys-based adjuvant R4-Pam2Cys provides the host with both immediate and long-term protection against secondary pneumococcal infections following influenza virus infection through innate and specific immune mechanisms, resp. Vaccinated animals generated influenza virus-specific immune responses that provided the host with long-term protection against influenza virus and its sequelae. This vaccine, which generates an immediate response, provides an addnl. countermeasure, which is ideal for use even in the midst of an influenza outbreak.
- 89Wu, W.; Li, R.; Malladi, S. S.; Warshakoon, H. J.; Kimbrell, M. R.; Amolins, M. W.; Ukani, R.; Datta, A.; David, S. A. Structure-Activity Relationships in Toll-like Receptor-2 Agonistic Diacylthioglycerol Lipopeptides. J. Med. Chem. 2010, 53 (8), 3198– 3213, DOI: 10.1021/jm901839g[ACS Full Text], [CAS], Google Scholar89https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3cXjs1Wktb8%253D&md5=49dd3dd1a4967d5694564fdc4ccfeebbStructure-Activity Relationships in Toll-like Receptor-2 Agonistic Diacylthioglycerol LipopeptidesWu, Wenyan; Li, Rongti; Malladi, Subbalakshmi S.; Warshakoon, Hemamali J.; Kimbrell, Matthew R.; Amolins, Michael W.; Ukani, Rehman; Datta, Apurba; David, Sunil A.Journal of Medicinal Chemistry (2010), 53 (8), 3198-3213CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)The N-termini of bacterial lipoproteins are acylated with a (S)-(2,3-bisacyloxypropyl)cysteinyl residue. Lipopeptides derived from lipoproteins activate innate immune responses by engaging Toll-like receptor 2 (TLR2) and are highly immunostimulatory and yet without apparent toxicity in animal models. The lipopeptides may therefore be useful as potential immunotherapeutic agents. Previous structure-activity relationships in such lipopeptides have largely been obtained using murine cells, and it is now clear that significant species-specific differences exist between human and murine TLR responses. We have examd. in detail the role of the highly conserved Cys residue as well as the geometry and stereochem. of the Cys-Ser dipeptide unit. (R)-Diacylthioglycerol analogs are maximally active in reporter gene assays using human TLR2. The Cys-Ser dipeptide unit represents the minimal part-structure, but its stereochem. was found not to be a crit. determinant of activity. The thioether bridge between the diacyl and dipeptide units is crucial, and replacement by an oxoether bridge results in a dramatic decrease in activity.
- 90Salunke, D. B.; Shukla, N. M.; Yoo, E.; Crall, B. M.; Balakrishna, R.; Malladi, S. S.; David, S. A. Structure-Activity Relationships in Human Toll-like Receptor 2-Specific Monoacyl Lipopeptides. J. Med. Chem. 2012, 55 (7), 3353– 3363, DOI: 10.1021/jm3000533[ACS Full Text], [CAS], Google Scholar90https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC38XjtFGmt70%253D&md5=f03c060a2bcb85190ff6a8b792fe564cStructure-Activity Relationships in Human Toll-like Receptor 2-Specific Monoacyl LipopeptidesSalunke, Deepak B.; Shukla, Nikunj M.; Yoo, Euna; Crall, Breanna M.; Balakrishna, Rajalakshmi; Malladi, Subbalakshmi S.; David, Sunil A.Journal of Medicinal Chemistry (2012), 55 (7), 3353-3363CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)Toll-like receptor 2-agonistic lipopeptides typified by S-[2,3-bis(palmitoyloxy)-(2RS)-propyl]-R-cysteinyl-S-serine (PAM2CS) compds. are potential vaccine adjuvants. We had previously detd. that at least one acyl group of optimal length (C16) and an appropriately oriented ester carbonyl group is essential for TLR2-agonistic activity. We now show that these structurally simpler analogs display agonistic activities with human, but not murine, TLR2. SAR studies on the monoacyl derivs. show that the optimal acyl chain length is C16, and aryl substituents are not tolerated. A variety of alkyl and acyl substituents on the cysteine amine were examd. All N-alkyl derivs. were inactive. In contradistinction, short-chain N-acyl analogs were found to be highly active, with a clear dependence on the chain length. A cysteine N-acetyl analog was found to be the most potent (EC50: 1 nM), followed by the N-butyryl analog. The N-acetyl analog is human TLR2-specific, with its potency comparable to that of PAM2CS.
- 91Steinhagen, F.; Kinjo, T.; Bode, C.; Klinman, D. M. TLR-Based Immune Adjuvants. Vaccine 2011, 29 (17), 3341– 3355, DOI: 10.1016/j.vaccine.2010.08.002[Crossref], [PubMed], [CAS], Google Scholar91https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3MXkvVWjsb0%253D&md5=fdf92eff10e87ac4f2264541740a8991TLR-based immune adjuvantsSteinhagen, Folkert; Kinjo, Takeshi; Bode, Christian; Klinman, Dennis M.Vaccine (2011), 29 (17), 3341-3355CODEN: VACCDE; ISSN:0264-410X. (Elsevier Ltd.)A review. This work describes the nature and strength of the immune response induced by various Toll-like receptor ligands and their ability to act as vaccine adjuvants. It reviews the various ligands capable of triggering individual TLRs, and then focuses on the efficacy and safety of those agents for which clin. results are available.
- 92Luo, Y.; Friese, O. V.; Runnels, H. A.; Khandke, L.; Zlotnick, G.; Aulabaugh, A.; Gore, T.; Vidunas, E.; Raso, S. W.; Novikova, E.; Byrne, E.; Schlittler, M.; Stano, D.; Dufield, R. L.; Kumar, S.; Anderson, A. S.; Jansen, K. U.; Rouse, J. C. The Dual Role of Lipids of the Lipoproteins in Trumenba, a Self-Adjuvanting Vaccine Against Meningococcal Meningitis B Disease. AAPS J. 2016, 18 (6), 1562– 1575, DOI: 10.1208/s12248-016-9979-x[Crossref], [PubMed], [CAS], Google Scholar92https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XhvFCqtbbO&md5=08e8c20ebde879649793707dd829c992The Dual Role of Lipids of the Lipoproteins in Trumenba, a Self-Adjuvanting Vaccine Against Meningococcal Meningitis B DiseaseLuo, Yin; Friese, Olga V.; Runnels, Herbert A.; Khandke, Lakshmi; Zlotnick, Gary; Aulabaugh, Ann; Gore, Thomas; Vidunas, Eugene; Raso, Stephen W.; Novikova, Elena; Byrne, Emilia; Schlittler, Michael; Stano, Donald; Dufield, Robert L.; Kumar, Sandeep; Anderson, Annaliesa S.; Jansen, Kathrin U.; Rouse, Jason C.AAPS Journal (2016), 18 (6), 1562-1575CODEN: AJAOB6; ISSN:1550-7416. (Springer)Trumenba (bivalent rLP2086) is a vaccine licensed for the prevention of meningococcal meningitis disease caused by Neisseria meningitidis serogroup B (NmB) in individuals 10-25 years of age in the USA. The vaccine is composed of two factor H binding protein (fHbp) variants that were recombinantly expressed in Escherichia coli as native lipoproteins: rLP2086-A05 and rLP2086-B01. The vaccine was shown to induce potent bactericidal antibodies against a broad range of NmB isolates expressing fHbp that were different in sequence from the fHbp vaccine antigens. Here, we describe the characterization of the vaccine antigens including the elucidation of their structure which is characterized by two distinct motifs, the polypeptide domain and the N-terminal lipid moiety. In the vaccine formulation, the lipoproteins self-assoc. to form micelles driven by the hydrophobicity of the lipids and limited by the size of the folded polypeptides. The micelles help to increase the structural stability of the lipoproteins in the absence of bacterial cell walls. Anal. of the lipoproteins in Toll-like receptor (TLR) activation assays revealed their TLR2 agonist activity. This activity was lost with removal of the O-linked fatty acids, similar to removal of all lipids, demonstrating that this moiety plays an adjuvant role in immune activation. The thorough understanding of the structure and function of each moiety of the lipoproteins, as well as their relationship, lays the foundation for identifying crit. parameters to guide vaccine development and manuf.
- 93Seib, K. L.; Scarselli, M.; Comanducci, M.; Toneatto, D.; Masignani, V. Neisseria Meningitidis Factor H-Binding Protein FHbp: Key Virulence Factor and Vaccine Antigen. Expert Rev. Vaccines 2015, 14 (6), 841– 859, DOI: 10.1586/14760584.2015.1016915[Crossref], [PubMed], [CAS], Google Scholar93https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXotFWltL8%253D&md5=16b961e1e4fb96f95ff16239f38d3601Neisseria meningitidis factor H-binding protein fHbp: a key virulence factor and vaccine antigenSeib, Kate L.; Scarselli, Maria; Comanducci, Maurizio; Toneatto, Daniela; Masignani, VegaExpert Review of Vaccines (2015), 14 (6), 841-859CODEN: ERVXAX; ISSN:1476-0584. (Informa Healthcare)Neisseria meningitidis is a leading cause of meningitis and sepsis worldwide. The first broad-spectrum multicomponent vaccine against serogroup B meningococcus (MenB), 4CMenB (Bexsero), was approved by the EMA in 2013, for prevention of MenB disease in all age groups, and by the US FDA in Jan. 2015 for use in adolescents. A second protein-based MenB vaccine has also been approved in the USA for adolescents (rLP2086, Trumenba). Both vaccines contain the lipoprotein factor H-binding protein (fHbp). Preclin. studies demonstrated that fHbp elicits a robust bactericidal antibody response that correlates with the amt. of fHbp expressed on the bacterial surface. FHbp is able to selectively bind human factor H, the key regulator of the alternative complement pathway, and this has important implications both for meningococcal pathogenesis and for vaccine design. Here, we review the functional and structural properties of fHbp, the strategies that led to the design of the two fHbp-based vaccines and the data generated during clin. studies.
- 94Murgueitio, M. S.; Rakers, C.; Frank, A.; Wolber, G. Balancing Inflammation: Computational Design of Small-Molecule Toll-like Receptor Modulators. Trends Pharmacol. Sci. 2017, 38 (2), 155– 168, DOI: 10.1016/j.tips.2016.10.007[Crossref], [PubMed], [CAS], Google Scholar94https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XhslKnu7jK&md5=ba4f734c3604910c1f56ec6d6d3717f9Balancing Inflammation: Computational Design of Small-Molecule Toll-like Receptor ModulatorsMurgueitio, Manuela S.; Rakers, Christin; Frank, Anne; Wolber, GerhardTrends in Pharmacological Sciences (2017), 38 (2), 155-168CODEN: TPHSDY; ISSN:0165-6147. (Elsevier Ltd.)As essential proteins of the innate immune system, Toll-like receptors (TLRs) are involved in a plethora of physiol. pathologies and their modulation is an ongoing quest in the field of drug discovery. Although TLRs recognize an unusually broad range of different mol. patterns, only a few small-mol. TLR modulators have been reported to date. Recent advances in crystallog. and in silico techniques provide promising opportunities for TLR investigations and drug design. Here, three application areas for computational approaches are considered: (i) exploration of TLR structure and activation; (ii) understanding TLR modulation; and (iii) TLR drug discovery. By providing an overview on state-of-the-art computational methods, we highlight the value of mol. modeling in mechanistically understanding TLR function and guiding drug design.
- 95Cheng, K.; Gao, M.; Godfroy, J. I.; Brown, P. N.; Kastelowitz, N.; Yin, H. Specific Activation of the TLR1-TLR2 Heterodimer by Small-Molecule Agonists. Sci. Adv. 2015, 1 (3), e1400139, DOI: 10.1126/sciadv.1400139[Crossref], [PubMed], [CAS], Google Scholar95https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28Xht1Oqt7vP&md5=d072710e2bbaaab12f74abc7ac0e3868Specific activation of the TLR1-TLR2 heterodimer by small-molecule agonistsCheng, Kui; Gao, Meng; Godfroy, James I.; Brown, Peter N.; Kastelowitz, Noah; Yin, HangScience Advances (2015), 1 (3), e1400139/1-e1400139/12CODEN: SACDAF; ISSN:2375-2548. (American Association for the Advancement of Science)Toll-like receptor (TLR) agonists activate both the innate and the adaptive immune systems. These TLR agonists have been exploited as potent vaccine adjuvants and antitumor agents. We describe the identification and characterization of a small mol., N-methyl-4-nitro-2-(4-(4-(trifluoromethyl)phenyl)-1H-imidazol-1-yl)aniline (CU-T12-9), that directly targets TLR1/2 to initiate downstream signaling. CU-T12-9 specifically induces TLR1/2 activation, which can be blocked by either the anti-hTLR1 or the anti-hTLR2 antibody, but not the anti-hTLR6 antibody. Using a variety of different biophys. assays, we have demonstrated the binding mode of CU-T12-9. By binding to both TLR1 and TLR2, CU-T12-9 facilitates the TLR1/2 heterodimeric complex formation, which in turn activates the downstream signaling. Fluorescence anisotropy assays revealed competitive binding to the TLR1/2 complex between CU-T12-9 and Pam3CSK4 with a half-maximal inhibitory concn. (IC50) of 54.4 nM. Finally, we showed that CU-T12-9 signals through nuclear factor κB (NF-κB) and invokes an elevation of the downstream effectors tumor necrosis factor-α (TNF-α), interleukin-10 (IL-10), and inducible nitric oxide synthase (iNOS). Thus, our studies not only provide compelling new insights into the regulation of TLR1/2 signaling transduction but also may facilitate future therapeutic developments.
- 96Botos, I.; Segal, D. M.; Davies, D. R. The Structural Biology of Toll-like Receptors. Structure 2011, 19 (4), 447– 459, DOI: 10.1016/j.str.2011.02.004[Crossref], [PubMed], [CAS], Google Scholar96https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3MXksFyit78%253D&md5=7c71f872271b6b299a016bbc9f44ec80The Structural Biology of Toll-like ReceptorsBotos, Istvan; Segal, David M.; Davies, David R.Structure (Cambridge, MA, United States) (2011), 19 (4), 447-459CODEN: STRUE6; ISSN:0969-2126. (Cell Press)A review. The membrane-bound Toll-like receptors (TLRs) trigger innate immune responses after recognition of a wide variety of pathogen-derived compds. Despite the wide range of ligands recognized by TLRs, the receptors share a common structural framework in their extracellular, ligand-binding domains. These domains all adopt horseshoe-shaped structures built from leucine-rich repeat motifs. Typically, on ligand binding, two extracellular domains form an "m"-shaped dimer sandwiching the ligand mol. bringing the transmembrane and cytoplasmic domains in close proximity and triggering a downstream signaling cascade. Although the ligand-induced dimerization of these receptors has many common features, the nature of the interactions of the TLR extracellular domains with their ligands varies markedly between TLR paralogs.
- 97Hu, Z.; Banothu, J.; Beesu, M.; Gustafson, C. J.; Brush, M. J. H.; Trautman, K. L.; Salyer, A. C. D.; Pathakumari, B.; David, S. A. Identification of Human Toll-like Receptor 2 - Agonistic Activity in Dihydropyridine – Quinolone Carboxamides. ACS Med. Chem. Lett. 2019, 10, 132– 136, DOI: 10.1021/acsmedchemlett.8b00540[ACS Full Text], [CAS], Google Scholar97https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXisFKitLfE&md5=fdb3779fa549649651f4aa8026e7a13dIdentification of Human Toll-like Receptor 2-Agonistic Activity in Dihydropyridine-Quinolone CarboxamidesHu, Ziwei; Banothu, Janardhan; Beesu, Mallesh; Gustafson, Collin J.; Brush, Michael J. H.; Trautman, Kathryn L.; Salyer, Alex C. D.; Pathakumari, Balaji; David, Sunil A.ACS Medicinal Chemistry Letters (2019), 10 (1), 132-136CODEN: AMCLCT; ISSN:1948-5875. (American Chemical Society)Using a multiplexed, reporter gene-based, high-throughput screen, we identified 9-fluoro-7-hydroxy-3-methyl-5-oxo-N-(pyridin-3-ylmethyl)-2,3-dihydro-1H,5H-pyrido[3,2,1-ij]quinoline-6-carboxamide as a TLR2 agonist. Preliminary structure-activity relationship studies on the carboxamide moiety led to the identification of analogs that induce chemokines and cytokines in a TLR2-dependent manner. These results represent new leads for the development of vaccine adjuvants.
- 98Ribes, S.; Adam, N.; Ebert, S.; Regen, T.; Bunkowski, S.; Hanisch, U. K.; Nau, R. The Viral TLR3 Agonist Poly(I:C) Stimulates Phagocytosis and Intracellular Killing of Escherichia Coli by Microglial Cells. Neurosci. Lett. 2010, 482 (1), 17– 20, DOI: 10.1016/j.neulet.2010.06.078[Crossref], [PubMed], [CAS], Google Scholar98https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3cXhtVeht7rF&md5=a649e8cdd932760121555bbb99a9ba4bThe viral TLR3 agonist poly(I:C) stimulates phagocytosis and intracellular killing of Escherichia coli by microglial cellsRibes, Sandra; Adam, Nina; Ebert, Sandra; Regen, Tommy; Bunkowski, Stephanie; Hanisch, Uwe-Karsten; Nau, RolandNeuroscience Letters (2010), 482 (1), 17-20CODEN: NELED5; ISSN:0304-3940. (Elsevier Ireland Ltd.)A review. Stimulation of murine primary microglia with Toll-like receptor (TLR) agonists enhances their ability to phagocytose and kill bacteria. Here we show that the viral TLR3 agonist poly(I:C) stimulates the release of cyto-/chemokines and nitric oxide by microglia. Poly(I:C) increases microglial phagocytosis and intracellular killing of Escherichia coli K1, a pathogenic encapsulated bacterial strain, after 30 and 90 min of co-incubation. Stimulation with a viral epitope may strengthen the resistance of the brain to bacterial infections in vivo. Our data encourage animal expts. with poly(I:C) derivs. to assess whether this approach can increase the resistance of the CNS against bacterial infections.
- 99Molteni, M.; Gemma, S.; Rossetti, C. The Role of Toll-Like Receptor 4 in Infectious and Noninfectious Inflammation. Mediators Inflammation 2016, 2016, 6978936, DOI: 10.1155/2016/6978936[Crossref], [PubMed], [CAS], Google Scholar99https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC2s%252FpsFCktA%253D%253D&md5=2eb5be39fefa9201ffd703f2d3f112caThe Role of Toll-Like Receptor 4 in Infectious and Noninfectious InflammationMolteni Monica; Gemma Sabrina; Rossetti CarloMediators of inflammation (2016), 2016 (), 6978936 ISSN:.Toll-like receptor 4 (TLR4) belongs to the family of pattern recognition receptors (PRRs). They are highly conserved receptors that recognize conserved pathogen-associated molecular patterns (PAMPs), thus representing the first line of defense against infections. TLR4 has been long recognized as the sensing receptor for gram-negative lipopolysaccharide (LPS). In addition, it also binds endogenous molecules produced as a result of tissue injury. Hence, TLR4 represents a key receptor on which both infectious and noninfectious stimuli converge to induce a proinflammatory response. TLR4-mediated inflammation, triggered by exogenous or endogenous ligands, is also involved in several acute and chronic diseases, having a pivotal role as amplifier of the inflammatory response. This review focuses on the research progress about the role of TLR4 activation in infectious and noninfectious (e.g., sterile) inflammation and the effects of TLR4 signaling in some pathological conditions.
- 100Kumar, S.; Sunagar, R.; Gosselin, E. Bacterial Protein Toll-like-Receptor Agonists: A Novel Perspective on Vaccine Adjuvants. Front. Immunol. 2019, 10, 1144, DOI: 10.3389/fimmu.2019.01144[Crossref], [PubMed], [CAS], Google Scholar100https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhs1aiu7s%253D&md5=5951dbba0e55a7f0e40e1a4aac94b84aBacterial protein toll-like-receptor agonists: a novel perspective on vaccine adjuvantsKumar, Sudeep; Sunagar, Raju; Gosselin, EdmundFrontiers in Immunology (2019), 10 (), 1144CODEN: FIRMCW; ISSN:1664-3224. (Frontiers Media S.A.)Adjuvants have been used in vaccines for over a century, however, the search for safe and effective vaccine adjuvants continues. In recent decades toll-like-receptor (TLR) agonists have been investigated as potential vaccine adjuvants. In this regard, the majority of the currently investigated TLR agonists are non-protein microbial components such as lipopolysaccharides, oligonucleotides, and lipopeptides. On the other hand, a growing no. of studies reveal that TLR signaling and immune responses can be activated by numerous bacterial proteins. However, their potential roles as adjuvants have been somewhat overlooked. Herein, we discuss several such bacterial proteins which exhibit adjuvant properties, including the activation of TLR signaling, antigen presenting cell maturation, pro-inflammatory cytokine prodn. and adaptive immune response. The protein nature of these TLR agonists presents several unique features not shared by non-protein TLR agonists. These properties include the amenability for modifying the structure and function as necessary for optimal immunogenicity and minimal toxicity. Protein adjuvants can be genetically fused to protein antigens which ensure the co-delivery of adjuvant-antigen not only into the same cell but also in the same endocytic cargo, leading to more effective activation of innate and adaptive immune response.
- 101Needham, B. D.; Trent, M. S. Fortifying the Barrier: The Impact of Lipid A Remodelling on Bacterial Pathogenesis. Nat. Rev. Microbiol. 2013, 11, 467– 481, DOI: 10.1038/nrmicro3047[Crossref], [PubMed], [CAS], Google Scholar101https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXptValtrY%253D&md5=3e284d1c60e14246f886691001b5aba3Fortifying the barrier: the impact of lipid A remodelling on bacterial pathogenesisNeedham, Brittany D.; Trent, M. StephenNature Reviews Microbiology (2013), 11 (7), 467-481CODEN: NRMACK; ISSN:1740-1526. (Nature Publishing Group)A review. Gram-neg. bacteria decorate their outermost surface structure, lipopolysaccharide, with elaborate chem. moieties, which effectively disguises them from immune surveillance and protects them from the onslaught of host defences. Many of these changes occur on the lipid A moiety of lipopolysaccharide, a component that is crucial for host recognition of Gram-neg. infection. In this Review, we describe the regulatory mechanisms controlling lipid A modification and discuss the impact of modifications on pathogenesis, bacterial physiol. and bacterial interactions with the host immune system.
- 102Fensterheim, B. A.; Young, J. D.; Luan, L.; Kleinbard, R. R.; Stothers, C. L.; Patil, N. K.; Mcatee-pereira, A. G.; Guo, Y.; Trenary, I.; Hernandez, A.; Fults, J. B.; Williams, D. L.; Sherwood, E. R.; Bohannon, J. K. The TLR4 Agonist Monophosphoryl Lipid A Drives Broad Resistance to Infection via Dynamic Reprogramming of Macrophage Metabolism. J. Immunol. 2018, 200, 3777– 3789, DOI: 10.4049/jimmunol.1800085[Crossref], [PubMed], [CAS], Google Scholar102https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXpslOns7o%253D&md5=01f42d89e2f4e1f33d5228360d4572a1The TLR4 Agonist Monophosphoryl Lipid A Drives Broad Resistance to Infection via Dynamic Reprogramming of Macrophage MetabolismFensterheim, Benjamin A.; Young, Jamey D.; Luan, Liming; Kleinbard, Ruby R.; Stothers, Cody L.; Patil, Naeem K.; McAtee-Pereira, Allison G.; Guo, Yin; Trenary, Irina; Hernandez, Antonio; Fults, Jessica B.; Williams, David L.; Sherwood, Edward R.; Bohannon, Julia K.Journal of Immunology (2018), 200 (11), 3777-3789CODEN: JOIMA3; ISSN:0022-1767. (American Association of Immunologists)Monophosphoryl lipid A (MPLA) is a clin. used TLR4 agonist that has been found to drive nonspecific resistance to infection for up to 2 wk. However, the mol. mechanisms conferring protection are not well understood. In this study, we found that MPLA prompts resistance to infection, in part, by inducing a sustained and dynamic metabolic program in macrophages that supports improved pathogen clearance. Mice treated with MPLA had enhanced resistance to infection with Staphylococcus aureus and Candida albicans that was assocd. with augmented microbial clearance and organ protection. Tissue macrophages, which exhibited augmented phagocytosis and respiratory burst after MPLA treatment, were required for the beneficial effects of MPLA. Further anal. of the macrophage phenotype revealed that early TLR4-driven aerobic glycolysis was later coupled with mitochondrial biogenesis, enhanced malate shuttling, and increased mitochondrial ATP prodn. This metabolic program was initiated by overlapping and redundant contributions of MyD88- and TRIF-dependent signaling pathways as well as downstream mTOR activation. Blockade of mTOR signaling inhibited the development of the metabolic and functional macrophage phenotype and ablated MPLA-induced resistance to infection in vivo. Our findings reveal that MPLA drives macrophage metabolic reprogramming that evolves over a period of days to support a macrophage phenotype highly effective at mediating microbe clearance and that this results in nonspecific resistance to infection.
- 103Bowen, W. S.; Minns, L. A.; Johnson, D. A.; Mitchell, T. C.; Hutton, M. M.; Evans, J. T. Selective TRIF-Dependent Signaling by a Synthetic Toll-Like Receptor 4 Agonist. Sci. Signaling 2012, 5 (211), ra13, DOI: 10.1126/scisignal.2001963
- 104Garcia, M. M.; Goicoechea, C.; Molina-Álvarez, M.; Pascual, D. Toll-like Receptor 4: A Promising Crossroads in the Diagnosis and Treatment of Several Pathologies. Eur. J. Pharmacol. 2020, 874, 172975, DOI: 10.1016/j.ejphar.2020.172975[Crossref], [PubMed], [CAS], Google Scholar104https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXjtFCjsrs%253D&md5=12b7076a514fc843103578e1b9b0ce0dToll-like receptor 4: A promising crossroads in the diagnosis and treatment of several pathologiesGarcia, Miguel M.; Goicoechea, Carlos; Molina-Alvarez, Miguel; Pascual, DavidEuropean Journal of Pharmacology (2020), 874 (), 172975CODEN: EJPHAZ; ISSN:0014-2999. (Elsevier B.V.)Toll-like receptor 4 (TLR4) is expressed in a wide variety of cells and is the central component of the mammalian innate immune system. Precisely, the finding of conserved sequence homol. among species along with the mol. and functional characterization of the TLR4 gene enabled researchers to envisage a common operating system in the activation of innate immunity and the initiation of plastic changes at the onset of chronic pain. Malfunctioning in other conditions was conceived in parallel. In this respect, "pivot" proteins and pathway redundancy are not just evolutionary leftovers but essential for normal functioning or cell survival. Indeed, at present, TLR4 single nucleotide polymorphisms (SNP) and their assocn. with certain dysfunctions and diseases are being confirmed in different pools of patients. However, despite its ability to trigger pathogen infection or alternatively tissue injury communications to immune system, TLR4 targeting might not be considered a panacea. This review article represents a compilation of what we know about TLR4 from clinics and basic research on the 20th anniversary of its discovery. Understanding how to fine-tune the interaction between TLR4 and its specific ligands may lead in the next decades to the development of promising new treatments, reducing polypharmacy and probably having an impact on drug use in numerous pathologies.
- 105Yang, J.; Yan, H. TLR5: Beyond the Recognition of Flagellin. Cell. Mol. Immunol. 2017, 14, 1017– 1019, DOI: 10.1038/cmi.2017.122[Crossref], [PubMed], [CAS], Google Scholar105https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXhvFSmsrfL&md5=ef95bbd5b1f36740a4537aa9738940d6TLR5: beyond the recognition of flagellinYang, Jingyi; Yan, HuiminCellular & Molecular Immunology (2017), 14 (12), 1017-1019CODEN: CMIEAO; ISSN:1672-7681. (Nature Research)The innate immune system plays an essential role in the host defense against infections by initially sensing and recognizing diverse microbial pathogens and directing adaptive immune responses to their infections.
- 106Song, W. S.; Jeon, Y. J.; Namgung, B.; Hong, M.; Yoon, S. Il. A Conserved TLR5 Binding and Activation Hot Spot on Flagellin. Sci. Rep. 2017, 7, 40878, DOI: 10.1038/srep40878[Crossref], [PubMed], [CAS], Google Scholar106https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXhsFamsrk%253D&md5=3515af1f8c2672830128bd47592532a4A conserved TLR5 binding and activation hot spot on flagellinSong, Wan Seok; Jeon, Ye Ji; Namgung, Byeol; Hong, Minsun; Yoon, Sung-ilScientific Reports (2017), 7 (), 40878CODEN: SRCEC3; ISSN:2045-2322. (Nature Publishing Group)Flagellin is a bacterial protein that polymerizes into the flagellar filament and is essential for bacterial motility. When flagellated bacteria invade the host, flagellin is recognized by Toll-like receptor 5 (TLR5) as a pathogen invasion signal and eventually evokes the innate immune response. Here, we provide a conserved structural mechanism by which flagellins from Gram-neg. γ-proteobacteria and Gram-pos. Firmicutes bacteria bind and activate TLR5. The comparative structural anal. using our crystal structure of a complex between Bacillus subtilis flagellin (bsflagellin) and TLR5 at 2.1 Å resoln., combined with the alanine scanning anal. of the binding interface, reveals a common hot spot in flagellin for TLR5 activation. An arginine residue (bsflagellin R89) of the flagellin D1 domain and its adjacent residues (bsflagellin E114 and L93) constitute a hot spot that provides shape and chem. complementarity to a cavity generated by the loop of leucine-rich repeat 9 in TLR5. In addn. to the flagellin D1 domain, the D0 domain also contributes to TLR5 activity through structurally dispersed regions, but not a single focal area. These results establish the groundwork for the future design of flagellin-based therapeutics.
- 107Taylor, D. N.; Treanor, J. J.; Strout, C.; Johnson, C.; Fitzgerald, T.; Kavita, U.; Ozer, K.; Tussey, L.; Shaw, A. Induction of a Potent Immune Response in the Elderly Using the TLR-5 Agonist, Flagellin, with a Recombinant Hemagglutinin Influenza-Flagellin Fusion Vaccine (VAX125, STF2.HA1 SI). Vaccine 2011, 29 (31), 4897– 4902, DOI: 10.1016/j.vaccine.2011.05.001[Crossref], [PubMed], [CAS], Google Scholar107https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3MXotl2ltL8%253D&md5=cfde3d5ce936071e57480bd9c734fefcInduction of a potent immune response in the elderly using the TLR-5 agonist, flagellin, with a recombinant hemagglutinin influenza-flagellin fusion vaccine (VAX125, STF2.HA1 SI)Taylor, David N.; Treanor, John J.; Strout, Cynthia; Johnson, Casey; Fitzgerald, Theresa; Kavita, Uma; Ozer, Karen; Tussey, Lynda; Shaw, AlanVaccine (2011), 29 (31), 4897-4902CODEN: VACCDE; ISSN:0264-410X. (Elsevier Ltd.)Background: Influenza vaccines perform poorly in the elderly with reduced serol. response and vaccine efficacy. We evaluated a novel influenza vaccine consisting of the globular head of the HA1 domain of the A/Solomon Islands/3/2006 (H1N1) influenza virus (VAX125) genetically fused to the TLR5 ligand, flagellin, and produced in Escherichia coli. Methods: 120 subjects ≥65 years old were enrolled at three clin. centers. VAX125 vaccine was administered at doses of 0.5, 1, 2, 3, 5 or 8 μg delivered i.m. as a single dose vaccination on Day 0 using a dose-escalation with 20 subjects in each dose level. Subjects were followed for adverse events and sera were tested by hemagglutination-inhibition (HAI) against egg-grown virus on days 0, 7, 14, and 28. Serum C-reactive protein (CRP) and anti-flagellin antibody were also assessed. Results: The mean age was 71 years. The vaccine was well tolerated at all dose levels, with no more than mild to moderate local or systemic symptoms. The geometric mean titers (GMT) increased in all dose groups. In the 5 μg group the day 14 post-vaccination HAI titer was 1:226 showing a 12-fold increase over baseline. The 8 μg group showed a similar post-vaccination GMT increase (∼8-fold). In the combined 5 and 8 μg groups, the seroconversion rate was 75% and the seroprotection rate was 98%. Conclusions: A 5 μg dose of VAX125 was safe and able to induce a greater than 10-fold increase HAI antibody levels and nearly complete seroprotection in subjects over 65 years old. The use of flagellin to adjuvant influenza vaccines via the TLR5 innate immune pathway appears to be a useful approach to overcome poor immune responses in the elderly. VAX125 is a promising new candidate for prevention of influenza A disease in both young adults and the elderly.
- 108Yan, L.; Liang, J.; Yao, C.; Wu, P.; Zeng, X.; Cheng, K.; Yin, H. Pyrimidine Triazole Thioether Derivatives as Toll-Like Receptor 5 (TLR5)/Flagellin Complex Inhibitors. ChemMedChem 2016, 11 (8), 822– 826, DOI: 10.1002/cmdc.201500471[Crossref], [PubMed], [CAS], Google Scholar108https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXhvFGjtL3L&md5=28495e1bd35a0f5559977bccfc0655ddPyrimidine Triazole Thioether Derivatives as Toll-Like Receptor 5 (TLR5)/Flagellin Complex InhibitorsYan, Lei; Liang, Jiaqi; Yao, Chengbo; Wu, Peiyao; Zeng, Xianfeng; Cheng, Kui; Yin, HangChemMedChem (2016), 11 (8), 822-826CODEN: CHEMGX; ISSN:1860-7179. (Wiley-VCH Verlag GmbH & Co. KGaA)Protein-protein interactions have been regarded as "undruggable" despite their importance in many biol. processes. The complex formed between host toll-like receptor 5 (TLR5) and flagellin, a globular protein that is the main component of a bacterial flagellum, plays a vital role in a no. of pathogen defenses, immunol. diseases and cancers. Through high-throughput screening, we identified two hits with a common pharmacophore, which were used to successfully develop a series of small-mol. probes as novel inhibitors of flagellin binding to TLR5. In a multitude of assays, 4-((4-benzyl-5-(pyridin4yl)-4H-1,2,4-triazol-3-yl)thio)pyrido[3',2':4,5]thieno[3,2-d]pyrimidine (TH1020) was identified as a potent antagonist of TLR5 signaling with promising activity (IC50=0.85±0.12 μM) and specificity. Furthermore, TH1020 was shown to repress the expression of downstream TNF-α signaling pathways mediated by the TLR5/flagellin complex formation. Based on mol. docking simulation, TH1020 is suggested to compete with flagellin and disrupt its assocn. with TLR5. TH1020 provides a much-needed mol. probe for studying this important protein-protein interaction and a lead compd. for identifying novel therapeutics targeting TLR5.
- 109Kauppila, J. H.; Mattila, A. E.; Karttunen, T. J.; Salo, T. Toll-like Receptor 5 and the Emerging Role of Bacteria in Carcinogenesis. Oncoimmunology 2013, 2 (4), e23620, DOI: 10.4161/onci.23620
- 110Yazar, V.; Kilic, G.; Bulut, O.; Canavar Yildirim, T.; Yagci, F. C; Aykut, G.; Klinman, D. M; Gursel, M.; Gursel, I. A Suppressive Oligodeoxynucleotide Expressing TTAGGG Motifs Modulates Cellular Energetics through the MTOR Signaling Pathway. Int. Immunol. 2020, 32 (1), 39– 48, DOI: 10.1093/intimm/dxz059[Crossref], [PubMed], [CAS], Google Scholar110https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhslSktLvK&md5=24aaa3626028ed79bfe8ccdee53025ccA suppressive oligodeoxynucleotide expressing TTAGGG motifs modulates cellular energetics through the mTOR signaling pathwayYazar, Volkan; Kilic, Gizem; Bulut, Ozlem; Yildirim, Tugce Canavar; Yagci, Fuat C.; Aykut, Gamze; Klinman, Dennis M.; Gursel, Mayda; Gursel, IhsanInternational Immunology (2020), 32 (1), 39-48CODEN: INIMEN; ISSN:1460-2377. (Oxford University Press)Immune-mediated inflammation must be down-regulated to facilitate tissue remodeling during homeostatic restoration of an inflammatory response. Uncontrolled or over-exuberant immune activation can cause autoimmune diseases, as well as tissue destruction. A151, the archetypal example of a chem. synthesized suppressive oligodeoxynucleotide (ODN) based on repetitive telomere-derived TTAGGG sequences, was shown to successfully down-regulate a variety of immune responses. However, the degree, duration and breadth of A151-induced transcriptome alterations remain elusive. Here, we performed a comprehensive microarray anal. in combination with Ingenuity Pathway Anal. (IPA) using murine splenocytes to investigate the underlying mechanism of A151-dependent immune suppression. Our results revealed that A151 significantly down-regulates crit. mammalian target of rapamycin (mTOR) activators (Pi3kcd, Pdpk1 and Rheb), elements downstream of mTOR signaling (Rps6ka1, Myc, Stat3 and Slc2a1), an important component of the mTORC2 protein complex (Rictor) and Mtor itself. The effects of A151 on mTOR signaling were dose- and time-dependent. Moreover, flow cytometry and immunoblotting analyses demonstrated that A151 is able to reverse mTOR phosphorylation comparably to the well-known mTOR inhibitor rapamycin. Furthermore, Seahorse metabolic assays showed an A151 ODN-induced decrease in both oxygen consumption and glycolysis implying that a metabolically inert state in macrophages could be triggered by A151 treatment. Overall, our findings suggested novel insights into the mechanism by which the immune system is metabolically modulated by A151 ODN.
- 111Relitti, N.; Saraswati, A. P.; Federico, S.; Khan, T.; Brindisi, M.; Zisterer, D.; Brogi, S.; Gemma, S.; Butini, S.; Campiani, G. Telomerase-Based Cancer Therapeutics: A Review on Their Clinical Trials. Curr. Top. Med. Chem. 2020, 20 (6), 433– 457, DOI: 10.2174/1568026620666200102104930[Crossref], [PubMed], [CAS], Google Scholar111https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXosVektbg%253D&md5=a73a8e16434993551ca487423068db35Telomerase-based Cancer Therapeutics: A Review on their Clinical TrialsRelitti, Nicola; Saraswati, Akella P.; Federico, Stefano; Khan, Tuhina; Brindisi, Margherita; Zisterer, Daniela; Brogi, Simone; Gemma, Sandra; Butini, Stefania; Campiani, GiuseppeCurrent Topics in Medicinal Chemistry (Sharjah, United Arab Emirates) (2020), 20 (6), 433-457CODEN: CTMCCL; ISSN:1568-0266. (Bentham Science Publishers Ltd.)A review. Telomeres are protective chromosomal ends that shield the chromosomes from DNA damage, exonucleolytic degrdn., recombination, and end-to-end fusion. Telomerase is a ribonucleoprotein that adds TTAGGG tandem repeats to the telomeric ends. It has been obsd. that 85 to 90% of human tumors express high levels of telomerase, playing a crucial role in the development of cancers. Interestingly, the telomerase activity is generally absent in normal somatic cells. This selective telomerase expression has driven scientists to develop novel anti-cancer therapeutics with high specificity and potency. Several advancements have been made in this area, which is reflected by the enormous success of the anticancer agent Imetelstat. Since the discovery of Imetelstat, several research groups have contributed to enrich the therapeutic arsenal against cancer. Such contributions include the application of new classes of small mols., peptides, and hTERT-based immunotherapeutic agents (p540, GV1001, GRNVAC1 or combinations of these such as Vx-001). Many of these therapeutic tools are under different stages of clin. trials and have shown promising outcomes. In this review, we highlight the current status of telomerase-based cancer therapeutics and the outcome of these investigations.
- 112Saraswati, A. P.; Relitti, N.; Brindisi, M.; Gemma, S.; Zisterer, D.; Butini, S.; Campiani, G. Raising the Bar in Anticancer Therapy: Recent Advances in, and Perspectives on, Telomerase Inhibitors. Drug Discovery Today 2019, 24 (7), 1370– 1388, DOI: 10.1016/j.drudis.2019.05.015[Crossref], [PubMed], [CAS], Google Scholar112https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhtVOgu7%252FJ&md5=17a0dff2d5905cf91e7651d5edbbbc1eRaising the bar in anticancer therapy: recent advances in, and perspectives on, telomerase inhibitorsSaraswati, A. Prasanth; Relitti, Nicola; Brindisi, Margherita; Gemma, Sandra; Zisterer, Daniela; Butini, Stefania; Campiani, GiuseppeDrug Discovery Today (2019), 24 (7), 1370-1388CODEN: DDTOFS; ISSN:1359-6446. (Elsevier Ltd.)A review. Telomerase is a ribonucleic reverse transcriptase enzyme that uses an integral RNA component as a template to add tandem telomeric DNA repeats, TTAGGG, at the 3' end of the chromosomes. 85-90% of human tumors and their derived cell lines predominantly express high levels of telomerase, therefore contributing to cancer cell development. However, in normal cells, telomerase activity is almost always absent except in germ cells and stem cells. This differential expression has been exploited to develop highly specific and potent cancer therapeutics. In this review, it outline recent advances in the development of telomerase inhibitors as anticancer agents.
- 113Golenkina, E. A.; Viryasova, G. M.; Dolinnaya, N. G.; Bannikova, V. A.; Gaponova, T. V.; Romanova, Y. M.; Sud'ina, G. F. The Potential of Telomeric G-Quadruplexes Containing Modified Oligoguanosine Overhangs in Activation of Bacterial Phagocytosis and Leukotriene Synthesis in Human Neutrophils. Biomolecules 2020, 10, 249, DOI: 10.3390/biom10020249[Crossref], [CAS], Google Scholar113https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXktVyms70%253D&md5=254d654b9ed21b503feea01666799a69The potential of telomeric G-quadruplexes containing modified oligoguanosine overhangs in activation of bacterial phagocytosis and leukotriene synthesis in human neutrophilsGolenkina, Ekaterina A.; Viryasova, Galina M.; Dolinnaya, Nina G.; Bannikova, Valeria A.; Gaponova, Tatjana V.; Romanova, Yulia M.; Sud'ina, Galina F.Biomolecules (2020), 10 (2), 249CODEN: BIOMHC; ISSN:2218-273X. (MDPI AG)Using HPLC anal., flow cytometry, and other biochem. methods, we studied the effect of synthetic oligodeoxyribonucleotides (ODNs) able to fold into G-quadruplex structures on the main functions of neutrophils. Designed ODNs contained four human telomere TTAGGG repeats (G4) including those with phosphorothioate oligoguanosines attached to the end(s) of G-quadruplex core. Just modified analogs of G4 was shown to more actively than parent ODN penetrate into cells, improve phagocytosis of Salmonella typhimurium bacteria, affect 5-LOX activation, the cytosol calcium ion level, and the oxidative status of neutrophils. As evident from CD and UV spectroscopy data, the presence of oligoguanosines flanking G4 sequence leads to dramatic changes in G-quadruplex topol. While G4 folds into a single antiparallel structure, two main folded forms have been identified in solns. of modified ODNs: antiparallel and dominant, more stable parallel. Thus, both the secondary structure of ODNs and their ability to penetrate into the cytoplasm of cells are important for the activation of neutrophil cellular effects. Our results offer new clues for understanding the role of G-quadruplex ligands in regulation of integral cellular processes and for creating the antimicrobial agents of a new generation.
- 114Yeh, D.-W.; Lai, C.-Y.; Liu, Y.-L.; Lu, C.-H.; Tseng, P.-H.; Yuh, C.-H.; Yu, G.-Y.; Liu, S.-J.; Leng, C.-H.; Chuang, T.-H. CpG-Oligodeoxynucleotides Developed for Grouper Toll-like Receptor (TLR) 21s Effectively Activate Mouse and Human TLR9s Mediated Immune Responses. Sci. Rep. 2017, 7, 17297, DOI: 10.1038/s41598-017-17609-2[Crossref], [PubMed], [CAS], Google Scholar114https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC1MzgsVWnug%253D%253D&md5=baf8d3e7e70c9a031537dd188224d791CpG-oligodeoxynucleotides developed for grouper toll-like receptor (TLR) 21s effectively activate mouse and human TLR9s mediated immune responsesYeh Da-Wei; Lai Chao-Yang; Liu Yi-Ling; Lu Chih-Hao; Chuang Tsung-Hsien; Lu Chih-Hao; Tseng Ping-Hui; Yuh Chiou-Hwa; Yu Guann-Yi; Liu Shih-Jen; Leng Chih-Hsiang; Chuang Tsung-HsienScientific reports (2017), 7 (1), 17297 ISSN:.Synthetic phosphorothiolate-modified CpG-oligodeoxynucleotides (CpG-ODNs) are potent immune stimuli. Toll-like receptor (TLR) 9 and TLR21 are their cellular receptors in different species. The structural requirements for CpG-ODN to strongly activate TLR9 have been relatively well studied, but studies on TLR21 are in their infancy. Therefore, in this study, we investigated the interaction between CpG-ODNs and TLR21s from groupers (Epinephelus spp.), which are economically important fish species. We cloned the cDNA of giant grouper (E. lanceolatus) TLR21, and compared its sequence with orange-spotted grouper (E. coioides) TLR21A and TLR21B. These three receptors were activated by CpG-ODNs containing the GTCGTT motif but not by those containing the GACGTT motif. We developed two CpG-ODNs that contained 19 phosphorothiolated deoxynucleotides with one or two GTCGTT motifs. These CpG-ODNs had better activity on grouper TLR21s than currently developed CpG-ODNs, and produced similar immune stimulatory profiles when applied to cells isolated from orange-spotted grouper. The developed CpG-ODNs also effectively activated both human and mouse TLR9-mediated NF-κB activation and cytokine productions. These findings suggest that the GTCGTT motif is required for CpG-ODNs to activate grouper TLR21s, and that the CpG-ODNs that were developed for grouper TLR21s contain structures that effectively activate human and mouse TLR9s.
- 115Mohamed, W.; Domann, E.; Chakraborty, T.; Mannala, G.; Lips, K. S.; Heiss, C.; Schnettler, R.; Alt, V. TLR9Mediates S. Aureus Killing inside Osteoblasts via Induction of Oxidative Stress. BMC Microbiol. 2016, 16, 230, DOI: 10.1186/s12866-016-0855-8[Crossref], [PubMed], [CAS], Google Scholar115https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXlsFCi&md5=4a08d03b142012c742fb41a54e6542b2TLR9 mediates S. aureus killing inside osteoblasts via induction of oxidative stressMohamed, Walid; Domann, Eugen; Chakraborty, Trinad; Mannala, Gopala; Lips, Katrin S.; Heiss, Christian; Schnettler, Reinhard; Alt, VolkerBMC Microbiology (2016), 16 (), 230/1-230/8CODEN: BMMIBC; ISSN:1471-2180. (BioMed Central Ltd.)Background:Staphylococcus aureus is the principle causative pathogen of osteomyelitis and implant-assocd. bone infections. It is able to invade and to proliferate inside osteoblasts thus avoiding antibiotic therapy and the host immune system. Therefore, development of alternative approaches to stimulate host innate immune responses could be beneficial in prophylaxis against S. aureus infection. TLR9 is the intracellular receptor which recognizes unmethylated bacterial CpG-DNA and activates immune cells. Synthetic CpG-motifs contg. oligodeoxynucleotide (CpG-ODNs) mimics the stimulatory effect of bacterial DNA. Results: Osteoblast-like SAOS-2 cells were pretreated with CpG-ODN type-A 2216, type-B 2006, or neg. CpG-ODN 2243 (neg. control) 4 h before infection with S. aureus isolate EDCC 5055 (= DSM 28763). Intracellular bacteria were streaked on BHI plates 4 h and 20 h after infection. ODN2216 as well as ODN2006 but not ODN2243 were able to significantly inhibit the intracellular bacterial growth because about 31 % as well as 43 % of intracellular S. aureus could survive the pretreatment of SAOS-2 cells with ODN2216 or ODN2006 resp. 4 h and 20 h post-infection. RT-PCR anal. of cDNAs from SAOS-2 cells showed that pretreatment with ODN2216 or ODN2006 stimulated the expression of TLR9. Pretreatment of SAOS-2 cells with ODN2216 or ODN2006 but not ODN2243 managed to induce reactive oxygen species (ROS) prodn. inside osteoblasts as measured by flow cytometry anal. Moreover, treating SAOS-2 cells with the antioxidant Diphenyleneiodonium (DPI) obviously reduced S. aureus killing ability of TLR9 agonists mediated by oxidative stress. Conclusions: In this work we demonstrated for the first time that CPG-ODNs have inhibitory effects on S. aureus survival inside SAOS-2 osteoblast-like cell line. This effect was attributed to stimulation of TLR9 and subsequent induction of oxidative stress. Pretreatment of infected SAOS-2 cells with ROS inhibitors resulted in the abolishment of the CPG-ODNs killing effects.
- 116Kim, T. H.; Kim, D.; Lee, H.; Kwak, M. H.; Park, S.; Lee, Y.; Kwon, H. J. CpG-DNA Induces Bacteria-Reactive IgM Enhancing Phagocytic Activity against Staphylococcus Aureus Infection. BMB Rep. 2019, 52 (11), 635– 640, DOI: 10.5483/BMBRep.2019.52.11.018[Crossref], [PubMed], [CAS], Google Scholar116https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhsVCiur0%253D&md5=c86afb6a22dc1ca77abf7d2268475d80CpG-DNA induces bacteria-reactive IgM enhancing phagocytic activity against Staphylococcus aureus infectionKim, Te Ha; Kim, Dongbum; Lee, Heesu; Kwak, Min Hyung; Park, Sangkyu; Lee, Younghee; Kwon, Hyung-JooBMB Reports (2019), 52 (11), 635-640CODEN: BRMEC2; ISSN:1976-670X. (Korean Society for Biochemistry and Molecular Biology)CpG-DNA triggers the proliferation and differentiation of B cells which results in the increased prodn. of antibodies. The presence of bacteria-reactive IgM in normal serum was reported; however, the relevance of CpG-DNA with the prodn. of bacteria-reactive IgM has not been investigated. Here, we proved the function of CpG-DNA for the prodn. of bacteria-reactive IgM. CpG-DNA administration led to increased prodn. of bacteria-reactive IgM both in the peritoneal fluid and serum through TLR9 signaling pathway. When we stimulated B cells with CpG-DNA, prodn. of bacteria-reactive IgM was reproduced in vitro. We established a bacteria-reactive monoclonal IgM antibody using CpG-DNA stimulated-peritoneal B cells. The monoclonal IgM antibody enhanced the phagocytic activity of RAW 264.7 cells against S. aureus MW2 infection. Therefore, we suggest that CpG-DNA enhances the antibacterial activity of the immune system by triggering the prodn. of bacteria-reactive IgM. We also suggest the possible application of the antibodies for the treatment of antibiotics-resistant bacterial infections.
- 117Duggan, J. M.; You, D.; Cleaver, J. O.; Larson, D. T.; Garza, R. J.; Guzmán Pruneda, F. A.; Tuvim, M. J.; Zhang, J.; Dickey, B. F.; Evans, S. E. Synergistic Interactions of TLR2/6 and TLR9 Induce a High Level of Resistance to Lung Infection in Mice. J. Immunol. 2011, 186 (10), 5916– 5926, DOI: 10.4049/jimmunol.1002122[Crossref], [PubMed], [CAS], Google Scholar117https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3MXlsFGrs7c%253D&md5=01f350dfb8e265cd9cf4995fe5bfb3fcSynergistic Interactions of TLR2/6 and TLR9 Induce a High Level of Resistance to Lung Infection in MiceDuggan, Jeffrey M.; You, Dahui; Cleaver, Jeffrey O.; Larson, Derek T.; Garza, R. Joshua; Guzman Pruneda, Francisco A.; Tuvim, Michael J.; Zhang, Jiexin; Dickey, Burton F.; Evans, Scott E.Journal of Immunology (2011), 186 (10), 5916-5926CODEN: JOIMA3; ISSN:0022-1767. (American Association of Immunologists)Infectious pneumonias exact an unacceptable mortality burden worldwide. Efforts to protect populations from pneumonia have focused historically on antibiotic development and vaccine-enhanced adaptive immunity. However, we have reported recently that the lungs' innate defenses can be induced therapeutically by inhalation of a bacterial lysate that protects mice against otherwise lethal pneumonia. In this study, we tested in mice the hypothesis that TLRs are required for this antimicrobial phenomenon and found that resistance could not be induced in the absence of the TLR signaling adaptor protein MyD88. We then attempted to recapitulate the protection afforded by the bacterial lysate by stimulating the lung epithelium with aerosolized synthetic TLR ligands. Although most single or combination treatments yielded no protection, simultaneous treatment with ligands for TLR2/6 and TLR9 conferred robust, synergistic protection against virulent Gram-pos. and Gram-neg. pathogens. Protection was assocd. with rapid pathogen killing in the lungs, and pathogen killing could be induced from lung epithelial cells in isolation. Taken together, these data demonstrate the requirement for TLRs in inducible resistance against pneumonia, reveal a remarkable, unanticipated synergistic interaction of TLR2/6 and TLR9, reinforce the emerging evidence supporting the antimicrobial capacity of the lung epithelium, and may provide the basis for a novel clin. therapeutic that can protect patients against pneumonia during periods of peak vulnerability.
- 118Savva, A.; Roger, T. TargetingToll-like Receptors : Promising Therapeutic Strategies for the Management of Sepsis-Associated Pathology and Infectious Diseases. Front. Immunol. 2013, 4, 387, DOI: 10.3389/fimmu.2013.00387[Crossref], [PubMed], [CAS], Google Scholar118https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC2cflsVWqtQ%253D%253D&md5=eb36f62cd3e4f15c96fe1568384a7484Targeting toll-like receptors: promising therapeutic strategies for the management of sepsis-associated pathology and infectious diseasesSavva Athina; Roger ThierryFrontiers in immunology (2013), 4 (), 387 ISSN:1664-3224.Toll-like receptors (TLRs) are pattern recognition receptors playing a fundamental role in sensing microbial invasion and initiating innate and adaptive immune responses. TLRs are also triggered by danger signals released by injured or stressed cells during sepsis. Here we focus on studies developing TLR agonists and antagonists for the treatment of infectious diseases and sepsis. Positioned at the cell surface, TLR4 is essential for sensing lipopolysaccharide of Gram-negative bacteria, TLR2 is involved in the recognition of a large panel of microbial ligands, while TLR5 recognizes flagellin. Endosomal TLR3, TLR7, TLR8, TLR9 are specialized in the sensing of nucleic acids produced notably during viral infections. TLR4 and TLR2 are favorite targets for developing anti-sepsis drugs, and antagonistic compounds have shown efficient protection from septic shock in pre-clinical models. Results from clinical trials evaluating anti-TLR4 and anti-TLR2 approaches are presented, discussing the challenges of study design in sepsis and future exploitation of these agents in infectious diseases. We also report results from studies suggesting that the TLR5 agonist flagellin may protect from infections of the gastrointestinal tract and that agonists of endosomal TLRs are very promising for treating chronic viral infections. Altogether, TLR-targeted therapies have a strong potential for prevention and intervention in infectious diseases, notably sepsis.
- 119Kuzmich, N. N.; Sivak, K. V.; Chubarev, V. N.; Porozov, Y. B.; Savateeva-lyubimova, T. N.; Peri, F. TLR4 Signaling Pathway Modulators as Potential Therapeutics in Inflammation and Sepsis. Vaccines 2017, 5, 34, DOI: 10.3390/vaccines5040034[Crossref], [CAS], Google Scholar119https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXitlOqt7vI&md5=df54d2a888ef4afdd58307ae5edee984TLR4 signaling pathway modulators as potential therapeutics in inflammation and sepsisKuzmich, Nikolay N.; Sivak, Konstantin V.; Chubarev, Vladimir N.; Porozov, Yury B.; Savateeva-Lyubimova, Tatiana N.; Peri, FrancescoVaccines (Basel, Switzerland) (2017), 5 (4), 34/1-34/25CODEN: VBSABP; ISSN:2076-393X. (MDPI AG)Toll-Like Receptor 4 (TLR4) signal pathway plays an important role in initiating the innate immune response and its activation by bacterial endotoxin is responsible for chronic and acute inflammatory disorders that are becoming more and more frequent in developed countries. Modulation of the TLR4 pathway is a potential strategy to specifically target these pathologies. Among the diseases caused by TLR4 abnormal activation by bacterial endotoxin, sepsis is the most dangerous one because it is a life-threatening acute system inflammatory condition that still lacks specific pharmacol. treatment. Here, we review mols. at a preclin. or clin. phase of development, that are active in inhibiting the TLR4-MyD88 and TLR4-TRIF pathways in animal models. These are low-mol. wt. compds. of natural and synthetic origin that can be considered leads for drug development. The results of in vivo studies in the sepsis model and the mechanisms of action of drug leads are presented and critically discussed, evidencing the differences in treatment results from rodents to humans.
- 120Steinhagen, F.; Schmidt, S. V.; Schewe, J.; Peukert, K.; Klinman, D. M.; Bode, C. Immunotherapy in Sepsis - Brake or Accelerate?. Pharmacol. Ther. 2020, 208, 107476, DOI: 10.1016/j.pharmthera.2020.107476[Crossref], [PubMed], [CAS], Google Scholar120https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhtFCru7w%253D&md5=390ff4ee02c08cd10108b008ddf5267eImmunotherapy in sepsis - brake or accelerate?Steinhagen, Folkert; Schmidt, Susanne V.; Schewe, Jens-Christian; Peukert, Konrad; Klinman, Dennis M.; Bode, ChristianPharmacology & Therapeutics (2020), 208 (), 107476CODEN: PHTHDT; ISSN:0163-7258. (Elsevier)A review. Sepsis, a life threating syndrome characterized by organ failure after infection, is the most common cause of death in hospitalized patients. The treatment of sepsis is generally supportive in nature, involving the administration of i.v. fluids, vasoactive substances and oxygen plus antibiotics to eliminate the pathogen. No drugs have been approved specifically for the treatment of sepsis, and clin. trials of potential therapies have failed to reduce mortality - suggesting that new approaches are needed. Abnormalities in the immune response elicited by the pathogen, ranging from excessive inflammation to immunosuppression, contribute to disease pathogenesis. Although hundreds of immunomodulatory agents are potentially available, it remains unclear which patient benefits from which immune therapy at a given time point. Results indicate the importance of personalized therapy, specifically the need to identify the type of intervention required by each individual patient at a given point in the disease process. To address this issue will require using biomarkers to stratify patients based on their individual immune status. This article reviews recent and ongoing clin. investigations using immunostimulatory or immunosuppressive therapies against sepsis including non-pharmacol. and novel preclin. approaches.
- 121Chavez, S. A.; Martinko, A. J.; Lau, C.; Pham, M. N.; Cheng, K.; Bevan, D. E.; Mollnes, T. E.; Yin, H. Development of β -Amino Alcohol Derivatives That Inhibit Toll-like Receptor 4 Mediated Inflammatory Response as Potential Antiseptics. J. Med. Chem. 2011, 54, 4659– 4669, DOI: 10.1021/jm2003365[ACS Full Text], [CAS], Google Scholar121https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3MXmvFOjtLo%253D&md5=1b068f29d0001e28ba30af500af04cc9Development of β-Amino Alcohol Derivatives That Inhibit Toll-like Receptor 4 Mediated Inflammatory Response as Potential AntisepticsChavez, Sherry A.; Martinko, Alexander J.; Lau, Corinna; Pham, Michael N.; Cheng, Kui; Bevan, Douglas E.; Mollnes, Tom E.; Yin, HangJournal of Medicinal Chemistry (2011), 54 (13), 4659-4669CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)Toll-like receptor 4 (TLR4) induced proinflammatory signaling has been directly implicated in severe sepsis and represents an attractive therapeutic target. Herein, we report our investigations into the structure-activity relationship and preliminary drug metab./pharmacokinetics study of β-amino alc. derivs. that inhibit the TLR4 signaling pathway. Lead compds. were identified from in vitro cellular examn. with micromolar potency for their inhibitory effects on TLR4 signaling and subsequently assessed for their ability to suppress the TLR4-induced inflammatory response in an ex vivo whole blood model. In addn., the toxicol., specificity, soly., brain-blood barrier permeability, and drug metab. of several compds. were evaluated. Although further optimizations are needed, our findings lay the groundwork for the future drug development of this class of small mol. agents for the treatment of severe sepsis.
- 122Cighetti, R.; Ciaramelli, C.; Sestito, E.; Zanoni, I.; Kubik, Ł.; Arda-Freire, A.; Calabrese, V.; Granucci, F.; Jerala, R.; Martín-Santamaría, S.; Jimenez-Barbero, J.; Peri, F. Modulation of CD14 and TLR4 · MD-2 Activities by a Synthetic Lipid A Mimetic. ChemBioChem 2014, 15, 250– 258, DOI: 10.1002/cbic.201300588[Crossref], [PubMed], [CAS], Google Scholar122https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXhvFWrtb%252FE&md5=151e5741457211ca7d67e6d1843935b2Modulation of CD14 and TLR4·MD-2 Activities by a Synthetic Lipid A MimeticCighetti, Roberto; Ciaramelli, Carlotta; Sestito, Stefania Enza; Zanoni, Ivan; Kubik, Lukasz; Arda-Freire, Ana; Calabrese, Valentina; Granucci, Francesca; Jerala, Roman; Martin-Santamaria, Sonsoles; Jimenez-Barbero, Jesus; Peri, FrancescoChemBioChem (2014), 15 (2), 250-258CODEN: CBCHFX; ISSN:1439-4227. (Wiley-VCH Verlag GmbH & Co. KGaA)Monosaccharide lipid A mimetics based on a glucosamine core linked to two fatty acid chains and bearing one or two phosphate groups have been synthesized. Compds. 1 and 2, each with one phosphate group, were practically inactive in inhibiting LPS-induced TLR4 signaling and cytokine prodn. in HEK-blue cells and murine macrophages, but compd. 3, with two phosphate groups, was found to be active in efficiently inhibiting TLR4 signal in both cell types. The direct interaction between compd. 3 and the MD-2 coreceptor was investigated by NMR spectroscopy and mol. modeling/docking anal. This compd. also interacts directly with the CD14 receptor, stimulating its internalization by endocytosis. Expts. on macrophages show that the effect on CD14 reinforces the activity on MD-2·TLR4 because compd. 3's activity is higher when CD14 is important for TLR4 signaling (i.e., at low LPS concn.). The dual targeting of MD-2 and CD14, accompanied by good soly. in water and lack of toxicity, suggests the use of monosaccharide 3 as a lead compd. for the development of drugs directed against TLR4related syndromes.
- 123Zaffaroni, L.; Peri, F. Recent Advances on Toll-like Receptor 4 Modulation: New Therapeutic Perspectives. Future Med. Chem. 2018, 10 (4), 461– 476, DOI: 10.4155/fmc-2017-0172[Crossref], [PubMed], [CAS], Google Scholar123https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXivFCntbg%253D&md5=cae56465df8e23632a549bdaaae1343bRecent advances on Toll-like receptor 4 modulation: new therapeutic perspectivesZaffaroni, Lenny; Peri, FrancescoFuture Medicinal Chemistry (2018), 10 (4), 461-476CODEN: FMCUA7; ISSN:1756-8919. (Future Science Ltd.)Activation or inhibition of TLR4 by small mols. will provide in the next few years a new generation of therapeutics. TLR4 stimulation (agonism) by high-affinity ligands mimicking lipid A gave vaccine adjuvants with improved specificity and efficacy that have been licensed and entered into the market. TLR4 inhibition (antagonism) prevents cytokine prodn. at a very early stage; this is in principle a more efficient method to block inflammatory diseases compared to cytokines neutralization by antibodies. Advances in TLR4 modulation by drug-like small mols. achieved in the last years are reviewed. Recently discovered TLR4 agonists and antagonists of natural and synthetic origin are presented, and their mechanism of action and structure-activity relationship are discussed.
- 124Liang, Q.; Wu, Q.; Jiang, J.; Duan, J.; Wang, C.; Smith, M. D.; Lu, H.; Wang, Q.; Nagarkatti, P.; Fan, D. Characterization of Sparstolonin B, a Chinese Herb-Derived Compound, as a Selective Toll-like Receptor Antagonist with Potent Anti-Inflammatory Properties. J. Biol. Chem. 2011, 286 (30), 26470– 26479, DOI: 10.1074/jbc.M111.227934[Crossref], [PubMed], [CAS], Google Scholar124https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3MXpt1Kktbo%253D&md5=acd3a0d119e9dbf2aa7ea83072e838dbCharacterization of Sparstolonin B, a Chinese Herb-derived Compound, as a Selective Toll-like Receptor Antagonist with Potent Anti-inflammatory PropertiesLiang, Qiao-Li; Wu, Qi-Nan; Jiang, Ji-Hong; Duan, Jin-Ao; Wang, Chao; Smith, Mark D.; Lu, Hong; Wang, Qian; Nagarkatti, Prakash; Fan, Da-PingJournal of Biological Chemistry (2011), 286 (30), 26470-26479, S26470/1-S26470/8CODEN: JBCHA3; ISSN:0021-9258. (American Society for Biochemistry and Molecular Biology)Blockade of excessive Toll-like receptor (TLR) signaling is a therapeutic approach being actively pursued for many inflammatory diseases. Here we report a Chinese herb-derived compd., sparstolonin B (SsnB), which selectively blocks TLR2- and TLR4-mediated inflammatory signaling. SsnB was isolated from a Chinese herb, Sparganium stoloniferum; its structure was detd. by NMR spectroscopy and x-ray crystallog. SsnB effectively inhibited inflammatory cytokine expression in mouse macrophages induced by lipopolysaccharide (LPS, a TLR4 ligand), Pam3CSK4 (a TLR1/TLR2 ligand), and Fsl-1 (a TLR2/TLR6 ligand) but not that by poly(I:C) (a TLR3 ligand) or ODN1668 (a TLR9 ligand). It suppressed LPS-induced cytokine secretion from macrophages and diminished phosphorylation of Erk1/2, p38a, IκBα, and JNK in these cells. In THP-1 cells expressing a chimeric receptor CD4-TLR4, which triggers constitutive NF-κB activation, SsnB effectively blunted the NF-κB activity. Co-immunopptn. showed that SsnB reduced the assocn. of MyD88 with TLR4 and TLR2, but not that with TLR9, in HEK293T cells and THP-1 cells overexpressing MyD88 and TLRs. Furthermore, administration of SsnB suppressed splenocyte inflammatory cytokine expression in mice challenged with LPS. These results demonstrate that SsnB acts as a selective TLR2 and TLR4 antagonist by blocking the early intracellular events in the TLR2 and TLR4 signaling. Thus, SssB may serve as a promising lead for the development of selective TLR antagonistic agents for inflammatory diseases.
- 125Pollock, J. A.; Sharma, N.; Ippagunta, S. K.; Redecke, V.; Häcker, H.; Katzenellenbogen, J. A. Triaryl Pyrazole Toll-Like Receptor Signaling Inhibitors: Structure–Activity Relationships Governing Pan- and Selective Signaling Inhibitors. ChemMedChem 2018, 13 (20), 2208– 2216, DOI: 10.1002/cmdc.201800417[Crossref], [PubMed], [CAS], Google Scholar125https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhslSrsLrN&md5=a23002828b400218d1de99c494ff02f0Triaryl Pyrazole Toll-Like Receptor Signaling Inhibitors: Structure-Activity Relationships Governing Pan- and Selective Signaling InhibitorsPollock, Julie A.; Sharma, Naina; Ippagunta, Sirish K.; Redecke, Vanessa; Haecker, Hans; Katzenellenbogen, John A.ChemMedChem (2018), 13 (20), 2208-2216CODEN: CHEMGX; ISSN:1860-7179. (Wiley-VCH Verlag GmbH & Co. KGaA)The immune system uses members of the toll-like receptor (TLR) family to recognize a variety of pathogen- and host-derived mols. in order to initiate immune responses. Although TLR-mediated, pro-inflammatory immune responses are essential for host defense, prolonged and exaggerated activation can result in inflammation pathol. that manifests in a variety of diseases. Therefore, small-mol. inhibitors of the TLR signaling pathway might have promise as anti-inflammatory drugs. We previously identified a class of triaryl pyrazole compds. that inhibit TLR signaling by modulation of the protein-protein interactions essential to the pathway. We have now systematically examd. the structural features essential for inhibition of this pathway, revealing characteristics of compds. that inhibited all TLRs tested (pan-TLR signaling inhibitors) as well as compds. that selectively inhibited certain TLRs. These findings reveal interesting classes of compds. that could be optimized for particular inflammatory diseases governed by different TLRs.
- 126Paul, B.; Rahaman, O.; Roy, S.; Pal, S.; Satish, S.; Mukherjee, A.; Ghosh, A. R.; Raychaudhuri, D.; Bhattacharya, R.; Goon, S.; Ganguly, D.; Talukdar, A. Activity-Guided Development of Potent and Selective Toll-like Receptor 9 Antagonists. Eur. J. Med. Chem. 2018, 159, 187– 205, DOI: 10.1016/j.ejmech.2018.09.058[Crossref], [PubMed], [CAS], Google Scholar126https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhvVKntbbL&md5=2b30577538a603af0204de5edaf3f6cbActivity-guided development of potent and selective toll-like receptor 9 antagonistsPaul, Barnali; Rahaman, Oindrila; Roy, Swarnali; Pal, Sourav; Satish, Sohal; Mukherjee, Ayan; Ghosh, Amrit R.; Raychaudhuri, Deblina; Bhattacharya, Roopkatha; Goon, Sunny; Ganguly, Dipyaman; Talukdar, ArindamEuropean Journal of Medicinal Chemistry (2018), 159 (), 187-205CODEN: EJMCA5; ISSN:0223-5234. (Elsevier Masson SAS)TLR9 is one of the major innate immune receptors expressed in the endosomes of pDCs and B cells in humans. Aberrant TLR9 activation is implicated in several autoimmune and metabolic disorders as well as in sepsis, making this receptor an important therapeutic target, though specific TLR9 antagonists are yet to be available for clin. use. Here we elucidate the importance of specific physiochem. properties through substitution patterns in quinazoline scaffold to achieve potent hTLR9 inhibition at < 50 nM as well as > 600 fold selectivity against hTLR7, another closely related TLR that shares downstream signaling with TLR9 but plays distinct roles in physiol. and pathol. Assays were performed using hPBMC and reporter cell lines. Favorable in vitro ADME profile, pharmacokinetics as well as validation in a clin. relevant in vivo TLR9-inhibition efficacy model in mice establish these novel TLR9-antagonists as candidate therapeutic agents in relevant clin. contexts.
- 127D’Alessandro, S.; Alfano, G.; Di Cerbo, L.; Brogi, S.; Chemi, G.; Relitti, N.; Brindisi, M.; Lamponi, S.; Novellino, E.; Campiani, G.; Gemma, S.; Basilico, N.; Taramelli, D.; Baratto, M. C.; Pogni, R.; Butini, S. Bridged Bicyclic 2,3-Dioxabicyclo[3.3.1]Nonanes as Antiplasmodial Agents: Synthesis, Structure-Activity Relationships and Studies on Their Biomimetic Reaction with Fe(II). Bioorg. Chem. 2019, 89, 103020, DOI: 10.1016/j.bioorg.2019.103020[Crossref], [PubMed], [CAS], Google Scholar127https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhtFClt7%252FO&md5=9f454170238b307d4fd0c31a34701b0bBridged bicyclic 2,3-dioxabicyclo[3.3.1]nonanes as antiplasmodial agents: Synthesis, structure-activity relationships and studies on their biomimetic reaction with Fe(II)D'Alessandro, Sarah; Alfano, Gloria; Di Cerbo, Luisa; Brogi, Simone; Chemi, Giulia; Relitti, Nicola; Brindisi, Margherita; Lamponi, Stefania; Novellino, Ettore; Campiani, Giuseppe; Gemma, Sandra; Basilico, Nicoletta; Taramelli, Donatella; Baratto, Maria Camilla; Pogni, Rebecca; Butini, StefaniaBioorganic Chemistry (2019), 89 (), 103020CODEN: BOCMBM; ISSN:0045-2068. (Elsevier B.V.)Despite recent advancements in its control, malaria is still a deadly parasitic disease killing millions of people each year. Progresses in combating the infection have been made by using the so-called artemisinin combination therapies (ACTs). Natural and synthetic peroxides are an important class of antimalarials. Here we describe a new series of peroxides synthesized through a new elaboration of the scaffold of bicyclic-fused/bridged synthetic endoperoxides previously developed by us. These peroxides are produced by a straightforward synthetic protocol and are characterized by submicromolar potency when tested against both chloroquine-sensitive and chloroquine-resistant Plasmodium falciparum strains. To investigate their mode of action, the biomimetic reaction of the representative compd. I with Fe(II) was studied by EPR and the reaction products were characterized by NMR. Rationalization of the obsd. structure-activity relationship studies was performed by mol. docking. Taken together, our data robustly support the hypothesized mode of activation of peroxides and led to the definition of the key structural requirements responsible for the antiplasmodial potency. These data will pave the way in future to the rational design of novel optimized antimalarials suitable for in vivo investigation.
- 128Kalantari, P. The Emerging Role of Pattern Recognition Receptors in the Pathogenesis of Malaria. Vaccines 2018, 6, 13, DOI: 10.3390/vaccines6010013[Crossref], [CAS], Google Scholar128https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhtVGntrnL&md5=c9af2a81c30383275239227b22193237The emerging role of pattern recognition receptors in the pathogenesis of malariaKalantari, ParisaVaccines (Basel, Switzerland) (2018), 6 (1), 13/1-13/15CODEN: VBSABP; ISSN:2076-393X. (MDPI AG)Despite a global effort to develop an effective vaccine, malaria is still a significant health problem. Much of the pathol. of malaria is immune mediated. This suggests that host immune responses have to be finely regulated. The innate immune system initiates and sets the threshold of the acquired immune response and dets. the outcome of the disease. Yet, our knowledge of the regulation of innate immune responses during malaria is limited. Theor., inadequate activation of the innate immune system could result in unrestrained parasite growth. Conversely, hyperactivation of the innate immune system, is likely to cause excessive prodn. of proinflammatory cytokines and severe pathol. Toll-like receptors (TLRs) have emerged as essential receptors which detect signature mols. and shape the complex host response during malaria infection. This review will highlight the mechanisms by which Plasmodium components are recognized by innate immune receptors with particular emphasis on TLRs. A thorough understanding of the complex roles of TLRs in malaria may allow the delineation of pathol. vs. protective host responses and enhance the efficacy of anti-malarial treatments and vaccines.
- 129Eriksson, E. M.; Sampaio, N. G.; Schofield, L. Toll-Like Receptors and Malaria – Sensing and Susceptibility. J. Trop. Dis. 2014, 2 (1), 1– 7, DOI: 10.4172/2329-891X.1000126
- 130Ernest, M.; Hunja, C.; Arakura, Y.; Haraga, Y.; Abkallo, H. M.; Zeng, W.; Jackson, D. C.; Chua, B.; Culleton, R. The Toll-Like Receptor 2 Agonist PEG-Pam2Cys as an Immunochemoprophylactic and Immunochemotherapeutic against the Liver and Transmission Stages of Malaria Parasites. Int. J. Parasitol.: Drugs Drug Resist. 2018, 8 (3), 451– 458, DOI: 10.1016/j.ijpddr.2018.10.006[Crossref], [PubMed], [CAS], Google Scholar130https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB3cvmsl2htQ%253D%253D&md5=2dd8e3c53c65e77ab3108549f3da718eThe Toll-Like Receptor 2 agonist PEG-Pam2Cys as an immunochemoprophylactic and immunochemotherapeutic against the liver and transmission stages of malaria parasitesErnest Medard; Hunja Carol; Arakura Yuka; Haraga Yohei; Abkallo Hussein M; Zeng Weiguang; Jackson David C; Chua Brendon; Culleton RichardInternational journal for parasitology. Drugs and drug resistance (2018), 8 (3), 451-458 ISSN:.Both vaccine and therapeutic approaches to malaria are based on conventional paradigms; whole organism or single antigen epitope-based vaccines administered with or without an adjuvant, and chemotherapeutics (anti-malaria drugs) that are toxic to the parasite. Two major problems that limit the effectiveness of these approaches are i) high levels of antigenic variation within parasite populations rendering vaccination efficacy against all variants difficult, and ii) the capacity of the parasite to quickly evolve resistance to drugs. We describe a new approach to both protection from and treatment of malaria parasites that involves the direct stimulation of the host innate immune response through the administration of a Toll-Like Receptor-2 (TLR2) agonist. The activity of PEG-Pam2Cys against the hepatocytic stages, erythrocytic stages and gametocytes of the rodent malaria parasite Plasmodium yoelii was investigated in laboratory mice. We show that administration of PEG-Pam2Cys, a soluble form of the TLR2 agonist S-[2,3-bis(palmitoyloxy)propyl] cysteine (Pam2Cys), significantly and dramatically reduces the numbers of malaria parasites that grow in the livers of mice following subsequent challenge with sporozoites. We also show that treatment can also clear parasites from the liver when administered subsequent to the establishment of infection. Finally, PEG-Pam2Cys can reduce the numbers of mosquitoes that are infected, and the intensity of their infection, following blood feeding on gametocytaemic mice. These results suggest that this compound could represent a novel liver stage anti-malarial that can be used both for the clearance of parasites following exposure and for the prevention of the establishment of infection.
- 131Kaur, A.; Kannan, D.; Mehta, S. K.; Singh, S.; Salunke, D. B. Synthetic Toll-like Receptor Agonists for the Development of Powerful Malaria Vaccines: A Patent Review. Expert Opin. Ther. Pat. 2018, 28 (11), 837– 847, DOI: 10.1080/13543776.2018.1530217[Crossref], [PubMed], [CAS], Google Scholar131https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhvFynt7nJ&md5=2ac288641c57ef14eae1d635e0f763fcSynthetic Toll-like receptor agonists for the development of powerful malaria vaccines: a patent reviewKaur, Arshpreet; Kannan, Deepika; Mehta, Surinder K.; Singh, Shailja; Salunke, Deepak B.Expert Opinion on Therapeutic Patents (2018), 28 (11), 837-847CODEN: EOTPEG; ISSN:1354-3776. (Taylor & Francis Ltd.)A review. Introduction: Currently, there is no efficient vaccine available against clin. malaria. However, continuous efforts have been committed to develop powerful antimalarial vaccine by discovery of novel antigens with in-depth understanding of its nature, immunogenicity, and presentation (delivery adjuvants). Moreover, another important part of vaccine development includes discovery of better immunostimulatory formulation components (immunostimulants). A protective vaccine against malaria requires antigen-specific B and T helper cell responses as well as cytotoxic T lymphocyte (CTL) responses. A long-lasting B and T memory cell prodn. is also required for effective malaria vaccine. Since activation of Toll-like receptors (TLRs) promotes both innate inflammatory responses as well as the induction of adaptive immunity, several initiatives have been mounted during the last few years for the use of TLR agonists as malaria vaccine adjuvants. Areas covered: The review summarizes reports related to the use and development of TLR agonists as malaria vaccine adjuvants and describes various strategies involved for the selection of specific antigens and TLR agonists. Expert opinion: TLR agonists are promising adjuvants for the development of effective malaria vaccine, allowing for both innate inflammatory responses as well as the induction of adaptive immunity.
- 132Coban, C.; Horii, T.; Akira, S.; Ishii, K. J. TLR9 and Endogenous Adjuvants of the Whole Blood-Stage Malaria Vaccine. Expert Rev. Vaccines 2010, 9 (7), 775– 784, DOI: 10.1586/erv.10.60[Crossref], [PubMed], [CAS], Google Scholar132https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3cXoslyltrs%253D&md5=c2ac8cde110358a1eeef6055c4d111e4TLR9 and endogenous adjuvants of the whole blood-stage malaria vaccineCoban, Cevayir; Horii, Toshihiro; Akira, Shizuo; Ishii, Ken J.Expert Review of Vaccines (2010), 9 (7), 775-784CODEN: ERVXAX; ISSN:1476-0584. (Expert Reviews Ltd.)A review. Vaccination has been a successful tool in the protection against many infectious diseases, and recent advances in biotechnol. have created new techniques and strategies to produce safe and efficacious vaccines for human use. However, developing a protective vaccine against malaria has been a challenge. In this article, we focus on an old approach with some new modifications, the so-called whole-parasite vaccination strategy against blood-stage Plasmodium falciparum, the deadliest human malarial agent. In addn., we discuss recent developments in our understanding of how the endogenous adjuvant activity in the parasites, which functions via Toll-like receptor 9, acts as a double-edged sword between protective vaccination and pathol. responses against malaria infection.
- 133Battista, T.; Colotti, G.; Ilari, A.; Fiorillo, A. Targeting Trypanothione Reductase, a Key Enzyme in the Redox Trypanosomatid Metabolism, to Develop New Drugs against Leishmaniasis and Trypanosomiases. Molecules 2020, 25 (8), 1924, DOI: 10.3390/molecules25081924[Crossref], [CAS], Google Scholar133https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhtVekur7M&md5=d19e3b7e88240c74ea2d9670ca357ec3Targeting trypanothione reductase, a key enzyme in the redox trypanosomatid metabolism, to develop new drugs against leishmaniasis and trypanosomiasesBattista, Theo; Colotti, Gianni; Ilari, Andrea; Fiorillo, AnnaritaMolecules (2020), 25 (8), 1924CODEN: MOLEFW; ISSN:1420-3049. (MDPI AG)A review. The protozoans Leishmania and Trypanosoma, belonging to the same Trypanosomatidae family, are the causative agents of Leishmaniasis, Chagas disease, and human African trypanosomiasis. Overall, these infections affect millions of people worldwide, posing a serious health issue as well as socio-economical concern. Current treatments are inadequate, mainly due to poor efficacy, toxicity, and emerging resistance; therefore, there is an urgent need for new drugs. Among several mol. targets proposed, trypanothione reductase (TR) is of particular interest for its crit. role in controlling the parasite's redox homeostasis and several classes of active compds. that inhibit TR have been proposed so far. This review provides a comprehensive overview of TR's structural characterization. In particular, we discuss all the structural features of TR relevant for drug discovery, with a focus on the recent advances made in the understanding of inhibitor binding. The reported cases show how, on the basis of the detailed structural information provided by the crystallog. anal., it is possible to rationally modify mol. scaffolds to improve their properties.
- 134Gemma, S.; Federico, S.; Brogi, S.; Brindisi, M.; Butini, S.; Campiani, G. Dealing with Schistosomiasis: Current Drug Discovery Strategies. Annu. Rep. Med. Chem. 2019, 53, 107– 138, DOI: 10.1016/bs.armc.2019.06.002
- 135Fouzder, C.; Mukhuty, A.; Das, S.; Chattopadhyay, D. TLR Signaling on Protozoan and Helminthic Parasite Infection. IntechOpen 2020, 1– 20, DOI: 10.5772/intechopen.84711
- 136Mukherjee, S.; Karmakar, S.; Babu, S. P. S. TLR2 and TLR4Mediated Host Immune Responses in Major Infectious Diseases: A Review. Braz. J. Infect. Dis. 2016, 20 (2), 193– 204, DOI: 10.1016/j.bjid.2015.10.011[Crossref], [PubMed], [CAS], Google Scholar136https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC28nhtV2hsQ%253D%253D&md5=74f6b80f6746c8cb52fecd019d913ae1TLR2 and TLR4 mediated host immune responses in major infectious diseases: a reviewMukherjee Suprabhat; Karmakar Subhajit; Babu Santi Prasad SinhaThe Brazilian journal of infectious diseases : an official publication of the Brazilian Society of Infectious Diseases (2016), 20 (2), 193-204 ISSN:.During the course of evolution, multicellular organisms have been orchestrated with an efficient and versatile immune system to counteract diverse group of pathogenic organisms. Pathogen recognition is considered as the most critical step behind eliciting adequate immune response during an infection. Hitherto Toll-like receptors (TLRs), especially the surface ones viz. TLR2 and TLR4 have gained immense importance due to their extreme ability of identifying distinct molecular patterns from invading pathogens. These pattern recognition receptors (PRRs) not only act as innate sensor but also shape and bridge innate and adaptive immune responses. In addition, they also play a pivotal role in regulating the balance between Th1 and Th2 type of response essential for the survivability of the host. In this work, major achievements rather findings made on the typical signalling and immunopathological attributes of TLR2 and TLR4 mediated host response against the major infectious diseases have been reviewed. Infectious diseases like tuberculosis, trypanosomiasis, malaria, and filariasis are still posing myriad threat to mankind. Furthermore, increasing resistance of the causative organisms against available therapeutics is also an emerging problem. Thus, stimulation of host immune response with TLR2 and TLR4 agonist can be the option of choice to treat such diseases in future.
- 137Wang, X.; Dong, L.; Ni, H.; Zhou, S.; Xu, Z.; Hoellwarth, J. S.; Chen, X.; Zhang, R.; Chen, Q.; Liu, F.; Wang, J.; Su, C. Combined TLR7/8 and TLR9 Ligands Potentiate the Activity of a Schistosoma Japonicum DNA Vaccine. PLoS Neglected Trop. Dis. 2013, 7 (4), e2164, DOI: 10.1371/journal.pntd.0002164[Crossref], [PubMed], [CAS], Google Scholar137https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXnsFaiurY%253D&md5=b91b5ddfb837cd25266fd81823dfa0b8Combined TLR7/8 and TLR9 ligands potentiate the activity of a Schistosoma japonicum DNA vaccineWang, Xuefeng; Dong, Liyang; Ni, Hongchang; Zhou, Sha; Xu, Zhipeng; Hoellwarth, Jason Shih; Chen, Xiaojun; Zhang, Rongbo; Chen, Qiaoyun; Liu, Feng; Wang, Jun; Su, ChuanPLoS Neglected Tropical Diseases (2013), 7 (4), e2164CODEN: PNTDAM; ISSN:1935-2735. (Public Library of Science)Background: Toll-like receptor (TLR) ligands have been explored as vaccine adjuvants for tumor and virus immunotherapy, but few TLR ligands affecting schistosoma vaccines have been characterized. Previously, the authors developed a partially protective DNA vaccine encoding the 26-kDa glutathione S-transferase of Schistosoma japonicum (pVAX1-Sj26GST). Methodol./Principal Findings: In this study, the authors evaluated a TLR7/8 ligand (R848) and a TLR9 ligand (CpG oligodeoxynucleotides, or CpG) as adjuvants for pVAX1-Sj26GST and assessed their effects on the immune system and protection against S. japonicum. The authors show that combining CpG and R848 with pVAX1-Sj26GST immunization significantly increases splenocyte proliferation and IgG and IgG2a levels, decreases CD4+CD25+Foxp3+ regulatory T cells (Treg) frequency in vivo and enhances protection against S. japonicum. CpG and R848 inhibited Treg-mediated immunosuppression, upregulated the prodn. of interferon (IFN)-γ, tumor necrosis factor (TNF)-α, interleukin (IL)-4, IL-10, IL-2 and IL-6 and decreased Foxp3 expression in vitro, which may contribute to prevent Treg suppression and conversion during vaccination and allow expansion of antigen-specific T cells against pathogens. Conclusions: Our data shows that selective TLR ligands can increase the protective efficacy of DNA vaccines against schistosomiasis, potentially through combined antagonism of Treg-mediated immunosuppression and conversion.
- 138Bourgeois, C.; Kuchler, K. Fungal Pathogens-a Sweet and Sour Treat for Toll-like Receptors. Front. Cell. Infect. Microbiol. 2012, 2, 142, DOI: 10.3389/fcimb.2012.00142[Crossref], [PubMed], [CAS], Google Scholar138https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC3s7ntVOnsw%253D%253D&md5=cec0c2b051ef4218be1aa74e825fed13Fungal pathogens-a sweet and sour treat for toll-like receptorsBourgeois Christelle; Kuchler KarlFrontiers in cellular and infection microbiology (2012), 2 (), 142 ISSN:.Hundred-thousands of fungal species are present in our environment, including normal colonizers that constitute part of the human microbiota. The homeostasis of host-fungus interactions encompasses efficient fungal sensing, tolerance at mucosal surfaces, as well as antifungal defenses. Decrease in host immune fitness or increase in fungal burden may favor pathologies, ranging from superficial mucocutaneous diseases to invasive life-threatening fungal infections. Toll-like receptors (TLRs) are essential players in this balance, due to their ability to control both inflammatory and anti-inflammatory processes upon recognition of fungal-specific pathogen-associated molecular patterns (PAMPs). Certain members of the TLR family participate to the initial recognition of fungal PAMPs on the cell surface, as well as inside phagosomes of innate immune cells. Active signaling cascades in phagocytes ultimately enable fungus clearance and the release of cytokines that shape and instruct other innate immune cells and the adaptive immune system. Some TLRs cooperate with other pattern recognition receptors (PRRs) (e.g., C-type lectins and Galectins), thus allowing for a tailored immune response. The spatio-temporal and physiological contributions of individual TLRs in fungal infections remains ill-defined, although in humans, TLR gene polymorphisms have been linked to increased susceptibility to fungal infections. This review focuses entirely on the role of TLRs that control the host susceptibility to environmental fungi (e.g., Aspergillus, Cryptoccocus, and Coccidoides), as well as to the most frequent human fungal pathogens represented by the commensal Candida species. The emerging roles of TLRs in modulating host tolerance to fungi, and the strategies that evolved in some of these fungi to evade or use TLR recognition to their advantage will also be discussed, as well as their potential suitability as targets in vaccine therapies.
- 139Patin, E. C.; Thompson, A.; Orr, S. J. Pattern Recognition Receptors in Fungal Immunity. Semin. Cell Dev. Biol. 2019, 89, 24– 33, DOI: 10.1016/j.semcdb.2018.03.003[Crossref], [PubMed], [CAS], Google Scholar139https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXkslWkt70%253D&md5=36ffa63b229ff244186d68354deb6bdePattern recognition receptors in fungal immunityPatin, Emmanuel C.; Thompson, Aiysha; Orr, Selinda J.Seminars in Cell & Developmental Biology (2019), 89 (), 24-33CODEN: SCDBFX; ISSN:1084-9521. (Elsevier Ltd.)Over the last decade, invasive fungal infections have emerged as a growing threat to human health worldwide and novel treatment strategies are urgently needed. In this context, investigations into host-pathogen interactions represent an important and promising field of research. Antigen presenting cells such as macrophages and dendritic cells are strategically located at the frontline of defense against potential invaders. Importantly, these cells express germline encoded pattern recognition receptors (PRRs), which sense conserved entities from pathogens and orchestrate innate immune responses. Herein, we review the latest findings regarding the biol. and functions of the different classes of PRRs involved in pathogenic fungal recognition. We also discuss recent literature on PRR collaboration/crosstalk and the mechanisms involved in inhibiting/regulating PRR signalling. Finally, we discuss how the accumulated knowledge on PRR biol., esp. Dectin-1, has been used for the design of new immunotherapies against fungal infections.
- 140Martínez, A.; Bono, C.; Megías, J.; Yáñez, A.; Gozalbo, D.; Gil, M. L. Systemic Candidiasis and TLR2 Agonist Exposure Impact the Antifungal Response of Hematopoietic Stem and Progenitor Cells. Front. Cell. Infect. Microbiol. 2018, 8, 309, DOI: 10.3389/fcimb.2018.00309[Crossref], [PubMed], [CAS], Google Scholar140https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhvVahtb3I&md5=fcee336466a51032db681a1bb6b35d17Systemic candidiasis and TLR2 agonist exposure impact the antifungal response of hematopoietic stem and progenitor cellsMartinez, Alba; Bono, Cristina; Megias, Javier; Yanez, Alberto; Gozalbo, Daniel; Gil, M. LuisaFrontiers in Cellular and Infection Microbiology (2018), 8 (), 309/1-309/15CODEN: FCIMAB; ISSN:2235-2988. (Frontiers Media S.A.)We have previously demonstrated that Candida albicans induces differentiation of hematopoietic stem and progenitor cells (HSPCs) toward the myeloid lineage both in vitro and in vivo in a TLR2- and Dectin-1-dependent manner, giving rise to functional macrophages. In this work, we used an ex vivo model to investigate the functional consequences for macrophages derived from HSPCs in vivo-exposed to Pam3CSK4 (a TLR2 agonist) or C. albicans infection. Short in vivo treatment of mice with Pam3CSK4 results in a tolerized phenotype of ex vivo HSPC-derived macrophages, whereas an extended Pam3CSK4 treatment confers a trained phenotype. Early during candidiasis, HSPCs give rise to macrophages trained in their response to Pam3CSK4 and with an increased fungicidal activity; however, as the infection progresses to higher fungal burden, HSPC-derived macrophages become tolerized, while their fungicidal capacity is maintained. These results demonstrate that memory-like innate immune responses, already described for monocytes and macrophages, also take place in HSPCs. Interestingly, extended Pam3CSK4 treatment leads to an expansion of spleen HSPCs and myeloid cells, and drastically reduces the fungal burden in the kidney and spleen during systemic C. albicans infection. This protection against tissue invasion is abrogated by immunodepletion of HSPCs, suggesting their protective role against infection in this model. In addn., HSPCs produce in vitro cytokines and chemokines in response to C. albicans and Pam3CSK4, and these secretomes are capable of inducing myeloid differentiation of HSPCs and modulating peritoneal macrophage cytokine responses. Taken together, these data assign an active role for HSPCs in sensing pathogens during infection and in contributing to host protection by diverse mechanisms.
- 141Redlich, S.; Ribes, S.; Schütze, S.; Eiffert, H.; Nau, R. Toll-like Receptor Stimulation Increases Phagocytosis of Cryptococcus Neoformans by Microglial Cells. J. Neuroinflammation 2013, 10, 841, DOI: 10.1186/1742-2094-10-71
- 142Oh, H. M.; Lee, S. W.; Park, M. H.; Kim, M. H.; Ryu, Y. B.; Kim, M. S.; Kim, H. H.; Park, K. H.; Lee, W. S.; Park, S. J.; Rho, M. C. Norkurarinol Inhibits Toll-Like Receptor 3 (TLR3)-Mediated pro-Inflammatory Signaling Pathway and Rotavirus Replication. J. Pharmacol. Sci. 2012, 118 (2), 161– 170, DOI: 10.1254/jphs.11077FP[Crossref], [PubMed], [CAS], Google Scholar142https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC38Xjt12hsr8%253D&md5=1eb18926ad3e77f6d0a463a9482c9670Norkurarinol inhibits toll-like receptor 3 (TLR3)-mediated pro-inflammatory signaling pathway and rotavirus replicationOh, Hyun-Mee; Lee, Seung Woong; Park, Mi Hye; Kim, Mi Hwa; Ryu, Young Bae; Kim, Myo Sun; Kim, Ha-Hyun; Park, Ki Hun; Lee, Woo Song; Park, Su-Jin; Rho, Mun-ChualJournal of Pharmacological Sciences (Tokyo, Japan) (2012), 118 (2), 161-170CODEN: JPSTGJ; ISSN:1347-8613. (Japanese Pharmacological Society)This study examd. the effect of norkurarinol on the toll-like receptor 3 (TLR3)-mediated signaling pathways and rotavirus replication. Norkurarinol, a lavandulylated flavanone, was isolated from the roots of Sophora flavescens, which has been shown to have anti-inflammatory activity. Norkurarinol suppressed the NF-κB and AP-1 inducible secreted embryonic alk. phosphatase (SEAP) activity induced by poly(I:C), TLR3 ligand, in THP1-Blue-CD14 cells with IC50 values of 20.9 μM. Norkurarinol also significantly suppressed the mRNA expression of pro-inflammatory and adhesive mols. induced by poly(I:C) and rotavirus infection. Pretreatment of norkurarinol blocked the NF-κB and AP-1 signaling pathway and the phosphorylation of MAPKs induced by poly(I:C). On the other hand, norkurarinol increased the level of IRF3 phosphorylation and IFNβ expression in a dose-dependent manner. Moreover, norkurarinol inhibited the rotavirus-induced cytopathic effects. These results suggest that norkurarinol can modulate the TLR3-mediated inflammatory responses and rotavirus replication.
- 143Engelmann, C.; Sheikh, M.; Sharma, S.; Kondo, T.; Loeffler-Wirth, H.; Zheng, Y. B.; Novelli, S.; Hall, A.; Kerbert, A. J. C.; Macnaughtan, J.; Mookerjee, R.; Habtesion, A.; Davies, N.; Ali, T.; Gupta, S.; Andreola, F.; Jalan, R. Toll-like Receptor 4 Is a Therapeutic Target for Prevention and Treatment of Liver Failure. J. Hepatol. 2020, 73 (1), 102– 112, DOI: 10.1016/j.jhep.2020.01.011[Crossref], [PubMed], [CAS], Google Scholar143https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXksV2jsro%253D&md5=c11b33143b00aca7d3763e70f2d3ffd7Toll-like receptor 4 is a therapeutic target for prevention and treatment of liver failureEngelmann, Cornelius; Sheikh, Mohammed; Sharma, Shreya; Kondo, Takayuki; Loeffler-Wirth, Henry; Zheng, Yu Bao; Novelli, Simone; Hall, Andrew; Kerbert, Annarein J. C.; MacNaughtan, Jane; Mookerjee, Rajeshwar; Habtesion, Abeba; Davies, Nathan; Ali, Tauhid; Gupta, Saurabh; Andreola, Fausto; Jalan, RajivJournal of Hepatology (2020), 73 (1), 102-112CODEN: JOHEEC; ISSN:0168-8278. (Elsevier B.V.)Toll-like receptor 4 (TLR4) plays an essential role in mediating organ injury in acute liver failure (ALF) and acute-on-chronic liver failure (ACLF). Herein, we assess whether inhibiting TLR4 signaling can ameliorate liver failure and serve as a potential treatment.Circulating TLR4 ligands and hepatic TLR4 expression were measured in plasma samples and liver biopsies from patients with cirrhosis. TAK-242 (TLR4 inhibitor) was tested in vivo (10 mg/kg i.p.) in rodent models of ACLF (bile duct ligation + lipopolysaccharide [LPS]; carbon tetrachloride + LPS) and ALF (galactosamine + LPS) and in vitro on immortalized human monocytes (THP-1) and hepatocytes (HHL5). The in vivo therapeutic effect was assessed by coma-free survival, organ injury and cytokine release and in vitro by measuring IL-6, IL-1β or cell injury (TUNEL), resp.In patients with cirrhosis, hepatic TLR4 expression was upregulated and circulating TLR4 ligands were increased (p <0.001). ACLF in rodents was assocd. with a switch from apoptotic cell death in ALF to non-apoptotic forms of cell death. TAK-242 reduced LPS-induced cytokine secretion and cell death (p = 0.002) in hepatocytes and monocytes in vitro. In rodent models of ACLF, TAK-242 administration improved coma-free survival, reduced the degree of hepatocyte cell death in the liver (p <0.001) and kidneys (p = 0.048) and reduced circulating cytokine levels (IL-1β, p <0.001). In a rodent model of ALF, TAK-242 prevented organ injury (p <0.001) and systemic inflammation (IL-1β, p <0.001).This study shows that TLR4 signaling is a key factor in the development of both ACLF and ALF; its inhibition reduces the severity of organ injury and improves outcome. TAK-242 may be of therapeutic relevance in patients with liver failure.Toll-like receptor 4 (or TLR4) mediates endotoxin-induced tissue injury in liver failure and cirrhosis. This receptor sensitizes cells to endotoxins, which are produced by gram-neg. bacteria. Thus, inhibiting TLR4 signaling with an inhibitor (TAK-242) ameliorates organ injury and systemic inflammation in rodent models of acute and acute-on-chronic liver failure.
- 144Papaioannou, A. I.; Spathis, A.; Kostikas, K.; Karakitsos, P.; Papiris, S.; Rossios, C. The Role of Endosomal Toll-like Receptors in Asthma. Eur. J. Pharmacol. 2017, 808 (September), 14– 20, DOI: 10.1016/j.ejphar.2016.09.033[Crossref], [PubMed], [CAS], Google Scholar144https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28Xhs1akt77P&md5=34a805658522703d2bcfcc326a4baeadThe role of endosomal toll-like receptors in asthmaPapaioannou, Andriana I.; Spathis, Aris; Kostikas, Konstantinos; Karakitsos, Petros; Papiris, Spyros; Rossios, ChristosEuropean Journal of Pharmacology (2017), 808 (), 14-20CODEN: EJPHAZ; ISSN:0014-2999. (Elsevier B.V.)Asthma is a heterogeneous inflammatory disease caused by assocn. of genetic and environmental factors and its incidence has significantly increased over the latest years. The clin. manifestations of asthma are the result of airway hyper-reactivity to a variety of triggers such as aeroallergens, viral and bacterial components. Toll-like receptors (TLRs) are pathogen assocd. mol. pattern receptors, which are also expressed in the lung tissue as well as in several cells of the innate and adaptive immune system. Ligation of TLRs results in alterations in the expression of several inflammatory and anti-inflammatory mediators, which are known to be involved in the pathogenesis of asthma. The endosomal TLRs have been shown to be assocd. with the induction of asthmatic inflammation (TLR3), and with disease exacerbations (TLR7, TLR8 and TLR9). Targeting these receptors seems to be an effective choice for suppressing airway inflammation, eosinophilia and airway hyperresponsiveness in asthmatic patients. In this review we provide information regarding endosomal TLRs and their role in the pathogenesis of asthma as well as their potential use as targets for the development of novel treatments for the therapy of asthma.
- 145Kim, J.; Durai, P.; Jeon, D.; Jung, I. D.; Lee, S. J.; Park, Y. M.; Kim, Y. Phloretin as a Potent Natural TLR2/1 Inhibitor Suppresses TLR2-Induced Inflammation. Nutrients 2018, 10 (7), 868, DOI: 10.3390/nu10070868[Crossref], [CAS], Google Scholar145https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXisFKls7%252FF&md5=d401bd5305121455a4a8a3d755d60816Phloretin as a potent natural TLR2/1 inhibitor suppresses TLR2-induced inflammationKim, Jieun; Durai, Prasannavenkatesh; Jeon, Dasom; Jung, In Duk; Lee, Seung Jun; Park, Yeong-Min; Kim, YangmeeNutrients (2018), 10 (7), 868/1-868/12CODEN: NUTRHU; ISSN:2072-6643. (MDPI AG)Here, we investigated whether the anti-inflammatory activity of phloretin is mediated through TLR2 pathways, and whether phloretin acts as an inhibitor of TLR2/1 heterodimerization using the TLR2/1 agonist Pam3CSK4. We tested the effects of phloretin on tumor necrosis factor (TNF)-α prodn. induced by various TLRs using known TLR-specific agonists. Phloretin significantly inhibited Pam3CSK4-induced TRL2/1 signaling in Raw264.7 cells compared to TLR signaling induced by the other agonists tested. Therefore, we further tested the effects of phloretin in human embryonic kidney (HEK) 293-hTLR2 cells induced by Pam3CSK4, and confirmed that phloretin has comparable inhibition of TLR2/1 heterodimerization to that induced by the known TLR2 inhibitor CU-CPT22. Moreover, phloretin reduced the secretion of the inflammatory cytokines TNF-α and interleukin (IL)-8 in Pam3CSK4-induced HEK293-hTLR2 cells, whereas it did not significantly reduce these cytokines under Pam2CSK4-induced activation. Western blot results showed that phloretin significantly suppressed Pam3CSK4-induced TLR2 and NF-κB p65 expression. Phloretin bound to TLR2 with micromolar binding affinity, and we proposed a binding model of phloretin at the TLR2-TLR1 interface. Overall, we confirmed that phloretin inhibits the heterodimerization of TLR2/1, highlighting TLR2 signaling as a therapeutic target for treating TLR2-mediated inflammatory immune diseases.
- 146Fußbroich, D.; Schubert, R.; Schneider, P.; Zielen, S.; Beermann, C. Impact of Soyasaponin I on TLR2 and TLR4 Induced Inflammation in the MUTZ-3-Cell Model. Food Funct. 2015, 6 (3), 1001– 1010, DOI: 10.1039/C4FO01065E[Crossref], [PubMed], [CAS], Google Scholar146https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXitlalsbc%253D&md5=755f02843c06e6782e583e961e0bdd80Impact of soyasaponin I on TLR2 and TLR4 induced inflammation in the MUTZ-3-cell modelFussbroich, Daniela; Schubert, Ralf; Schneider, Petra; Zielen, Stefan; Beermann, ChristopherFood & Function (2015), 6 (3), 1001-1010CODEN: FFOUAI; ISSN:2042-6496. (Royal Society of Chemistry)Previous studies have demonstrated that soyasaponin (SoSa) possesses anti-inflammatory properties in lipopolysaccharide (LPS)-stimulated immune cells by influencing the immune sensing of toll-like receptor (TLR) 4. The aim of this study was to investigate the immune modulatory effect of SoSa I on TLR2- and TLR4-induced inflammation within the monocytic MUTZ-3-cell model. MUTZ-3 cells were stimulated with gram-neg. (Escherichia coli) or gram-pos. (Staphylococcus aureus) bacteria or bacterial pathogen-assocd. mol. patterns (PAMPs) such as LPS or peptidoglycans (PGN) alone or in combination with SoSa I. Cell morphol. was characterized by raster scanning and light microscopy. Cytokine prodn. (IL-1β, IL-6, TNF-α, IP-10, RANTES and IL-8) was measured by cytometric bead array and the expression of surface markers was assessed by flow cytometry. MUTZ-3 cells revealed a cell maturation-like alteration in morphol. and increased expression of CD80, CD86, TLR2 and TLR4 after stimulation with either gram-neg. and gram-pos. bacteria or bacterial PAMPs. The addn. of SoSa I suppressed pro-inflammatory cytokine and chemokine secretions in a dose-dependent manner regardless of TLR2 or TLR4 stimulation. Interestingly, E. coli- and S. aureus-induced inflammation was always inhibited better by SoSa I than that induced by LPS and PGN. Addnl., SoSa I reduced the expression of CD86 in PGN- or LPS-stimulated cells. This study demonstrated that the anti-inflammatory capacity of SoSa I is based on influencing both monocytic TLR2 and TLR4 and that SoSa I inhibits more effectively whole bacteria compared to solely LPS or PGN what points to a broader role of SoSa I in the down-regulation of inflammation.
- 147Lim, H. J.; Jang, H.-J.; Kim, M. H.; Lee, S.; Lee, S. W.; Lee, S.-J.; Rho, M.-C. Oleanolic Acid Acetate Exerts Anti-Inflammatory Activity via IKKα/β Suppression in TLR3-Mediated NF-KB Activation. Molecules 2019, 24 (21), 4002, DOI: 10.3390/molecules24214002[Crossref], [CAS], Google Scholar147https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXitlCgurfJ&md5=21d6df22cb0d6f032d8538f49f4f53c6Oleanolic acid acetate exerts anti-inflammatory activity via IKKa/B suppression in TLR3-mediated NF-KB activationLim, Hyung Jin; Jang, Hyun-Jae; Kim, Mi Hwa; Lee, Soyoung; Lee, Seung Woong; Lee, Seung-Jae; Rho, Mun-ChualMolecules (2019), 24 (21), 4002CODEN: MOLEFW; ISSN:1420-3049. (MDPI AG)Here, we show the mol. basis for the effect of OAA on Toll-like receptor (TLR) downstream signaling. OAA treatment significantly inhibited the secretion of embryonic alk. phosphatase (SEAP) induced by polyinosinic acid (poly(I), TLR3 ligand) in a dose-dependent manner and without cytotoxicity in THP1-XBlue cells. In addn., OAA downregulated the gene expression of poly(I) induced pro-inflammatory cytokines and chemokines genes such as MCP-1, IL-1B, IL-8, VCAM-1 and ICAM-1. Furthermore, we found that the inhibition activity of OAA was accompanied by decreased activation of not only nuclear factor-kappa B (NF-KB) signaling but also mitogen-activated protein kinase (MAPK) signaling upon stimulation with the TLR3 agonist. Interestingly, the interaction of OAA with IKB kinase a/B (IKKa/B) strongly attenuated the prodn. of certain proteins and inflammatory cytokines in the TLR3 signaling pathway, such as nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha (IkBa), extracellular regulated kinases (ERK), and p38, in an in vitro model. These results reveal new insight into the understanding of the regulatory mechanisms of the downstream TLR3 signaling pathway and consequent inflammatory responses that are involved in the development and progression of inflammatory diseases.
- 148Okada, T.; Kawakita, F.; Nishikawa, H.; Nakano, F.; Liu, L.; Suzuki, H. Selective Toll-Like Receptor 4 Antagonists Prevent Acute Blood-Brain Barrier Disruption After Subarachnoid Hemorrhage in Mice. Mol. Neurobiol. 2019, 56 (2), 976– 985, DOI: 10.1007/s12035-018-1145-2[Crossref], [PubMed], [CAS], Google Scholar148https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhtVOls7rN&md5=0b14a479f1603b50aab3f5e3fcf1fd82Selective Toll-Like Receptor 4 Antagonists Prevent Acute Blood-Brain Barrier Disruption After Subarachnoid Hemorrhage in MiceOkada, Takeshi; Kawakita, Fumihiro; Nishikawa, Hirofumi; Nakano, Fumi; Liu, Lei; Suzuki, HidenoriMolecular Neurobiology (2019), 56 (2), 976-985CODEN: MONBEW; ISSN:0893-7648. (Humana Press Inc.)There are no direct evidences showing the linkage between Toll-like receptor 4 (TLR4) and blood-brain barrier (BBB) disruption after subarachnoid hemorrhage (SAH). The purpose of this study was to examine if selective blockage of TLR4 prevents BBB disruption after SAH in mice and if the TLR4 signaling involves mitogen-activated protein kinases (MAPKs). One hundred and fifty-one C57BL/6 male mice underwent sham or endovascular perforation SAH operation, randomly followed by an intracerebroventricular infusion of vehicle or two dosages (117 or 585 ng) of a selective TLR4 antagonist IAXO-102 at 30 min post-operation. The effects were evaluated by survival rates, neurol. scores, and brain water content at 24-72 h and IgG immunostaining and Western blotting at 24 h post-SAH. IAXO-102 significantly prevented post-SAH neurol. impairments, brain edema, and BBB disruption, resulting in improved survival rates. IAXO-102 also significantly suppressed post-SAH activation of a major isoform of MAPK p46 c-Jun N-terminal kinase (JNK) and matrix metalloproteinase-9 as well as periostin induction and preserved tight junction protein zona occludens-1. Another selective TLR4 antagonist TAK-242, which has a different binding site from IAXO-102, also showed similar effects to IAXO-102. This study first provided the evidence that TLR4 signaling is involved in post-SAH acute BBB disruption and that the signaling is mediated at least partly by JNK activation. TLR4-targeted therapy may be promising to reduce post-SAH morbidities and mortalities.
- 149Plunk, M. A.; Alaniz, A.; Olademehin, O. P.; Ellington, T. L.; Shuford, K. L.; Kane, R. R. Design and Catalyzed Activation of Tak-242 Prodrugs for Localized Inhibition of TLR4-Induced Inflammation. ACS Med. Chem. Lett. 2020, 11 (2), 141– 146, DOI: 10.1021/acsmedchemlett.9b00518[ACS Full Text], [CAS], Google Scholar149https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXjt1Gjug%253D%253D&md5=3d4e7b808795806e8b088aff98369e29Design and catalyzed activation of Tak-242 prodrugs for localized inhibition of TLR4-induced inflammationPlunk, Michael A.; Alaniz, Alyssa; Olademehin, Olatunde P.; Ellington, Thomas L.; Shuford, Kevin L.; Kane, Robert R.ACS Medicinal Chemistry Letters (2020), 11 (2), 141-146CODEN: AMCLCT; ISSN:1948-5875. (American Chemical Society)Tak-242 (resatorvid), a Toll-like Receptor 4 (TLR4) inhibitor, has been identified as a potent suppressor of innate inflammation. As a strategy to target Tak-242 to select tissue, four TLR4-inactive prodrugs were synthesized for activation via two different release mechanisms. Two nitrobenzyl Tak-242 prodrugs released the parent drug upon exposure to the exogenous enzyme nitroreductase, while the two propargyl prodrugs were converted to Tak-242 in the presence of Pd0.
- 150Facchini, F. A.; Zaffaroni, L.; Minotti, A.; Rapisarda, S.; Calabrese, V.; Forcella, M.; Fusi, P.; Airoldi, C.; Ciaramelli, C.; Billod, J. M.; Schromm, A. B.; Braun, H.; Palmer, C.; Beyaert, R.; Lapenta, F.; Jerala, R.; Pirianov, G.; Martin-Santamaria, S.; Peri, F. Structure-Activity Relationship in Monosaccharide-Based Toll-like Receptor 4 (TLR4) Antagonists. J. Med. Chem. 2018, 61 (7), 2895– 2909, DOI: 10.1021/acs.jmedchem.7b01803[ACS Full Text], [CAS], Google Scholar150https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXjs1ChtrY%253D&md5=dca4454e8d270b8b0ad8ba765bb547d7Structure-Activity Relationship in Monosaccharide-Based Toll-Like Receptor 4 (TLR4) AntagonistsFacchini, Fabio A.; Zaffaroni, Lenny; Minotti, Alberto; Rapisarda, Silvia; Calabrese, Valentina; Forcella, Matilde; Fusi, Paola; Airoldi, Cristina; Ciaramelli, Carlotta; Billod, Jean-Marc; Schromm, Andra; Braun, Harald; Palmer, Charys; Beyaert, Rudi; Lapenta, Fabio; Jerala, Roman; Pirianov, Grisha; Martin-Santamaria, Sonsoles; Peri, FrancescoJournal of Medicinal Chemistry (2018), 61 (7), 2895-2909CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)The structure-activity relationship was investigated in a series of synthetic TLR4 antagonists formed by a glucosamine core linked to two phosphate esters and two linear carbon chains. Mol. modeling showed that the compds. with 10, 12, and 14 carbons chains are assocd. with higher stabilization of the MD-2/TLR4 antagonist conformation than in the case of the C16 variant. Binding expts. with human MD-2 showed that the C12 and C14 variants have higher affinity than C10, while the C16 variant did not interact with the protein. The mols., with the exception of the C16 variant, inhibited the LPS-stimulated TLR4 signal in human and murine cells, and the antagonist potency mirrored the MD-2 affinity calcd. from in vitro binding expts. Fourier-transform IR, NMR, and small angle X-ray scattering measurements suggested that the aggregation state in aq. soln. depends on fatty acid chain lengths and that this property can influence TLR4 activity in this series of compds.
- 151Fernández, G.; Moraga, A.; Cuartero, M. I.; García-Culebras, A.; Peña-Martínez, C.; Pradillo, J. M.; Hernández-Jiménez, M.; Sacristán, S.; Ayuso, M. I.; Gonzalo-Gobernado, R.; Fernández-López, D.; Martín, M. E.; Moro, M. A.; González, V. M.; Lizasoain, I. TLR4-Binding DNA Aptamers Show a Protective Effect against Acute Stroke in Animal Models. Mol. Ther. 2018, 26 (8), 2047– 2059, DOI: 10.1016/j.ymthe.2018.05.019[Crossref], [PubMed], [CAS], Google Scholar151https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhsVekur%252FP&md5=0eab3caf2fdac646839068511b1e74e8TLR4-Binding DNA Aptamers Show a Protective Effect against Acute Stroke in Animal ModelsFernandez, Geronimo; Moraga, Ana; Cuartero, Maria I.; Garcia-Culebras, Alicia; Pena-Martinez, Carolina; Pradillo, Jesus M.; Hernandez-Jimenez, Macarena; Sacristan, Silvia; Ayuso, M. Irene; Gonzalo-Gobernado, Rafael; Fernandez-Lopez, David; Martin, M. Elena; Moro, Maria A.; Gonzalez, Victor M.; Lizasoain, IgnacioMolecular Therapy (2018), 26 (8), 2047-2059CODEN: MTOHCK; ISSN:1525-0024. (Cell Press)Since Toll-like receptor 4 (TLR4) mediates brain damage after stroke, development of TLR4 antagonists is a promising therapeutic strategy for this disease. Our aim was to generate TLR4-blocking DNA aptamers to be used for stroke treatment. From a random oligonucleotide pool, we identified two aptamers (ApTLR#1R, ApTLR#4F) with high affinity for human TLR4 by systematic evolution of ligands by exponential enrichment (SELEX). Optimized truncated forms (ApTLR#1RT, ApTLR#4FT) were obtained. Our data demonstrate specific binding of both aptamers to human TLR4 as well as a TLR4 antagonistic effect. ApTLR#4F and ApTLR#4FT showed a long-lasting protective effect against brain injury induced by middle cerebral artery occlusion (MCAO), an effect that was absent in TLR4-deficient mice. Similar effects were obtained in other MCAO models, including in rat. Addnl., efficacy of ApTLR#4FT in a model of brain ischemia-reperfusion in rat supports the use of this aptamer in patients undergoing artery recanalization induced by pharmacol. or mech. interventions. The absence of major toxicol. aspects and the good safety profile of the aptamers further encourage their future clin. positioning for stroke therapy and possibly other diseases in which TLR4 plays a deleterious role.
- 152Flacher, V.; Neuberg, P.; Point, F.; Daubeuf, F.; Muller, Q.; Sigwalt, D.; Fauny, J. D.; Remy, J. S.; Frossard, N.; Wagner, A.; Mueller, C. G.; Schaeffer, E. Mannoside Glycolipid Conjugates Display Anti-Inflammatory Activity by Inhibition of Toll-like Receptor-4 Mediated Cell Activation. ACS Chem. Biol. 2015, 10 (12), 2697– 2705, DOI: 10.1021/acschembio.5b00552[ACS Full Text], [CAS], Google Scholar152https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXhsFanu73O&md5=e1ddb8cccf5b4444815cfad54a96fd82Mannoside Glycolipid Conjugates Display Anti-inflammatory Activity by Inhibition of Toll-like Receptor-4 Mediated Cell ActivationFlacher, Vincent; Neuberg, Patrick; Point, Floriane; Daubeuf, Francois; Muller, Quentin; Sigwalt, David; Fauny, Jean-Daniel; Remy, Jean-Serge; Frossard, Nelly; Wagner, Alain; Mueller, Christopher G.; Schaeffer, EvelyneACS Chemical Biology (2015), 10 (12), 2697-2705CODEN: ACBCCT; ISSN:1554-8929. (American Chemical Society)Inhibition of excessive Toll-like receptor 4 (TLR4) signaling is a therapeutic approach pursued for many inflammatory diseases. We report that Mannoside Glycolipid Conjugates (MGCs) selectively blocked TLR4-mediated activation of human monocytes and monocyte-derived dendritic cells (DCs) by lipopolysaccharide (LPS). They potently suppressed pro-inflammatory cytokine secretion and maturation of DCs exposed to LPS, leading to impaired T cell stimulation. MGCs did not interfere with LPS and could act in a delayed manner, hours after LPS stimulation. Their inhibitory action required both the sugar heads and the lipid chain, although the nature of the sugar and the structure of the lipid tail could be modified. They blocked early signaling events at the cell membrane, enhanced internalization of CD14 receptors, and prevented colocalization of CD14 and TLR4, thereby abolishing NF-κB nuclear translocation. When the best lead conjugate was tested in a mouse model of LPS-induced acute lung inflammation, it displayed an anti-inflammatory action by suppressing the recruitment of neutrophils. Thus, MGCs could serve as promising leads for the development of selective TLR4 antagonistic agents for inflammatory diseases.
- 153Lu, M. Y.; Chen, C. C.; Lee, L. Y.; Lin, T. W.; Kuo, C. F. N6-(2-Hydroxyethyl)Adenosine in the Medicinal Mushroom Cordyceps Cicadae Attenuates Lipopolysaccharide-Stimulated Pro-Inflammatory Responses by Suppressing TLR4-Mediated NF-KB Signaling Pathways. J. Nat. Prod. 2015, 78 (10), 2452– 2460, DOI: 10.1021/acs.jnatprod.5b00573[ACS Full Text], [CAS], Google Scholar153https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXhs1yisb7O&md5=14acc56b55bd736a85a6c46c2224159cN6-(2-Hydroxyethyl)adenosine in the Medicinal Mushroom Cordyceps cicadae Attenuates Lipopolysaccharide-Stimulated Pro-inflammatory Responses by Suppressing TLR4-Mediated NF-κB Signaling PathwaysLu, Meng-Ying; Chen, Chin-Chu; Lee, Li-Ya; Lin, Ting-Wei; Kuo, Chia-FengJournal of Natural Products (2015), 78 (10), 2452-2460CODEN: JNPRDF; ISSN:0163-3864. (American Chemical Society-American Society of Pharmacognosy)Natural products play an important role in promoting health with relation to the prevention of chronic inflammation. N6-(2-Hydroxyethyl)adenosine (HEA), a physiol. active compd. in the medicinal mushroom Cordyceps cicadae, has been identified as a Ca2+ antagonist and shown to control circulation and possess sedative activity in pharmacol. tests. The fruiting body of C. cicadae has been widely applied in Chinese medicine. However, neither the anti-inflammatory activities of HEA nor the fruiting bodies of C. cicadae have been carefully examd. In this study, the authors first cultured the fruiting bodies of C. cicadae and then investigated the anti-inflammatory activities of water and methanol exts. of wild and artificially cultured C. cicadae fruiting bodies. Next, the authors detd. the amt. of three bioactive compds., adenosine, cordycepin, and HEA, in the exts. and evaluated their synergistic anti-inflammatory effects. Moreover, the possible mechanism involved in anti-inflammatory action of HEA isolated from C. cicadae was investigated. The results indicate that cordycepin is more potent than adenosine and HEA in suppressing the lipopolysaccharide (LPS)-stimulated release of pro-inflammatory cytokines by RAW 264.7 macrophages; however, no synergistic effect was obsd. with these three compds. HEA attenuated the LPS-induced pro-inflammatory responses by suppressing the toll-like receptor (TLR)4-mediated nuclear factor-κB (NF-κB) signaling pathway. This result will support the use of HEA as an anti-inflammatory agent and C. cicadae fruiting bodies as an anti-inflammatory mushroom.
- 154Li, S.; Gao, X.; Wu, X.; Wu, Z.; Cheng, L.; Zhu, L.; Shen, D.; Tong, X. Parthenolide Inhibits LPS-Induced Inflammatory Cytokines through the Toll-like Receptor 4 Signal Pathway in THP-1 Cells. Acta Biochim. Biophys. Sin. 2015, 47 (5), 368– 375, DOI: 10.1093/abbs/gmv019[Crossref], [PubMed], [CAS], Google Scholar154https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXhsFChsLjL&md5=f5b4274c91e0f7b672c8d2798941ad76Parthenolide inhibits LPS-induced inflammatory cytokines through the toll-like receptor 4 signal pathway in THP-1 cellsLi, Shuangshuang; Gao, Xiangli; Wu, Xiaoxin; Wu, Zhigang; Cheng, Linfang; Zhu, Lifen; Shen, Dan; Tong, XiangminActa Biochimica et Biophysica Sinica (2015), 47 (5), 368-375CODEN: ABBSC2; ISSN:1672-9145. (ABBS Editorial Office)Parthenolide (PTL) shows potent anti-inflammatory and anti-cancer activities. In the present study, the mol. mechanisms of PTL's activities were explored in lipopolysaccharide (LPS)-induced human leukemia monocytic THP-1 cells and human primary monocytes. The 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium salt (MTS) assay was used to analyze the effect of PTL on THP-1 cell viability. ELISA was used to det. the effect of PTL on LPS-induced inflammatory cytokine secretion. Flow cytometry and quant. real-time polymerase chain reaction were used to assess the effect of PTL on LPS-induced toll-like receptor 4 (TLR4) expression. Phosphorylation levels of signaling mols. were detd. by western blot anal. Results showed that PTL <12.5 μM did not significantly affect THP-1 cells viability. LPS treatment led to a marked up-regulation of interleukin (IL)-6, IL-1β, IL-8, IL-12p40, tumor necrosis factor-α, IL-18, and NO in THP-1 cells. However, PTL inhibited the expression of these cytokines in a dose-dependent manner, with IC50 values of 1.091-2.620 μM. PTL blocked TLR4 expression with an IC50 value of 1.373 μM as detd. by the flow cytometry anal., and this blocking effect was verified at both protein and mRNA levels. Up-regulation of phosphorylation levels of extracellular signal-regulated kinase 1/2, Jun N-terminal kinase, p38, nuclear factor κB (NF-κB) p65, and IκBα and up-regulation of expressions of other mols. (inducible nitric oxide synthase, TLR4, and TNF receptor-assocd. factor 6) induced by LPS were abolished by PTL in a dose-dependent manner. The anti-inflammatory mechanisms of PTL operate partly through the TLR4-mediated mitogen-activated protein kinase and NF-κB signaling pathways. Therefore, TLR4 may be a new target for anti-inflammation therapies.
- 155Ye, S.; Zheng, Q.; Zhou, Y.; Bai, B.; Yang, D.; Zhao, Z. Chlojaponilactone B Attenuates Lipopolysaccharide-Induced Inflammatory Responses by Suppressing TLR4-Mediated ROS Generation and NF-KB Signaling Pathway. Molecules 2019, 24 (20), 3731, DOI: 10.3390/molecules24203731[Crossref], [CAS], Google Scholar155https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXitlaiur%252FM&md5=64b81017e8b870c825c5d9847902aadeChlojaponilactone B attenuates lipopolysaccharide-induced inflammatory responses by suppressing TLR4-mediated ROS generation and NF-κB signaling pathwayYe, Shaoxia; Zheng, Qiyao; Zhou, Yang; Bai, Bai; Yang, Depo; Zhao, ZhiminMolecules (2019), 24 (20), 3731CODEN: MOLEFW; ISSN:1420-3049. (MDPI AG)The lindenane-type sesquiterpenoid chlojaponilactone B (1), isolated from Chloranthus japonicus, has been reported to possess anti-inflammatory properties. The present study aimed to further explore the mol. mechanisms underlying the anti-inflammatory activity of 1. RNA-seq analyses revealed the significant changes in the expression levels of genes related to multiple inflammatory pathways upon treatment of lipopolysaccharide (LPS)-induced RAW 264.7 murine macrophages with 1. Real time PCR (RT-PCR) and Western blotting were used to confirm the modulations in the expression of essential mols. related to inflammatory responses. Compd. 1 inhibited toll like receptor 4 (TLR4) and myeloid differentiation factor 88 (MyD88) activation upon LPS stimulation, influencing the expression of NF-κB and pro-inflammatory mediators. Mol. docking studies showed that 1 bound to TLR4 in a manner similar to that of TAK-242, a TLR4 inhibitor. Moreover, our results showed that 1 suppressed inflammatory responses by inhibiting TLR4 and subsequently decreasing reactive oxygen species (ROS) generation, downregulating the NF-κB, thus reducing the expression of the pro-inflammatory cytokines iNOS, NO, COX-2, IL-6 and TNF-α; these effects were similar to those of TAK-242. We proposed that 1 should be considered as a potential anti-inflammatory compd. in future research.
- 156He, J.; Han, S.; Li, X. X.; Wang, Q. Q.; Cui, Y.; Chen, Y.; Gao, H.; Huang, L.; Yang, S. Diethyl Blechnic Exhibits Anti-Inflammatory and Antioxidative Activity via the TLR4/MyD88 Signaling Pathway in LPS-Stimulated RAW264.7 Cells. Molecules 2019, 24 (24), 4502, DOI: 10.3390/molecules24244502[Crossref], [CAS], Google Scholar156https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhs1Ort78%253D&md5=9925b723d6a1839cc1f860f090267d75Diethyl blechnic exhibits anti-inflammatory and antioxidative activity via the TLR4/MyD88 signaling pathway in LPS-stimulated RAW264.7 cellsHe, Jia; Han, Shan; Li, Xin-Xing; Wang, Qin-Qin; Cui, Yushun; Chen, Yangling; Gao, Hongwei; Huang, Liting; Yang, ShilinMolecules (2019), 24 (24), 4502CODEN: MOLEFW; ISSN:1420-3049. (MDPI AG)Inflammation is a common pathogenesis in many diseases. Salvia miltiorrhiza Bunge (Danshen), a traditional Chinese medicine, has been considered to have good anti-inflammatory effects. In the present study, we investigated the anti-inflammatory effect of di-Et blechnic (DB), a novel compd. isolated from Danshen, and its possible mechanisms in lipopolysaccharide (LPS)-induced RAW264.7 macrophages. The results showed that DB can inhibit the LPS-induced pro-inflammatory cytokines release of prostaglandin E2 (PGE2) and mRNA expression of TNF-a, IL-6, and IL-1b. In addn., the results of the flow cytometry assay and the fluorometric intracellular ROS kit assay indicated that DB reduced the generation of ROS in LPS-stimualted RAW264.7 cells. DB reversed the LPS-induced loss of the mitochondrial membrane potential (MMP). Furthermore, DB suppressed the LPS-stimulated increased expression of Toll-like receptor 4 (TLR4), myeloid differential protein-88 (MyD88) and phosphorylation of TAK1, PI3K, and AKT. DB promoted NF-E2-related factor 2 (Nrf2) into the nucleus, increased the expression of heme oxygenase-1 (HO-1) and NAD(P)H dehydrogenase [quinone] 1 (NQO1) and reduced the expression of Keap1. In summary, DB may inhibit LPS-induced inflammation, which mainly occurs through TLR4/MyD88 and oxidative stress signaling pathways in RAW264.7 cells.
- 157Thakur, V. R.; Beladiya, J. V.; Chaudagar, K. K.; Mehta, A. A. An Anti-Asthmatic Activity of Natural Toll-like Receptor-4 Antagonist in OVA-LPS-Induced Asthmatic Rats. Clin. Exp. Pharmacol. Physiol. 2018, 45 (11), 1187– 1197, DOI: 10.1111/1440-1681.13002[Crossref], [PubMed], [CAS], Google Scholar157https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhtlOrtr3J&md5=b2b82cc778823a5a8962d6ac72af4461An anti-asthmatic activity of natural Toll-like receptor-4 antagonist in OVA-LPS-induced asthmatic ratsThakur, Vandana R.; Beladiya, Jayesh V.; Chaudagar, Kiranj K.; Mehta, Anita A.Clinical and Experimental Pharmacology and Physiology (2018), 45 (11), 1187-1197CODEN: CEXPB9; ISSN:0305-1870. (Wiley-Blackwell)Summary : Toll-like receptor-4 (TLR4) is a key component of the innate immune system and activation of TLR4 signaling has a significant role in the pathogenesis of asthma. In the in vivo study, rats were sensitized with ovalbumin (OVA) (100 μg/kg, i.p.) on the 7th, 14th and 21st days and challenged intranasally with OVA (100 μg/100 μL) and LPS (10 ng/100 μL), 4 days/wk for 3 wk. At the end of the expt., we performed lung function parameters (respiratory rate, tidal vol., airflow rate), inflammatory cytokines (interleukin [IL]-4, IL-5, IL-13), total and differential leukocytes in blood as well as bronchoalveolar lavage fluid (BALf) and histol. examns. The computational study indicated that TLR4 antagonist activity of soya PC is due to linoleic acid (18:2) fatty acid chain. Soya PC significantly suppressed the LPS-induced neutrophil adhesion in a concn.-dependent manner to 1 μg/mL. The treatment of soya PC (5 and 10 mg/kg, 18 days, i.p.) significantly improved the lung function parameters, total and differential leukocyte counts in blood and BALf in asthmatic rats. This efficacy of soya PC was in extent similar to dexamethasone (2.5 mg/kg, 18 days, i.p.). However, soya PC was superior to dexamethasone in terms of benefits. The protective action of soya PC may be due to TLR4 antagonist activity and linoleic acid compn.
- 158Sun, H.; Zhu, X.; Cai, W.; Qiu, L. Hypaphorine Attenuates Lipopolysaccharide-Induced Endothelial Inflammation via Regulation of TLR4 and PPAR-γ Dependent on PI3K/Akt/MTOR Signal Pathway. Int. J. Mol. Sci. 2017, 18 (4), 844, DOI: 10.3390/ijms18040844[Crossref], [CAS], Google Scholar158https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhvFGjs7nL&md5=f9555b96313868cc1be3b50f642bdea0Hypaphorine attenuates lipopolysaccharide-induced endothelial inflammation via regulation of TLR4 and PPAR-γ dependent on PI3K/Akt/mTOR signal pathwaySun, Haijian; Zhu, Xuexue; Cai, Weiwei; Qiu, LiyingInternational Journal of Molecular Sciences (2017), 18 (4), 844/1-844/15CODEN: IJMCFK; ISSN:1422-0067. (MDPI AG)Endothelial lesion response to injurious stimuli is a necessary step for initiating inflammatory cascades in blood vessels. Hypaphorine (Hy) from different marine sources is shown to exhibit anti-inflammatory properties. However, the potential roles and possible mol. mechanisms of Hy in endothelial inflammation have yet to be fully clarified. We showed that Hy significantly inhibited the pos. effects of lipopolysaccharide (LPS) on pro-inflammatory cytokines expressions, including tumor necrosis factor-± (TNF-±), interleukin-12 (IL-12), monocyte chemoattractant protein 1 (MCP-1) and vascular cellular adhesion mol.-1 (VCAM-1), as well as induction of the phosphorylation of Akt and mTOR in HMEC-1 cells. The downregulated peroxisome proliferator-activated receptor γ (PPAR-γ) and upregulated toll-like receptor 4 (TLR4) expressions in LPS-challenged endothelial cells were prevented by Hy. Inhibition of both PI3K and mTOR reversed LPS-stimulated increases in TLR4 expressions and decreases in PPAR-γ levels. Genetic silencing of TLR4 or PPAR-γ agonist pioglitazone obviously abrogated the levels of pro-inflammatory cytokines in LPS-treated HMEC-1 cells. These results suggest that Hy may exert anti-inflammatory actions through the regulation of TLR4 and PPAR-γ dependent on PI3K/Akt/mTOR signal pathways. Hy may be considered as a therapeutic agent that can potentially relieve or ameliorate endothelial inflammation-assocd. diseases.
- 159Malgorzata-Miller, G.; Heinbockel, L.; Brandenburg, K.; Van Der Meer, J. W. M.; Netea, M. G.; Joosten, L. A. B. Bartonella Quintana Lipopolysaccharide (LPS): Structure and Characteristics of a Potent TLR4 Antagonist for in-Vitro and in-Vivo Applications. Sci. Rep. 2016, 6, 34221, DOI: 10.1038/srep34221[Crossref], [PubMed], [CAS], Google Scholar159https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XhsF2qsL%252FP&md5=c84db4fb33eb8ee5e15ab0a7d70b61e0Bartonella quintana lipopolysaccharide (LPS): structure and characteristics of a potent TLR4 antagonist for in-vitro and in-vivo applicationsMalgorzata-Miller, Gosia; Heinbockel, Lena; Brandenburg, Klaus; van der Meer, Jos W. M.; Netea, Mihai G.; Joosten, Leo A. B.Scientific Reports (2016), 6 (), 34221CODEN: SRCEC3; ISSN:2045-2322. (Nature Publishing Group)The pattern recognition receptor TLR4 is well known as a crucial receptor during infection and inflammation. Several TLR4 antagonists have been reported to inhibit the function of TLR4. Both natural occurring antagonists, lipopolysaccharide (LPS) from Gram-neg. bacteria as well as synthetic compds. based on the lipid A structure of LPS have been described as potent inhibitors of TLR4. Here, we have examd. the characteristics of a natural TLR4 antagonist, isolated from Bartonella quintana bacterium by elucidating its chem. primary structure. We have found that this TLR4 antagonist is actually a lipooligosaccharide (LOS) instead of a LPS, and that it acts very effective, with a high inhibitory activity against triggering by the LPS-TLR4 system in the presence of a potent TLR4 agonist (E. coli LPS). Furthermore, we demonstrate that B. quintana LPS is not inactivated by polymyxin B, a classical cyclic cationic polypeptide antibiotic that bind the lipid A part of LPS, such as E. coli LPS. Using a murine LPS/D-galactosamine endotoxemia model we showed that treatment with B. quintana LPS could improve the survival rate significantly. Since endogenous TLR4 ligands have been assocd. with several inflammatory- and immune-diseases, B. quintana LPS might be a novel therapeutic strategy for TLR4-driven pathologies.
- 160Shih, T. L.; Liu, M. H.; Li, C. W.; Kuo, C. F. Halo-Substituted Chalcones and Azachalcones-Inhibited, Lipopolysaccharited-Stimulated, pro-Inflammatory Responses through the TLR4-Mediated Pathway. Molecules 2018, 23 (3), 597, DOI: 10.3390/molecules23030597
- 161Guo, X. Y.; Cao, Q. Y.; Tang, Y. M.; Liang, Q. L. Simple Synthesis and Anti-Inflammatory Activities of Spanrstolonin B Derivatives. Phytochem. Lett. 2018, 24, 158– 162, DOI: 10.1016/j.phytol.2018.02.011[Crossref], [CAS], Google Scholar161https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXjs1eitL4%253D&md5=306dd718526f5bb606324ed0d792e815Simple synthesis and anti-inflammatory activities of Spanrstolonin B derivativesGuo, Xing-Yu; Cao, Qing-Yun; Tang, Ya-Min; Liang, Qiao-LiPhytochemistry Letters (2018), 24 (), 158-162CODEN: PLHEBK; ISSN:1874-3900. (Elsevier B.V.)Toll-like receptors are identified as an important factor in regulation of expression of pro-inflammatory cytokines and used as an important target in the field of anti-inflammation. SpanrstoloninB (SsnB), a new isocoumarin compd. isolated from the tuber of Scirpus yagara, is a Toll-like receptor 2 (TLR2) and TLR4 antagonist and can selectively block TLR2- and TLR4- mediated macrophages inflammatory responses. In this study, ten derivs. (A1-A6, B1-B2, and C1-C2) were synthesized by the structural modification of compds. 1 and 2, of which nine derivs. are new compds. The n-octanol/water partition coeffs. (Kow) of these derivs. were detd. by high performance liq. chromatog. method, and their anti-inflammatory activities were evaluated of inhibiting the secretion of TNF-α and IL-6 in LPS- or Pam3csk4- induced RAW264.7 cells. Preliminary structure-activity relationship study revealed that methylated, acetylated and butyrylated derivs. (A1-A6) exhibited weaker activities of anti-inflammatory than compd. 1 and 2. However, hydrolyzed and isoquinolone derivs. (B1-B2 and C1-C2) had better potential to decrease the levels of TNF-α and IL-6.
- 162Arora, S.; Ahmad, S.; Irshad, R.; Goyal, Y.; Rafat, S.; Siddiqui, N.; Dev, K.; Husain, M.; Ali, S.; Mohan, A.; Syed, M. A. TLRs in Pulmonary Diseases. Life Sci. 2019, 233, 116671, DOI: 10.1016/j.lfs.2019.116671[Crossref], [PubMed], [CAS], Google Scholar162https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhsFGjsLnK&md5=be2ba61debcb16c8c2cb23451e5f3341TLRs in pulmonary diseasesArora, Shweta; Ahmad, Shaniya; Irshad, Rasha; Goyal, Yamini; Rafat, Sahar; Siddiqui, Neha; Dev, Kapil; Husain, Mohammad; Ali, Shakir; Mohan, Anant; Syed, Mansoor AliLife Sciences (2019), 233 (), 116671CODEN: LIFSAK; ISSN:0024-3205. (Elsevier B.V.)A review. Toll-like receptors (TLRs) comprise a clan of proteins involved in identification and triggering a suitable response against pathogenic attacks. As lung is steadily exposed to multiple infectious agents, antigens and host-derived danger signals, the inhabiting stromal and myeloid cells of the lung express an aggregate of TLRs which perceive the endogenously derived damage-assocd. mol. patterns (DAMPs) along with pathogen assocd. mol. patterns (PAMPs) and trigger the TLR-assocd. signalling events involved in host defense. Thus, they form an imperative component of host defense activation in case of microbial infections as well as non-infectious pulmonary disorders such as interstitial lung disease, acute lung injury and airways disease, such as COPD and asthma. They also play an equally important role in lung cancer. Targeting the TLR signalling network would pave ways to the design of more reliable and effective vaccines against infectious agents and control deadly infections, desensitize allergens and reduce inflammation. Moreover, TLR agonists may act as adjuvants by increasing the efficiency of cancer vaccines, thereby contributing their role in treatment of lung cancer too. Overall, TLRs present a compelling and expeditiously bolstered area of research and addressing their signalling events would be of significant use in pulmonary diseases.
- 163Biggadike, K.; Ahmed, M.; Ball, D. I.; Coe, D. M.; Dalmas Wilk, D. A.; Edwards, C. D.; Gibbon, B. H.; Hardy, C. J.; Hermitage, S. A.; Hessey, J. O.; Hillegas, A. E.; Hughes, S. C.; Lazarides, L.; Lewell, X. Q.; Lucas, A.; Mallett, D. N.; Price, M. A.; Priest, F. M.; Quint, D. J.; Shah, P.; Sitaram, A.; Smith, S. A.; Stocker, R.; Trivedi, N. A.; Tsitoura, D. C.; Weller, V. Discovery of 6-Amino-2-{[(1S)-1-Methylbutyl]Oxy}-9-[5-(1-Piperidinyl)Pentyl]-7,9-Dihydro-8H-Purin-8-One (GSK2245035), a Highly Potent and Selective Intranasal Toll-Like Receptor 7 Agonist for the Treatment of Asthma. J. Med. Chem. 2016, 59 (5), 1711– 1726, DOI: 10.1021/acs.jmedchem.5b01647[ACS Full Text], [CAS], Google Scholar163https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28Xit1aksrk%253D&md5=adab143ac46a049054d9ee4f52cf6292Discovery of 6-Amino-2-{[(1S)-1-methylbutyl]oxy}-9-[5-(1-piperidinyl)pentyl]-7,9-dihydro-8H-purin-8-one (GSK2245035), a Highly Potent and Selective Intranasal Toll-Like Receptor 7 Agonist for the Treatment of AsthmaBiggadike, Keith; Ahmed, Mahbub; Ball, Doug I.; Coe, Diane M.; Dalmas Wilk, Deidre A.; Edwards, Chris D.; Gibbon, Bob H.; Hardy, Charlotte J.; Hermitage, Stephen A.; Hessey, Joanne O.; Hillegas, Aimee E.; Hughes, Stephen C.; Lazarides, Linos; Lewell, Xiao Q.; Lucas, Amanda; Mallett, David N.; Price, Mark A.; Priest, Fiona M.; Quint, Diana J.; Shah, Poonam; Sitaram, Anesh; Smith, Stephen A.; Stocker, Richard; Trivedi, Naimisha A.; Tsitoura, Daphne C.; Weller, VictoriaJournal of Medicinal Chemistry (2016), 59 (5), 1711-1726CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)Induction of IFNα in the upper airways via activation of TLR7 represents a novel immunomodulatory approach to the treatment of allergic asthma. Exploration of 8-oxoadenine derivs. bearing satd. oxygen or nitrogen heterocycles in the N-9 substituent has revealed a remarkable selective enhancement in IFNα inducing potency in the nitrogen series. Further potency enhancement was achieved with the novel (S)-pentyloxy substitution at C-2 leading to the selection of GSK2245035 (32) as an intranasal development candidate. In human cell cultures, compd. 32 resulted in suppression of Th2 cytokine responses to allergens, while in vivo intranasal administration at very low doses led to local upregulation of TLR7-mediated cytokines (IP-10). Target engagement was confirmed in humans following single intranasal doses of 32 of ≥20 ng, and reproducible pharmacol. response was demonstrated following repeat intranasal dosing at weekly intervals.
- 164Yoo, E.; Crall, B. M.; Balakrishna, R.; Malladi, S. S.; Fox, L. M.; Hermanson, A. R.; David, S. A. Structure-Activity Relationships in Toll-like Receptor 7 Agonistic 1H-Imidazo[4,5-c]Pyridines. Org. Biomol. Chem. 2013, 11 (38), 6526– 6545, DOI: 10.1039/c3ob40816g[Crossref], [PubMed], [CAS], Google Scholar164https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXhsVCjtL3M&md5=3280f9fcbe6343d78656ed6a3fea08c2Structure-activity relationships in Toll-like receptor 7 agonistic 1H-imidazo[4,5-c]pyridinesYoo, Euna; Crall, Breanna M.; Balakrishna, Rajalakshmi; Malladi, Subbalakshmi S.; Fox, Lauren M.; Hermanson, Alec R.; David, Sunil A.Organic & Biomolecular Chemistry (2013), 11 (38), 6526-6545CODEN: OBCRAK; ISSN:1477-0520. (Royal Society of Chemistry)Engagement of TLR7 in plasmacytoid dendritic cells leads to the induction of IFN-α/β which plays essential functions in the control of adaptive immunity. We had previously examd. structure-activity relationships (SAR) in TLR7/8-agonistic imidazoquinolines with a focus on substituents at the N1, C2, N3 and N4 positions, and we now report SAR on 1H-imidazo[4,5-c]pyridines. 1-Benzyl-2-butyl-1H-imidazo[4,5-c]pyridin-4-amine was a pure TLR7-agonist with negligible activity on TLR8. Increase in potency was obsd. in N6-substituted analogs, esp. in those compds. with electron-rich substituents. Direct aryl-aryl connections at C6 abrogated activity, but TLR7 agonism was reinstated in 6-benzyl and 6-phenethyl analogs. Consistent with the pure TLR7-agonistic behavior, prominent IFN-α induction in human PBMCs was obsd. with minimal proinflammatory cytokine induction. A benzologue of imidazoquinoline was also synthesized which showed substantial improvements in potency over the parent imidazopyridine. Distinct differences in N6-substituted analogs were obsd. with respect to IFN-α induction in human PBMCs on the one hand, and CD69 upregulation in lymphocytic subsets, on the other.
- 165Beesu, M.; Caruso, G.; Salyer, A. C. D.; Shukla, N. M.; Khetani, K. K.; Smith, L. J.; Fox, L. M.; Tanji, H.; Ohto, U.; Shimizu, T.; David, S. A. Identification of a Human Toll-Like Receptor (TLR) 8-Specific Agonist and a Functional Pan-TLR Inhibitor in 2-Aminoimidazoles. J. Med. Chem. 2016, 59 (7), 3311– 3330, DOI: 10.1021/acs.jmedchem.6b00023[ACS Full Text], [CAS], Google Scholar165https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XjvFyrtr4%253D&md5=27518d2e31e1758818b6fb44b046938bIdentification of a Human Toll-Like Receptor (TLR) 8-Specific Agonist and a Functional Pan-TLR Inhibitor in 2-AminoimidazolesBeesu, Mallesh; Caruso, Giuseppe; Salyer, Alex C. D.; Shukla, Nijunj M.; Khetani, Karishma K.; Smith, Luke J.; Fox, Lauren M.; Tanji, Hiromi; Ohto, Umeharu; Shimizu, Toshiyuki; David, Sunil A.Journal of Medicinal Chemistry (2016), 59 (7), 3311-3330CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)Activation of human toll-like receptor-8 (TLR8), expressed in myeloid dendritic cells, monocytes, and monocyte-derived dendritic cells, evokes a distinct cytokine profile which favors the development of Type 1 helper T cells. Part-structures of the 2-aminobenzimidazole scaffold were examd. with a view to identifying structural requisites corresponding to the smallest possible fragment of the benzimidazole core that would allow for retention of TLR8-agonistic activity. TLR8-specific agonistic activity was retained in 1-pentyl-4-phenyl-1H-imidazol-2-amine. The crystal structure of this compd. bound to the TLR8 ectodomain displayed binding interactions that are common to other TLR8 agonists. This compd. showed markedly attenuated proinflammatory properties in ex vivo human blood models. SAR studies revealed that 4-(2-(benzyloxy)phenyl)-1-pentyl-1H-imidazol-2-amine inhibited TLR signaling in a variety of TLR reporter cell lines, as well as in pharmacol. relevant human blood model systems. A kinase screen of this compd. showed relative specificity for calmodulin kinases.
- 166Beesu, M.; Salyer, A. C. D.; Trautman, K. L.; Hill, J. K.; David, S. A. Human Toll-like Receptor (TLR) 8-Specific Agonistic Activity in Substituted Pyrimidine-2,4-Diamines. J. Med. Chem. 2016, 59 (17), 8082– 8093, DOI: 10.1021/acs.jmedchem.6b00872[ACS Full Text], [CAS], Google Scholar166https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28Xhtlamt7vI&md5=3632c71b22857ff6f3561dc372b5e52fHuman Toll-like Receptor (TLR) 8-Specific Agonistic Activity in Substituted Pyrimidine-2,4-diaminesBeesu, Mallesh; Salyer, Alex C. D.; Trautman, Kathryn L.; Hill, Justin K.; David, Sunil A.Journal of Medicinal Chemistry (2016), 59 (17), 8082-8093CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)Activation of human toll-like receptor-8 (TLR8) evokes a distinct cytokine profile favoring the generation of Type 1 helper T cells. A multiplexed high-throughput screen had led to the identification of N4-butyl-5-iodo-6-methylpyrimidine-2,4-diamine as a pure TLR8 agonist, and a detailed SAR study of this chemotype was undertaken. A Bu substituent at N4 was optimal, and replacement of the 5-iodo group with chloro, bromo, or fluoro groups led to losses in potency, as did the introduction of arom. bulk. Drawing from the previous structure-based design, several 5-alkylamino derivs. were evaluated. Significant enhancement of potency was achieved in 5-(4-aminobutyl)-N4-butyl-6-methylpyrimidine-2,4-diamine. This compd. potently induced Th1-biasing IFN-γ and IL-12 in human blood, but lower levels of the proinflammatory cytokines IL-1β, IL-6 and IL-8. These results suggest that the inflammatory and reactogenic propensities of this compd. could be considerably more favorable than other TLR8 agonists under evaluation.
- 167Jiang, S.; Tanji, H.; Yin, K.; Zhang, S.; Sakaniwa, K.; Huang, J.; Yang, Y.; Li, J.; Ohto, U.; Shimizu, T.; Yin, H. Rationally Designed Small-Molecule Inhibitors Targeting an Unconventional Pocket on the TLR8 Protein–Protein Interface. J. Med. Chem. 2020, 63 (8), 4117– 4132, DOI: 10.1021/acs.jmedchem.9b02128[ACS Full Text], [CAS], Google Scholar167https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXmtFOisLc%253D&md5=7f5dbb4b3c72454c4b87ac188a98a531Rationally Designed Small-Molecule Inhibitors Targeting an Unconventional Pocket on the TLR8 Protein-Protein InterfaceJiang, Shuangshuang; Tanji, Hiromi; Yin, Kejun; Zhang, Shuting; Sakaniwa, Kentaro; Huang, Jian; Yang, Yi; Li, Jing; Ohto, Umeharu; Shimizu, Toshiyuki; Yin, HangJournal of Medicinal Chemistry (2020), 63 (8), 4117-4132CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)Rational designs of small-mol. inhibitors targeting protein-protein interfaces have met little success. Herein, we have designed a series of triazole derivs. with a novel scaffold to specifically intervene with the interaction of TLR8 homomerization. In multiple assays, TH1027 was identified as a highly potent and specific inhibitor of TLR8. A successful soln. of the X-ray crystal structure of TLR8 in complex with TH1027 provided an in-depth mechanistic insight into its binding mode, validating that TH1027 was located between two TLR8 monomers and recognized as an unconventional pocket, thereby preventing TLR8 from activation. Further biol. evaluations showed that TH1027 dose-dependently suppressed the TLR8-mediated inflammatory responses in both human monocyte cell lines, peripheral blood mononuclear cells, and rheumatoid arthritis patient specimens, suggesting a strong therapeutic potential against autoimmune diseases.
- 168Cheng, B.; Yuan, W. E.; Su, J.; Liu, Y.; Chen, J. Recent Advances in Small Molecule Based Cancer Immunotherapy. Eur. J. Med. Chem. 2018, 157, 582– 598, DOI: 10.1016/j.ejmech.2018.08.028[Crossref], [PubMed], [CAS], Google Scholar168https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhsFOqsb%252FP&md5=e15fa8048cf9b12ecd494d9ff8db8be5Recent advances in small molecule based cancer immunotherapyCheng, Binbin; Yuan, Wei-En; Su, Jing; Liu, Yao; Chen, JianjunEuropean Journal of Medicinal Chemistry (2018), 157 (), 582-598CODEN: EJMCA5; ISSN:0223-5234. (Elsevier Masson SAS)A review. Immunotherapy has been increasingly utilized for the treatment of cancer. Currently available cancer immunotherapies mainly involve the use of antibodies, which have advantages in terms of pharmacodynamics such as efficacy and specificity, however, they exhibit disadvantages in regard to the pharmacokinetics including but not limited to poor tissue and tumor penetration, very long half-life, and the lack of oral bioavailability. Also they are immunogenic and may cause undesired side effects. In addn., they are difficult and expensive to produce. In contrast to therapeutic antibodies, small mol. immuno-oncol. agents generally have favorable pharmacokinetics, for example, better oral bioavailability, higher tissue and tumor penetration, reasonable half-lives etc. Furthermore, some small mols. are highly selective and efficacious with benign toxicity profiles. Therefore, small mol. immuno-oncol. agents have the potential to overcome the drawbacks of therapeutic antibodies, and they can complement existing therapeutic antibodies and may also be used in combination with antibodies to achieve synergistic effects. In this article, we summarize the current advances in the field of small mol. approaches in tumor immunol. which include the small mols. in clin. trials and preclin. studies, and the reported crystal structures of small mols. and their target proteins as well as the binding interactions between small mols. and the targets. The tumorigenesis mechanism of different targets (the programmed cell death 1/programmed cell death ligand 1(PD1/PD-L1), retinoic acid-related orphan receptor-gamma t (RORγt), Chemokine receptor, Stimulator of Interferon Genes (Sting), Indoleamine 2,3-dioxygenase (IDO), toll-like receptors (TLR) etc.) are also elucidated.
- 169Basith, S.; Manavalan, B.; Yoo, T. H.; Kim, S. G.; Choi, S. Roles of Toll-like Receptors in Cancer: A Double-Edged Sword for Defense and Offense. Arch. Pharmacal Res. 2012, 35 (8), 1297– 1316, DOI: 10.1007/s12272-012-0802-7[Crossref], [PubMed], [CAS], Google Scholar169https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC38Xht1yntLrN&md5=23942ce19adebbedcae86c83890e5dfeRoles of toll-like receptors in Cancer: A double-edged sword for defense and offenseBasith, Shaherin; Manavalan, Balachandran; Yoo, Tae Hyeon; Kim, Sang Geon; Choi, SangdunArchives of Pharmacal Research (2012), 35 (8), 1297-1316CODEN: APHRDQ; ISSN:0253-6269. (Pharmaceutical Society of Korea)A review. Toll-like receptors (TLRs) belong to a class of pattern-recognition receptors that play an important role in host defense against pathogens by recognizing a wide variety of pathogen-assocd. mol. patterns (PAMPs). Besides driving inflammatory responses, TLRs also regulate cell proliferation and survival by expanding useful immune cells and integrating inflammatory responses and tissue repair processes. TLR signaling, which is centrally involved in the initiation of both innate and adaptive immune responses, has been thought to be restricted to immune cells. However, recent studies have shown that functional TLRs are expressed not only on immune cells, but also on cancer cells, thus implicating a role of TLRs in tumor biol. Increasing bodies of evidence have suggested that TLRs act as a double-edged sword in cancer cells because uncontrolled TLR signaling provides a microenvironment that is necessary for tumor cells to proliferate and evade the immune response. Alternatively, TLRs can induce an antitumor immune response in order to inhibit tumor progression. In this review, we summarize the dual roles of TLRs in tumor cells and, more importantly, delve into the therapeutic potential of TLRs in the context of tumorigenesis.
- 170Hennessy, E. J.; Parker, A. E.; O’Neill, L. A. J. Targeting Toll-like Receptors: Emerging Therapeutics?. Nat. Rev. Drug Discovery 2010, 9 (4), 293– 307, DOI: 10.1038/nrd3203[Crossref], [PubMed], [CAS], Google Scholar170https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3cXksF2itb4%253D&md5=ed2da43668217c9d470f5a53dd214708Targeting Toll-like receptors: emerging therapeutics?Hennessy, Elizabeth J.; Parker, Andrew E.; O'Neill, Luke A. J.Nature Reviews Drug Discovery (2010), 9 (4), 293-307CODEN: NRDDAG; ISSN:1474-1776. (Nature Publishing Group)A review. There is a growing interest in the targeting of Toll-like receptors (TLRs) for the prevention and treatment of cancer, rheumatoid arthritis, inflammatory bowel disease and systemic lupus erythematosus (SLE). Several new compds. are now undergoing preclin. and clin. evaluation, with a particular focus on TLR7 and TLR9 activators as adjuvants in infection and cancer, and inhibitors of TLR2, TLR4, TLR7 and TLR9 for the treatment of sepsis and inflammatory diseases. Here, we focus on TLRs that hold the most promise for drug discovery research, highlighting agents that are in the discovery phase and in clin. trials, and on the emerging new aspects of TLR-mediated signaling - such as control by ubiquitination and regulation by microRNAs - that might offer further possibilities of therapeutic manipulation.
- 171Pradere, J. P.; Dapito, D. H.; Schwabe, R. F. The Yin and Yang of Toll-like Receptors in Cancer. Oncogene 2014, 33 (27), 3485– 3495, DOI: 10.1038/onc.2013.302[Crossref], [PubMed], [CAS], Google Scholar171https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXht1CgsLnP&md5=c2321ec82e156ea1f78735eab8e72fa2The Yin and Yang of Toll-like receptors in cancerPradere, J.-P.; Dapito, D. H.; Schwabe, R. F.Oncogene (2014), 33 (27), 3485-3495CODEN: ONCNES; ISSN:0950-9232. (Nature Publishing Group)A review. Recognition of non-self mol. patterns by pattern recognition receptors is a cornerstone of innate immunity. Toll-like receptors (TLRs) exert a key role in recognizing pathogen-assocd. mol. patterns (PAMPs) but have also been implicated in the recognition of damage-assocd. mol. patterns (DAMPs). As such, TLRs regulate a wide range of biol. responses including inflammatory and immune responses during carcinogenesis. The high expression of TLRs by antigen-presenting cells, including dendritic cells, and their ability to induce antitumor mediators such as type I interferon has led to efforts to utilize TLR agonists in tumor therapy in order to convert the often tolerant immune response toward antitumor responses. However, TLRs are also increasingly recognized as regulators of tumor-promoting inflammation and promoters of tumor survival signals. Here, we will review in detail the dichotomous role of TLRs in tumor biol., focusing on relevant TLR-dependent pro- and antitumor pathways, and discuss clin. applications of TLR-targeted therapies for tumor prevention and treatment.
- 172Schmidt, J.; Welsch, T.; Jäger, D.; Mühlradt, P. F.; Büchler, M. W.; Märten, A. Intratumoural Injection of the Toll-like Receptor-2/6 Agonist ‘Macrophage-Activating Lipopeptide-2′ in Patients with Pancreatic Carcinoma: A Phase I/II Trial. Br. J. Cancer 2007, 97 (5), 598– 604, DOI: 10.1038/sj.bjc.6603903[Crossref], [PubMed], [CAS], Google Scholar172https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2sXpsF2ksL4%253D&md5=56326a3573fe871171db05f5ae6a662aIntratumoral injection of the toll-like receptor-2/6 agonist 'macrophage-activating lipopeptide-2' in patients with pancreatic carcinoma: a phase I/II trialSchmidt, J.; Welsch, T.; Jaeger, D.; Muehlradt, P. F.; Buechler, M. W.; Maerten, A.British Journal of Cancer (2007), 97 (5), 598-604CODEN: BJCAAI; ISSN:0007-0920. (Nature Publishing Group)This phase I/II trial examd. safety and efficacy of the toll-like receptor 2/6 agonist MALP-2 in combination with gemcitabine in patients with incompletely resectable pancreas carcinomas. MALP-2 is a toll-like receptor 2/6 agonist, acts as an immunol. adjuvant, and has been described recently to prolong survival in a mouse model of an orthotopic, syngeneic pancreas tumor. Male and female patients with incompletely resectable pancreas carcinomas were eligible while those with R0 or R1 resections or with peritoneal carcinosis were excluded. Ten patients were injected intratumorally during surgery with 20-30 μg MALP-2 followed by postoperative chemotherapy. Samples were taken from peripheral blood and wound secretion, and assayed for cell content, cytokine and CRP levels, and NK activity. An MALP-2 dose of 20 μg was well tolerated. Clear signs of local MALP-2 effects were presented by the influx of lymphocytes and monocytes in wound secretions, and abolishment of inhibition of NK activity. The actual mean survival is 17.1 ± 4.2 mo; the median survival being 9.3 mo. Two patients are still alive after 31 mo. Up to 20 μg MALP-2 was well tolerated, and no systemic side effects were noted. The mean survival of 17.1 mo is remarkably high.
- 173Ingale, S.; Wolfert, M. A.; Buskas, T.; Boons, G. J. Increasing the Antigenicity of Synthetic Tumor-Associated Carbohydrate Antigens by Targeting Toll-like Receptors. ChemBioChem 2009, 10 (3), 455– 463, DOI: 10.1002/cbic.200800596[Crossref], [PubMed], [CAS], Google Scholar173https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1MXis1amsL4%253D&md5=d5fc76855b718ae347d13f2dbd484d52Increasing the antigenicity of synthetic tumor-associated carbohydrate antigens by targeting Toll-like receptorsIngale, Sampat; Wolfert, Margreet A.; Buskas, Therese; Boons, Geert-JanChemBioChem (2009), 10 (3), 455-463CODEN: CBCHFX; ISSN:1439-4227. (Wiley-VCH Verlag GmbH & Co. KGaA)Epithelial cancer cells often overexpress mucins that are aberrantly glycosylated. Although it has been realized that these compds. offer exciting opportunities for the development of immunotherapy for cancer, their use is hampered by the low antigenicity of classical immunogens composed of a glycopeptide derived from a mucin conjugated to a foreign carrier protein. We have designed, chem. synthesized, and immunol. evaluated a no. of fully synthetic vaccine candidates to establish a strategy to overcome the poor immunogenicity of tumor-assocd. carbohydrates and glycopeptides. The compds. were also designed to allow study of the importance of Toll-like receptor (TLR) engagement for these antigenic responses in detail. We have found that covalent attachment of a TLR2 agonist, a promiscuous peptide T-helper epitope, and a tumor-assocd. glycopeptide gives a compd. (1) that elicits in mice exceptionally high titers of IgG antibodies that recognize MCF7 cancer cells expressing the tumor-assocd. carbohydrate. Immunizations with glycolipopeptide 2, which contains lipidated amino acids instead of a TLR2 ligand, gave significantly lower titers of IgG antibodies; this demonstrates that TLR engagement is crit. for optimum antigenic responses. Although mixts. of compd. 2 with Pam3CysSK4 (3) or monophosphoryl lipid A (4) elicited titers of IgG antibodies similar to those seen with 1, the resulting antisera had impaired ability to recognize cancer cells. It was also found that covalent linkage of the helper T-epitope to the B-epitope is essential, probably because internalization of the helper T-epitope by B-cells requires assistance of the B-epitope. The results presented here show that synthetic vaccine development is amenable to structure-activity relationship studies for successful optimization of carbohydrate-based cancer vaccines.
- 174Abdel-Aal, A. B. M.; Lakshminarayanan, V.; Thompson, P.; Supekar, N.; Bradley, J. M.; Wolfert, M. A.; Cohen, P. A.; Gendler, S. J.; Boons, G. J. Immune and Anticancer Responses Elicited by Fully Synthetic Aberrantly Glycosylated MUC1 Tripartite Vaccines Modified by a TLR2 or TLR9 Agonist. ChemBioChem 2014, 15 (10), 1508– 1513, DOI: 10.1002/cbic.201402077[Crossref], [PubMed], [CAS], Google Scholar174https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXovVegs70%253D&md5=f1a1a19319a0e4f48557e73ef2e83624Immune and Anticancer Responses Elicited by Fully Synthetic Aberrantly Glycosylated MUC1 Tripartite Vaccines Modified by a TLR2 or TLR9 AgonistAbdel-Aal, Abu-Baker M.; Lakshminarayanan, Vani; Thompson, Pamela; Supekar, Nitin; Bradley, Judy M.; Wolfert, Margreet A.; Cohen, Peter A.; Gendler, Sandra J.; Boons, Geert-JanChemBioChem (2014), 15 (10), 1508-1513CODEN: CBCHFX; ISSN:1439-4227. (Wiley-VCH Verlag GmbH & Co. KGaA)The mucin MUC1 is overexpressed and aberrantly glycosylated by many epithelial cancer cells manifested by truncated O-linked saccharides. Although tumor-assocd. MUC1 has generated considerable attention because of its potential for the development of a therapeutic cancer vaccine, it has been difficult to design constructs that consistently induce cytotoxic T-lymphocytes (CTLs) and ADCC-mediating antibodies specific for the tumor form of MUC1. The authors have designed, chem. synthesized, and immunol. examd. vaccine candidates each composed of a glycopeptide derived from MUC1, a promiscuous Thelper peptide, and a TLR2 (Pam3CysSK4) or TLR9 (CpG-ODN 1826) agonist. It was found that the Pam3CysSK4-contg. compd. elicits more potent antigenic and cellular immune responses, resulting in a therapeutic effect in a mouse model of mammary cancer. It is thus shown, for the first time, that the nature of an inbuilt adjuvant of a tripartite vaccine can significantly impact the quality of immune responses elicited against a tumor-assocd. glycopeptide. The unique adjuvant properties of Pam3CysSK4, which can reduce the suppressive function of regulatory T cells and enhance the cytotoxicity of tumor-specific CTLs, are likely responsible for the superior properties of the vaccine candidate 1.
- 175Shi, L.; Cai, H.; Huang, Z. H.; Sun, Z. Y.; Chen, Y. X.; Zhao, Y. F.; Kunz, H.; Li, Y. M. Synthetic MUC1 Antitumor Vaccine Candidates with Varied Glycosylation Pattern Bearing R/S-Configured Pam3CysSerLys4. ChemBioChem 2016, 17, 1412– 1415, DOI: 10.1002/cbic.201600206[Crossref], [PubMed], [CAS], Google Scholar175https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XpvFeqtrk%253D&md5=05b43ca881281de75651738cf0b1ba79Synthetic MUC1 Antitumor Vaccine Candidates with Varied Glycosylation Pattern Bearing R/S-configured Pam3CysSerLys4Shi, Lei; Cai, Hui; Huang, Zhi-Hua; Sun, Zhan-Yi; Chen, Yong-Xiang; Zhao, Yu-Fen; Kunz, Horst; Li, Yan-MeiChemBioChem (2016), 17 (15), 1412-1415CODEN: CBCHFX; ISSN:1439-4227. (Wiley-VCH Verlag GmbH & Co. KGaA)The Toll-like receptor 2 ligand Pam3CysSer is of particular interest for the construction synthetic vaccines because of its ability to stimulate of the innate immune system. Such vaccines usually comprise Pam3CysSer with the natural R-configuration at the glycerol 2-position. Pam3CysSer peptide vaccines with natural configuration have been shown to be more efficient than the corresponding R/S diastereomers. In order to clarify whether the effect of the configuration of Pam3Cys on the immune response also applies to glycopeptide vaccines, MUC1 glycopeptide-lipopeptide vaccines bearing either R- or R/S-configured Pam3CysSerLys4 were compared for their immunol. effects. In order to find out whether glycosylated MUC1 tandem repeat domains comprise not only B-cell epitopes but also T-cell epitopes, two-component vaccines contg. the Pam3CysSerLys4 lipopeptide and MUC1 glycopeptides with various glycosylation patterns were synthesized, and their immune reactions in mice were studied.
- 176Willems, M. M. J. H. P.; Zom, G. G.; Khan, S.; Meeuwenoord, N.; Melief, C. J. M.; Van Der Stelt, M.; Overkleeft, H. S.; Codée, J. D. C.; Van Der Marel, G. A.; Ossendorp, F.; Filippov, D. V. N-Tetradecylcarbamyl Lipopeptides as Novel Agonists for Toll-like Receptor 2. J. Med. Chem. 2014, 57 (15), 6873– 6878, DOI: 10.1021/jm500722p[ACS Full Text], [CAS], Google Scholar176https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXhtFCrt7bI&md5=39c3431ac3e0a49da9cba3561c8c4606N-Tetradecylcarbamyl Lipopeptides as Novel Agonists for Toll-like Receptor 2Willems, Marian M. J. H. P.; Zom, Gijs G.; Khan, Selina; Meeuwenoord, Nico; Melief, Cornelis J. M.; van der Stelt, Mario; Overkleeft, Herman S.; Codee, Jeroen D. C.; van der Marel, Gijsbert A.; Ossendorp, Ferry; Filippov, Dmitri V.Journal of Medicinal Chemistry (2014), 57 (15), 6873-6878CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)New analogs (UPam) of triacylated lipopeptide Pam3CysSK4, a popular agonist of Toll-like receptor 2 (TLR2), were designed making use of the cocrystal structure of a TLR2 heterodimer (with TLR1) with Pam3CysSK4. Twenty-two UPam derivs. that feature an N-tetradecylcarbamyl chain to mimic the native N-palmitoyl moiety and various small amino acids residues at the penultimate N-terminal position were prepd. via solid-phase synthesis. In vitro evaluation of immunostimulatory properties revealed new potent TLR2 ligands.
- 177Zom, G. G.; Willems, M. M. J. H. P.; Khan, S.; Van Der Sluis, T. C.; Kleinovink, J. W.; Camps, M. G. M.; Van Der Marel, G. A.; Filippov, D. V.; Melief, C. J. M.; Ossendorp, F. Novel TLR2-Binding Adjuvant Induces Enhanced T Cell Responses and Tumor Eradication. J. Immunother. Cancer 2018, 6, 146, DOI: 10.1186/s40425-018-0455-2[Crossref], [PubMed], [CAS], Google Scholar177https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB3cnht1WitA%253D%253D&md5=17a28bf91b230c2e8524b79acb03e8b0Novel TLR2-binding adjuvant induces enhanced T cell responses and tumor eradicationZom Gijs G; Khan Selina; van der Sluis Tetje C; Kleinovink Jan Willem; Camps Marcel G M; Melief Cornelis J M; Ossendorp Ferry; Willems Marian M J H P; van der Marel Gijsbert A; Filippov Dmitri V; Melief Cornelis J MJournal for immunotherapy of cancer (2018), 6 (1), 146 ISSN:.BACKGROUND: Ligands for the Toll-like receptor (TLR) family can induce activation of cells of the innate immune system and are widely studied for their potential to enhance adaptive immunity. Conjugation of TLR2-ligand Pam3CSK4 to synthetic long peptides (SLPs) was shown to strongly enhance the induction of antitumor immunity. To further improve cancer vaccination, we have previously shown that the novel TLR2-L Amplivant (AV), a modified Pam3CSK4, potentiates the maturation effects on murine DCs. In the current study, we further assessed the immunological properties of AV. METHODS: Naive mice were vaccinated with a conjugate of either Pam3CSK4 or AV and an SLP to assess specific T cell priming efficiency in vivo. The potency of AV and Pam3CSK4, either as free compounds or conjugated to different SLPs, to mature murine DCs was compared by stimulating murine dendritic cells overnight followed by ELISA and flow cytometry analysis. Murine tumor experiments were carried out by vaccinating mice carrying established HPV16 E6 and E7-expressing tumors and subsequently analyzing myeloid and lymphoid cells infiltrating the tumor microenvironment. Furthermore, tumor outgrowth after vaccination was monitored to enable comparison of the efficiency to induce antitumor immunity by Pam3CSK-SLP and AV-SLP conjugates. To enhance therapeutic efficacy, AV-SLP conjugate vaccination was combined with ablative therapies to assess whether synergism between such therapies would occur. RESULTS: SLPs conjugated to AV induce stronger DC maturation, in vivo T cell priming and antitumor immunity compared to conjugates with Pam3CSK4. Interestingly, AV-SLP conjugates modulate the macrophage populations in the tumor microenvironment, correlating with a therapeutic effect in an aggressive murine tumor model. The potency of AV-SLP conjugates in cancer vaccination operates optimally in combination with chemotherapy or photodynamic therapy. CONCLUSION: These data allow further optimization of vaccination-based immunotherapy of cancer by use of the improved TLR2-ligand Amplivant.
- 178Huynh, A. S.; Chung, W. J.; Cho, H. Il; Moberg, V. E.; Celis, E.; Morse, D. L.; Vagner, J. Novel Toll-like Receptor 2 Ligands for Targeted Pancreatic Cancer Imaging and Immunotherapy. J. Med. Chem. 2012, 55 (22), 9751– 9762, DOI: 10.1021/jm301002f[ACS Full Text], [CAS], Google Scholar178https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC38XhsFOlsbrF&md5=7a2659deb3a203a9a836c040b7df0ce3Novel Toll-like Receptor 2 Ligands for Targeted Pancreatic Cancer Imaging and ImmunotherapyHuynh, Amanda Shanks; Chung, Woo Jin; Cho, Hyun-Il; Moberg, Valerie E.; Celis, Esteban; Morse, David L.; Vagner, JosefJournal of Medicinal Chemistry (2012), 55 (22), 9751-9762CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)Toll-like receptor 2 (TLR2) is a target for immune system stimulation during cancer immunotherapy and a cell-surface marker for pancreatic cancer. To develop targeted agents for cancer imaging and therapy, we designed, synthesized, and characterized 13 novel, fully synthetic high affinity TLR2 agonists. Analog 10 had the highest agonist activity (NF-κB functional assay, EC50 = 20 nM) and binding affinity (competitive binding assay, Ki = 25 nM). As an immune adjuvant, compd. 10 stimulated the immune system in vivo by generation and persistence of antigen-specific CD8+ T cells indicating its potential use in cancer immunotherapy. After conjugation of near-IR dye to 10, agonist activity (EC50 = 34 nM) and binding affinity (Ki = 11 nM) were retained in 13. Fluorescence signal was present in TLR2 expressing pancreatic tumor xenografts 24 h after injection of 13, while an excess of unlabeled ligand blocked 13 from binding to the tumor, resulting in significantly decreased signal (p < 0.001) demonstrating in vivo selectivity.
- 179Bowdish, D. M. E.; Sakamoto, K.; Kim, M.-J.; Kroos, M.; Mukhopadhyay, S.; Leifer, C. A.; Tryggvason, K.; Gordon, S.; Russell, D. G. MARCO, TLR2, and CD14 Are Required for Macrophage Cytokine Responses to Mycobacterial Trehalose Dimycolate and Mycobacterium Tuberculosis. PLoS Pathog. 2009, 5 (6), e1000474, DOI: 10.1371/journal.ppat.1000474
- 180Yamamoto, H.; Oda, M.; Nakano, M.; Watanabe, N.; Yabiku, K.; Shibutani, M.; Inoue, M.; Imagawa, H.; Nagahama, M.; Himeno, S.; Setsu, K.; Sakurai, J.; Nishizawa, M. Development of Vizantin, a Safe Immunostimulant, Based on the Structure-Activity Relationship of Trehalose-6,6′-Dicorynomycolate. J. Med. Chem. 2013, 56 (1), 381– 385, DOI: 10.1021/jm3016443[ACS Full Text], [CAS], Google Scholar180https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC38XhslOls7rN&md5=6b9a2a5fa533d54e1d054f44b428e431Development of Vizantin, a Safe Immunostimulant, Based on the Structure-Activity Relationship of Trehalose-6,6'-dicorynomycolateYamamoto, Hirofumi; Oda, Masataka; Nakano, Mayo; Watanabe, Naoyuki; Yabiku, Kenta; Shibutani, Masahiro; Inoue, Masahisa; Imagawa, Hiroshi; Nagahama, Masahiro; Himeno, Seiichiro; Setsu, Kojun; Sakurai, Jun; Nishizawa, MugioJournal of Medicinal Chemistry (2013), 56 (1), 381-385CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)Vizantin, 6,6'-bis-O-(3-nonyldodecanoyl)-α,α'-trehalose, was developed as a safe immunostimulator on the basis of a structure-activity relation (SAR) study with trehalose 6,6'-dicorynomycolate (TDCM). It was possible to synthesize vizantin on a large scale more easily than in the case of TDCM, and the compd. exhibited more potent prophylactic effect on exptl. lung metastasis of B16-F0 melanoma cells. Because vizantin stimulated human macrophages, it is a promising candidate for clin. application.
- 181Morin, M. D.; Wang, Y.; Jones, B. T.; Mifune, Y.; Su, L.; Shi, H.; Moresco, E. M. Y.; Zhang, H.; Beutler, B.; Boger, D. L. Diprovocims: A New and Exceptionally Potent Class of Toll-like Receptor Agonists. J. Am. Chem. Soc. 2018, 140 (43), 14440– 14454, DOI: 10.1021/jacs.8b09223[ACS Full Text], [CAS], Google Scholar181https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhvVaqt7jE&md5=fb281c2f27781a593bab1ba13e7950beDiprovocims: A New and Exceptionally Potent Class of Toll-like Receptor AgonistsMorin, Matthew D.; Wang, Ying; Jones, Brian T.; Mifune, Yuto; Su, Lijing; Shi, Hexin; Moresco, Eva Marie Y.; Zhang, Hong; Beutler, Bruce; Boger, Dale L.Journal of the American Chemical Society (2018), 140 (43), 14440-14454CODEN: JACSAT; ISSN:0002-7863. (American Chemical Society)A screen conducted with nearly 100000 compds. and a surrogate functional assay for stimulation of an immune response that measured the release of TNF-α from treated human THP-1 myeloid cells differentiated along the macrophage line led to the discovery of the diprovocims. Unique to these efforts and of special interest, the screening leads for this new class of activators of an immune response came from a compd. library designed to promote cell-surface receptor dimerization. Subsequent comprehensive structure-activity relationship studies improved the potency 800-fold over that of the screening leads, providing diprovocim-1 and diprovocim-2. The diprovocims act by inducing cell-surface toll-like receptor (TLR)-2 dimerization and activation with TLR1 (TLR1/TLR2 agonist), bear no structural similarity to any known natural or synthetic TLR agonist, and are easy to prep. and synthetically modify, and selected members are active in both human and murine systems. The most potent diprovocim (3, diprovocim-1) elicits full agonist activity at extraordinarily low concns. (EC50 = 110 pM) in human THP-1 cells, being more potent than the naturally derived TLR1/TLR2 agonist Pam3CSK4 or any other known small mol. TLR agonist.
- 182Wang, Y.; Su, L.; Morin, M. D.; Jones, B. T.; Mifune, Y.; Shi, H.; Wang, K.-w.; Zhan, X.; Liu, A.; Wang, J.; Li, X.; Tang, M.; Ludwig, S.; Hildebrand, S.; Zhou, K.; Siegwart, D. J.; Moresco, E. M. Y.; Zhang, H.; Boger, D. L.; Beutler, B. Adjuvant Effect of the Novel TLR1/TLR2 Agonist Diprovocim Synergizes with Anti–PD-L1 to Eliminate Melanoma in Mice. Proc. Natl. Acad. Sci. U. S. A. 2018, 115 (37), E8698– E8706, DOI: 10.1073/pnas.1809232115[Crossref], [PubMed], [CAS], Google Scholar182https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXitVKhurrE&md5=bcb753f35bc5fb5bd54c4a7570cd5771Adjuvant effect of the novel TLR1/TLR2 agonist Diprovocim synergizes with anti-PD-L1 to eliminate melanoma in miceWang, Ying; Su, Lijing; Morin, Matthew D.; Jones, Brian T.; Mifune, Yuto; Shi, Hexin; Wang, Kuan-wen; Zhan, Xiaoming; Liu, Aijie; Wang, Jianhui; Li, Xiaohong; Tang, Miao; Ludwig, Sara; Hildebrand, Sara; Zhou, Kejin; Siegwart, Daniel J.; Y. Moresco, Eva Marie; Zhang, Hong; Boger, Dale L.; Beutler, BruceProceedings of the National Academy of Sciences of the United States of America (2018), 115 (37), E8698-E8706CODEN: PNASA6; ISSN:0027-8424. (National Academy of Sciences)Successful cancer immunotherapy entails activation of innate immune receptors to promote dendritic cell (DC) maturation, antigen presentation, up-regulation of costimulatory mols., and cytokine secretion, leading to activation of tumor antigen-specific cytotoxic T lymphocytes (CTLs). Here we screened a synthetic library of 100,000 compds. for innate immune activators using TNF prodn. by THP-1 cells as a readout. We identified and optimized a potent human and mouse Toll-like receptor (TLR)1/TLR2 agonist, Diprovocim, which exhibited an EC50 of 110 pM in human THP-1 cells and 1.3 nM in primary mouse peritoneal macrophages. In mice, Diprovocim-adjuvanted ovalbumin immunization promoted antigen-specific humoral and CTL responses and synergized with anti-PD-L1 treatment to inhibit tumor growth, generating long-term antitumor memory, curing or prolonging survival of mice engrafted with the murine melanoma B16-OVA. Diprovocim induced greater frequencies of tumor-infiltrating leukocytes than alum, of which CD8 T cells were necessary for the antitumor effect of immunization plus anti-PD-L1 treatment.
- 183Su, L.; Wang, Y.; Wang, J.; Mifune, Y.; Morin, M. D.; Jones, B. T.; Moresco, E. M. Y.; Boger, D. L.; Beutler, B.; Zhang, H. Structural Basis of TLR2/TLR1 Activation by the Synthetic Agonist Diprovocim. J. Med. Chem. 2019, 62 (6), 2938– 2949, DOI: 10.1021/acs.jmedchem.8b01583[ACS Full Text], [CAS], Google Scholar183https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXktV2mt70%253D&md5=4477d4c8261961e4cc5b68849946094dStructural Basis of TLR2/TLR1 Activation by the Synthetic Agonist DiprovocimSu, Lijing; Wang, Ying; Wang, Junmei; Mifune, Yuto; Morin, Matthew D.; Jones, Brian T.; Moresco, Eva Marie Y.; Boger, Dale L.; Beutler, Bruce; Zhang, HongJournal of Medicinal Chemistry (2019), 62 (6), 2938-2949CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)Diprovocim is a recently discovered exceptionally potent, synthetic small mol. agonist of TLR2/TLR1 and has shown significant adjuvant activity in anticancer vaccination against murine melanoma. Since Diprovocim bears no structural similarity to the canonical lipopeptide ligands of TLR2/TLR1, we investigated how Diprovocim interacts with TLR2/TLR1 through in vitro biophys., structural, and computational approaches. We found that Diprovocim induced the formation of TLR2/TLR1 heterodimers as well as TLR2 homodimers in vitro. We detd. the crystal structure of Diprovocim in a complex with a TLR2 ectodomain, which revealed, unexpectedly, two Diprovocim mols. bound to the ligand binding pocket formed between two TLR2 ectodomains. Extensive hydrophobic interactions and a hydrogen-bonding network between the protein and Diprovocim mols. are obsd. within the defined ligand binding pocket and likely underlie the high potency of Diprovocim. Our work shed first light into the activation mechanism of TLR2/TLR1 by a noncanonical agonist. The structural information obtained here may be exploited to manipulate TLR2/TLR1-dependent signaling.
- 184Cen, X.; Zhu, G.; Yang, J.; Yang, J.; Guo, J.; Jin, J.; Nandakumar, K. S.; Yang, W.; Yin, H.; Liu, S.; Cheng, K. TLR1/2 Specific Small-Molecule Agonist Suppresses Leukemia Cancer Cell Growth by Stimulating Cytotoxic T Lymphocytes. Adv. Sci. 2019, 6 (10), 1802042, DOI: 10.1002/advs.201802042[Crossref], [CAS], Google Scholar184https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB3M7pvF2nsQ%253D%253D&md5=47a770cd9148218f0a5ab7ff95dceb25TLR1/2 Specific Small-Molecule Agonist Suppresses Leukemia Cancer Cell Growth by Stimulating Cytotoxic T LymphocytesCen Xiaohong; Zhu Gengzhen; Yang Junjie; Guo Jiayin; Jin Jiabing; Nandakumar Kutty Selva; Liu Shuwen; Cheng Kui; Yang Jianjun; Yang Wei; Yin HangAdvanced science (Weinheim, Baden-Wurttemberg, Germany) (2019), 6 (10), 1802042 ISSN:2198-3844.Toll-like receptor 2 (TLR2) expressed on antigen presenting cells evokes a series of critical cytokines, which favor the development of tumor-specific cytotoxic T lymphocytes (CTLs). Therefore, TLR2 represents an attractive cancer immunotherapeutic target. Here, a synthetic library of 14 000 compounds together with a series of newly developed compounds for NF-κB activation using HEK-Blue hTLR2 cells is initially screened. Following further screening in a variety of cells including HEK-Blue hTLRs reporter cells, murine, and human macrophage cell lines, a potent small molecule agonist 23 (SMU-Z1) is identified, which specifically activates TLR2 through its association with TLR1, with a EC50 of 4.88 ± 0.79 × 10(-9) m. Toxicology studies, proinflammatory cytokines (e.g., TNF-α, IL-1β, IL-6, and nitric oxide) and target-protein based biophysical assays demonstrate the pharmacologically relevant characteristics of SMU-Z1. In addition, SMU-Z1 promotes murine splenocyte proliferation and upregulates the expression of CD8(+) T cells, NK cells and DCs, which results in a significant antitumor effect in a murine leukemia model. Finally, the induced tumors in three out of seven mice disappear after administration of SMU-Z1. Our studies thus identify a novel and potent TLR1/2 small molecule agonist, which displays promising immune adjuvant properties and antitumor immunity.
- 185Chen, Z.; Cen, X.; Yang, J.; Tang, X.; Cui, K.; Cheng, K. Structure-Based Discovery of a Specific TLR1-TLR2 Small Molecule Agonist from the ZINC Drug Library Database. Chem. Commun. 2018, 54 (81), 11411– 11414, DOI: 10.1039/C8CC06618C[Crossref], [PubMed], [CAS], Google Scholar185https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhslejtbnL&md5=75eccae65b738d00352291113f06a95fStructure-based discovery of a specific TLR1-TLR2 small molecule agonist from the ZINC drug library databaseChen, Zhipeng; Cen, Xiaohong; Yang, Junjie; Tang, Xiaoshan; Cui, Kai; Cheng, KuiChemical Communications (Cambridge, United Kingdom) (2018), 54 (81), 11411-11414CODEN: CHCOFS; ISSN:1359-7345. (Royal Society of Chemistry)We report herein the identification of urea structure-like small mols. by structure-based virtual screening of 10.5 million compds. Based on a variety of HEK-Blue hTLRs reporter cell assay results, we validated a TLR1/2-specific small mol. agonist, ZINC666243 (SMU127), with EC50 of 0.55±0.01 μM. SMU127 stimulates NF-κB activation and promotes TNFα secretion in human macrophages and mononuclear cells. Moreover, the in vivo assay indicated that SMU127 could inhibit the growth of breast cancer tumors in BABL/c mice. This work has shown for the first time that a small mol. TLR1/2 agonist can inhibit breast cancer in vivo.
- 186Kitada, S.; Leone, M.; Sareth, S.; Zhai, D.; Reed, J. C.; Pellecchia, M. Discovery, Characterization, and Structure - Activity Relationships Studies of Proapoptotic Polyphenols Targeting B-Cell Lymphocyte/Leukemia-2 Proteins. J. Med. Chem. 2003, 46 (20), 4259– 4264, DOI: 10.1021/jm030190z[ACS Full Text], [CAS], Google Scholar186https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD3sXmsFamsbo%253D&md5=6bd7d55afc614ba313ddec93fdd917c5Discovery, Characterization, and Structure-Activity Relationships Studies of Proapoptotic Polyphenols Targeting B-Cell Lymphocyte/Leukemia-2 ProteinsKitada, Shinichi; Leone, Marilisa; Sareth, Sina; Zhai, Dayong; Reed, John C.; Pellecchia, MaurizioJournal of Medicinal Chemistry (2003), 46 (20), 4259-4264CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)Among the most promising chemopreventive agents, certain natural polyphenols have recently received a great deal of attention because of their demonstrated inhibitory activity against tumorigenesis. In view of their anticancer properties, these compds. also hold great promise as potential chemotherapeutic agents. However, to translate these chemopreventive agents into chemotherapeutic compds., their exact mechanisms of action must be delineated. By using a multidisciplinary approach guided by modern NMR spectroscopy techniques, fluorescence polarization displacement assays, and cell-based assays, the authors have begun to unravel the mechanisms of actions of certain polyphenols such as Gossypol (a compd. from cotton seed exts.) and Purpurogallin (a natural compd. extd. from Quercus sp. nutgall) and their derivs. The authors findings suggest that these natural products bind and antagonize the antiapoptotic effects of B-cell lymphocyte/leukemia-2 (Bcl-2) family proteins such as Bcl-xL. The authors in vitro and in vivo data not only open a window of opportunities for the development of novel cancer treatments with these compds. but also provide structural information that can be used for the design and development of novel and more effective analogs.
- 187Cheng, K.; Wang, X.; Zhang, S.; Yin, H. Discovery of Small-Molecule Inhibitors of the TLR1/TLR2 Complex. Angew. Chem., Int. Ed. 2012, 51 (49), 12246– 12249, DOI: 10.1002/anie.201204910[Crossref], [CAS], Google Scholar187https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC38XhtlCqtbvP&md5=4feb4f19113c704e1a64c818a4bcf923Discovery of Small-Molecule Inhibitors of the TLR1/TLR2 ComplexCheng, Kui; Wang, Xiaohui; Zhang, Shuting; Yin, HangAngewandte Chemie, International Edition (2012), 51 (49), 12246-12249CODEN: ACIEF5; ISSN:1433-7851. (Wiley-VCH Verlag GmbH & Co. KGaA)A novel small mol., CU-CPT22 (I), that can compete with triacylated lipoprotein (Pam3CSK4) in binding to the TLR1/TLR2 complex with potency and specificity has been identified via structure-activity relationship studies. The down-stream signalling expts.further indicated that I suppresses the TLR1/TLR2-mediated inflammation response. This novel, small-mol. agent provides a much needed mol. probe for studying ligand interactions of the TLR1/TLR2 protein complex.
- 188Xu, Y. Y.; Chen, L.; Zhou, I. M.; Wu, Y. Y.; Zhu, Y. Y. Inhibitory Effect of DsRNA TLR3 Agonist in a Rat Hepatocellular Carcinoma Model. Mol. Med. Rep. 2013, 8 (4), 1037– 1042, DOI: 10.3892/mmr.2013.1646[Crossref], [PubMed], [CAS], Google Scholar188https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXhs1elsbzN&md5=61f84345c948e2e9ab3513bfdb5c65c2Inhibitory effect of dsRNA TLR3 agonist in a rat hepatocellular carcinoma modelXu, Yu-Yin; Chen, Li; Zhou, Jia-Ming; Wu, Yuan-Yuan; Zhu, Yuan-YuanMolecular Medicine Reports (2013), 8 (4), 1037-1042CODEN: MMROA5; ISSN:1791-2997. (Spandidos Publications Ltd.)Hepatocellular carcinoma (HCC) is one of the most common types of malignant tumor. Studies have demonstrated that the toll-like receptor 3 (TLR3)/interferon pathway is inhibitory in cancer cell proliferation, suggesting that the activation of this pathway may have therapeutic potential. In the present study, the inhibitory effects of BM-06, a double-stranded (ds)RNA TLR3 agonist, against HCC were studied in vivo. Using a 2-acetylaminofluorene-induced HCC rat model, histol. examn. and anal. of corresponding biomarkers following treatment with BM-06, showed a decrease in tumor growth and cell proliferation, and an increase in apoptosis compared with that in a phosphate-buffered saline control group. In addn., the obsd. antitumor effect of BM-06 in the HCC rat model was demonstrated to be superior to the known TLR3 agonist, polyinosinic-polycytidylic acid.
- 189Basith, S.; Manavalan, B.; Lee, G.; Kim, S. G.; Choi, S. Toll-like Receptor Modulators: A Patent Review (2006 - 2010). Expert Opin. Ther. Pat. 2011, 21 (6), 927– 944, DOI: 10.1517/13543776.2011.569494[Crossref], [PubMed], [CAS], Google Scholar189https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3MXmt1ymurs%253D&md5=21d288d66047cec245eb6a82a83c7baaToll-like receptor modulators: a patent review (2006 - 2010)Basith, Shaherin; Manavalan, Balachandran; Lee, Gwang; Kim, Sang Geon; Choi, SangdunExpert Opinion on Therapeutic Patents (2011), 21 (6), 927-944CODEN: EOTPEG; ISSN:1354-3776. (Informa Healthcare)A review. Introduction: The immune response is mediated via two parallel immune components, innate and adaptive, whose effector functions are highly integrated and coordinated for the protection of the human body against invading pathogens and transformed cells. The discovery of pathogen recognition receptors (PRRs), most notably toll-like receptors (TLRs), in innate immunity has evoked increased interest in the therapeutic handling of the innate immune system. TLRs are germ line-encoded receptors that play a potent role in the recognition of a diverse variety of ligands ranging from hydrophilic nucleic acids to lipopolysaccharide (LPS) or peptidoglycan (PGN) structures in pathogens. Areas covered: This review discusses recent updates (2006 - 2010) in completed, ongoing and planned clin. trials of TLR immunomodulator-based therapies for the treatment of infectious diseases, inflammatory disorders and cancer. Expert opinion: Since the discovery of human TLRs, modulating immune responses using TLR agonists or antagonists for therapeutic purposes has provoked intense activity in the pharmaceutical industry. The ability of TLRs to initiate and propagate inflammation makes them attractive therapeutic targets. We are now at the stage of evaluating such mols. in human diseases. Addnl., there is also extensive literature available on TLRs in diseased states. These data provide a basis for the identification of novel immunomodulators (agonists and antagonists) for the therapeutic targeting of TLRs.
- 190Matsumoto, M.; Takeda, Y.; Seya, T. Targeting Toll-like Receptor 3 in Dendritic Cells for Cancer Immunotherapy. Expert Opin. Biol. Ther. 2020, 20 (8), 937– 946, DOI: 10.1080/14712598.2020.1749260[Crossref], [PubMed], [CAS], Google Scholar190https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXnsVGjt7o%253D&md5=085157e98efdc7844a17d8acd288aae0Targeting Toll-like receptor 3 in dendritic cells for cancer immunotherapyMatsumoto, Misako; Takeda, Yohei; Seya, TsukasaExpert Opinion on Biological Therapy (2020), 20 (8), 937-946CODEN: EOBTA2; ISSN:1471-2598. (Taylor & Francis Ltd.)A review. : Activation of innate immune system is a key step to develop anti-tumor immunity. Antigen-presenting dendritic cells (DCs) cross-present tumor-assocd. antigens to cytotoxic CD8+ T cells (CTLs). Signaling from pattern-recognition receptors (PRRs) in DCs is required to induce tumor-specific CTLs.: This review summarizes the properties of PRRs expressed by antigen-presenting DCs, esp. TLR3, and provides the recent knowledge of their function in anti-tumor immunity. We also summarize the characteristics of newly-developed TLR3-specific agonist, ARNAX, which efficiently primes DCs to induce anti-tumor immunity without systemic inflammation in mice.: In cancer immunotherapy, the induction of tumor-specific CTLs is significant for tumor regression and to augment the efficacy of PD-1/PD-L1 blockade. Non-inflammatory TLR3 adjuvant ARNAX that can induce tumor-specific CTLs without inducing inflammation benefits cancer immunotherapy. Development of appropriate protocols for ARNAX vaccine therapy would be useful to overcome the PD-1/PD-L1 blockade resistance.
- 191Seya, T.; Takeda, Y.; Matsumoto, M. A Toll-like Receptor 3 (TLR3) Agonist ARNAX for Therapeutic Immunotherapy. Adv. Drug Delivery Rev. 2019, 147, 37– 43, DOI: 10.1016/j.addr.2019.07.008[Crossref], [PubMed], [CAS], Google Scholar191https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhsVOgtbjJ&md5=545569161cb2ef288443ca9cd67b4824A Toll-like receptor 3 (TLR3) agonist ARNAX for therapeutic immunotherapySeya, Tsukasa; Takeda, Yohei; Matsumoto, MisakoAdvanced Drug Delivery Reviews (2019), 147 (), 37-43CODEN: ADDREP; ISSN:0169-409X. (Elsevier B.V.)A review. Vaccine immunotherapy consisting of tumor antigens combined with an immune-enhancing adjuvant fosters cytotoxic T cell (CTL) proliferation. Clin., polyI:C has been used as an adjuvant to enhance cancer vaccine protocols. However, according to its long history, polyI:C promotes inflammation that causes cytokine toxicity. Although checkpoint inhibitor immunotherapy has improved the prognoses of patients with progressive cancer, over 75% of patients continue to experience resistance to antibody (Ab) against anti-programmed cell death-protein 1 (PD-1) or its ligand, PD-L1 therapy. In most cases, patients suffer from adverse events resulting from inflammation during anti-PD-1/L1 Ab therapy, which is a serious obstacle to patients' quality of life. We have studied the functional properties of double-stranded (ds)RNA and polyI:C, and developed a nucleic acid adjuvant that barely induces a significant increase in the level of serum inflammatory cytokines in mouse models. This adjuvant, termed ARNAX, consists of DNA-capped dsRNA that specifies the endosomal target for Toll-like receptor 3 (TLR3) in dendritic cells (DCs). We expect that this adjuvant is safe for administration in elderly patients with cancer receiving immunotherapy. Here, we summarize the properties of ARNAX for immunotherapy in mice. We suggest that DC-priming is essential to induce anti-tumor immunity; neither exogenous inflammation nor the administration of tumor antigens is always a prerequisite for DC-mediated CTL proliferation. If our mouse data can be extrapolated to humans, ARNAX and the liberated endogenous tumor antigens may facilitate effect of current therapies on patients with therapy-resistant tumors.
- 192Wang, Y.; Tu, Q.; Yan, W.; Xiao, D.; Zeng, Z.; Ouyang, Y.; Huang, L.; Cai, J.; Zeng, X.; Chen, Y. J.; Liu, A. CXC195 Suppresses Proliferation and Inflammatory Response in LPS-Induced Human Hepatocellular Carcinoma Cells via Regulating TLR4-MyD88-TAK1-Mediated NF-KB and MAPK Pathway. Biochem. Biophys. Res. Commun. 2015, 456 (1), 373– 379, DOI: 10.1016/j.bbrc.2014.11.090[Crossref], [PubMed], [CAS], Google Scholar192https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXitVeisrjJ&md5=2806c5aeed4c1bb6608f43dbd6fb5a91CXC195 suppresses proliferation and inflammatory response in LPS-induced human hepatocellular carcinoma cells via regulating TLR4-MyD88-TAK1-mediated NF-κB and MAPK pathwayWang, Yiting; Tu, Qunfei; Yan, Wei; Xiao, Dan; Zeng, Zhimin; Ouyang, Yuming; Huang, Long; Cai, Jing; Zeng, Xiaoli; Chen, Ya-Jie; Liu, AnwenBiochemical and Biophysical Research Communications (2015), 456 (1), 373-379CODEN: BBRCA9; ISSN:0006-291X. (Elsevier B.V.)CXC195 showed strong protective effects in neuronal apoptosis by exerting its antioxidant activity. However, the anti-cancer effects of CXC195 is still with limited acquaintance. Here, we investigated the role of CXC195 in lipopolysaccharide (LPS)-induced human hepatocellular carcinoma (HCC) cells lines (HepG2) and the possible signaling pathways. CXC195 exhibited significant anti-proliferative effect and induced cell cycle arrest in LPS-induced HepG2 cells. In addn., CXC195 suppressed the release of pro-inflammatory mediators in LPS-induced HepG2 cells, including TNF-α, iNOS, IL-1β, IL-6, CC chemokine ligand (CCL)-2, CCL-22 and epidermal growth factor receptor (EGFR). Moreover, CXC195 inhibited the expressions and interactions of TLR4, MyD88 and TAK1, NF-κB translocation to nucleus and its DNA binding activity, phosphorylation of ERK1/2, p38 and JNK. Our results suggested that treatment with CXC195 could attenuate the TLR4-mediated proliferation and inflammatory response in LPS-induced HepG2 cells, thus might be beneficial for the treatment of HCC.
- 193Liu, H.; Zhang, G.; Huang, J.; Ma, S.; Mi, K.; Cheng, J.; Zhu, Y.; Zha, X.; Huang, W. Atractylenolide I Modulates Ovarian Cancer Cell-Mediated Immunosuppression by Blocking MD-2/TLR4 Complex-Mediated MyD88/NF-KB Signaling in Vitro. J. Transl. Med. 2016, 14 (1), 4– 15, DOI: 10.1186/s12967-016-0845-5
- 194Zandi, Z.; Kashani, B.; Poursani, E. M.; Bashash, D.; Kabuli, M.; Momeny, M.; Mousavi-pak, S. H.; Sheikhsaran, F.; Alimoghaddam, K.; Mousavi, S. A.; Ghaffari, S. H. TLR4 Blockade Using TAK-242 Suppresses Ovarian and Breast Cancer Cells Invasion through the Inhibition of Extracellular Matrix Degradation and Epithelial-Mesenchymal Transition. Eur. J. Pharmacol. 2019, 853, 256– 263, DOI: 10.1016/j.ejphar.2019.03.046[Crossref], [PubMed], [CAS], Google Scholar194https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXms1Onu7Y%253D&md5=0ffd4dafc61d3b3916f38f4f59281176TLR4 blockade using TAK-242 suppresses ovarian and breast cancer cells invasion through the inhibition of extracellular matrix degradation and epithelial-mesenchymal transitionZandi, Zahra; Kashani, Bahareh; Poursani, Ensieh M.; Bashash, Davood; Kabuli, Majid; Momeny, Majid; Mousavi-pak, Seyedeh H.; Sheikhsaran, Fatemeh; Alimoghaddam, Kamran; Mousavi, Seyed A.; Ghaffari, Seyed H.European Journal of Pharmacology (2019), 853 (), 256-263CODEN: EJPHAZ; ISSN:0014-2999. (Elsevier B.V.)Numerous links exist between inflammation and tumor development. Toll-like receptor 4 (TLR4) expression by tumor cells can be a contributing factor that promotes tumor cell proliferation, survival, migration, and metastasis. In this study, we explored the impact of TLR4 inhibition using TAK-242, a specific inhibitor of TLR4, on the invasion properties of ovarian (A2780CP, 2008C13, SKOV3, and A2780S) and breast (MCF7, SKBR3, MDA-MB-231, and BT-474) cancer cell lines. Six out of eight cell lines expressed TLR4 and its downstream mediators (MyD88, NF-kB1, and RELB), indicating that these cell lines could be proper candidates for the TLR4 inhibition. TAK-242 induced a cytotoxic effect on all tested cell lines; however, a different cell sensitivity pattern was noticeable. Interestingly, in the TLR4-expressing cell lines, there was a significant correlation between the TLR4/MyD88 expressions and the cancer cell response to TAK-242: the higher the expression, the higher the IC50. To the best of our knowledge, no study has addressed the effects of TAK-242 on invasive abilities of cancer cells and our study suggests for the first time that TAK-242 could considerably decrease invasion properties of ovarian and breast cancer cell lines. We found that not only did TAK-242 reduce the enzymic activity of MMP2 and MMP9, but also down-regulated gene expressions of epithelial-mesenchymal transition (EMT)-related genes. In sum, it seems that targeting TLR4 using TAK-242 possesses novel promising potential in cancer treatment strategies and may prevent invasion in patients suffering from ovarian and breast cancers, esp. in those with over-expression of TLR4.
- 195Kashani, B.; Zandi, Z.; Karimzadeh, M. R.; Bashash, D.; Nasrollahzadeh, A.; Ghaffari, S. H. Blockade of TLR4 Using TAK-242 (Resatorvid) Enhances Anti-Cancer Effects of Chemotherapeutic Agents: A Novel Synergistic Approach for Breast and Ovarian Cancers. Immunol. Res. 2019, 67 (6), 505– 516, DOI: 10.1007/s12026-019-09113-8[Crossref], [PubMed], [CAS], Google Scholar195https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXlt1CqtL0%253D&md5=d7e6c23f754d23b88d622c6cf6533cc8Blockade of TLR4 using TAK-242 (resatorvid) enhances anti-cancer effects of chemotherapeutic agents: a novel synergistic approach for breast and ovarian cancersKashani, Bahareh; Zandi, Zahra; Karimzadeh, Mohammad Reza; Bashash, Davood; Nasrollahzadeh, Ali; Ghaffari, Seyed H.Immunologic Research (2019), 67 (6), 505-516CODEN: IMRSEB; ISSN:0257-277X. (Springer)Abstr.: It is believed that pathways of the immune system are responsible for eradicating cancer cells; however, their over-activation and also their ectopic expression in tumor cells and microenvironment are major contributors to tumor growth and chemoresistance. Toll-like receptor 4 (TLR4) pathway is an innate immune-related pathway which is usually overexpressed in tumor cells that leads to excessive pro-inflammatory cytokines and eventually results in tumor survival, drug resistance, and metastasis. In this study, we investigated whether TLR4 expression is affected upon the treatment of breast and ovarian cancer cells with common chemotherapeutics (paclitaxel, cisplatin, doxorubicin, and arsenic trioxide) and if TLR4 inhibition using its specific inhibitor TAK-242 could enhance cancer cells' response to the drugs. Both breast (MCF7) and ovarian (2008C13) cancer cells experienced an elevated expression of TLR4 after treatment with the drugs. The expression of this receptor was also upregulated in cisplatin-resistant 2008C13 cells; however, it was significantly higher upon short-term treatment with cisplatin. More importantly, the combination treatment of the drugs with TAK-242 intensified the chemosensitivity of six different breast and ovarian cancer cells to chemotherapeutic drugs. It was also identified that co-treatment of paclitaxel and TAK-242 not only led to enhanced G2/M arrest and apoptosis but also satisfactorily decreased the expression of TLR4 and different interleukins in these cells. Taken together, the results of the present study emphasize that chemotherapy may lead to chemoresistance through inducing TLR4 expression, and therefore inhibiting this receptor using TAK-242 could be a promising approach to improve the outcome of chemotherapy in foreseeable future.
- 196Kashani, B.; Zandi, Z.; Bashash, D.; Zaghal, A.; Momeny, M.; Poursani, E. M.; Pourbagheri-Sigaroodi, A.; Mousavi, S. A.; Ghaffari, S. H. Small Molecule Inhibitor of TLR4 Inhibits Ovarian Cancer Cell Proliferation: New Insight into the Anticancer Effect of TAK-242 (Resatorvid). Cancer Chemother. Pharmacol. 2020, 85 (1), 47– 59, DOI: 10.1007/s00280-019-03988-y[Crossref], [PubMed], [CAS], Google Scholar196https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXisVGhurvN&md5=c2796c6b52840c3ae9e8e3ab9e59473dSmall molecule inhibitor of TLR4 inhibits ovarian cancer cell proliferation: new insight into the anticancer effect of TAK-242 (Resatorvid)Kashani, Bahareh; Zandi, Zahra; Bashash, Davood; Zaghal, Azam; Momeny, Majid; Poursani, Ensieh M.; Pourbagheri-Sigaroodi, Atieh; Mousavi, Seyed A.; Ghaffari, Seyed H.Cancer Chemotherapy and Pharmacology (2020), 85 (1), 47-59CODEN: CCPHDZ; ISSN:0344-5704. (Springer)Background: Despite all advances in the treatment of ovarian cancer (OC), it remains the most lethal gynecol. malignancy worldwide. Therefore, Toll-like receptor 4 (TLR4), a mediator of inflammation in cancer cells, may be a proper anticancer target. Methods: The effects of TLR4 activation by LPS was studied using MTT, colony formation, staining, scratch, and qRT-PCR assays as the first step. Then the same assays, in addn. to anoikis resistance, cell cycle and annexin V/PI apoptosis tests, were used to investigate whether the inhibition of TLR4 using a small mol. inhibitor, TAK-242, could suppress the proliferation of various OC cell lines: A2780CP, 2008C13, SKOV3, and A2780S. Results: The activation of TLR4 using LPS showed enhanced proliferation and invasion in the TLR4-expressing cell line (SKOV3). Next, treatment with the inhibitor revealed that TAK-242 suppressed the inflammatory condition of ovarian cancer cells, as evident by the down-regulation of IL-6 gene expression. We also found that TAK-242 halted cancer cell proliferation by inducing cell cycle arrest and apoptosis through the modulation of genes involved in these processes. Overexpression of TLR4 contributes to drug resistance, it was tempting to investigate the effect of TAK-242 in a combined-modality strategy. Conclusion: TAK-242 serves as an appealing therapeutic strategy in the TLR4-expressing OC cells, either in the context of monotherapy or in combination with a chemotherapeutic drug.
- 197Premkumar, V.; Dey, M.; Dorn, R.; Raskin, I. MyD88-Dependent and Independent Pathways of Toll-Like Receptors Are Engaged in Biological Activity of Triptolide in Ligand-Stimulated Macrophages. BMC Chem. Biol. 2010, 10, 3, DOI: 10.1186/1472-6769-10-3[Crossref], [PubMed], [CAS], Google Scholar197https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC3czksVymug%253D%253D&md5=4a21fa2416aedfab5b281af25b31d659MyD88-dependent and independent pathways of Toll-Like Receptors are engaged in biological activity of Triptolide in ligand-stimulated macrophagesPremkumar Vummidigiridhar; Dey Moul; Dorn Ruth; Raskin IlyaBMC chemical biology (2010), 10 (), 3 ISSN:.BACKGROUND: Triptolide is a diterpene triepoxide from the Chinese medicinal plant Tripterygium wilfordii Hook F., with known anti-inflammatory, immunosuppressive and anti-cancer properties. RESULTS: Here we report the expression profile of immune signaling genes modulated by triptolide in LPS induced mouse macrophages. In an array study triptolide treatment modulated expression of 22.5% of one hundred and ninety five immune signaling genes that included Toll-like receptors (TLRs). TLRs elicit immune responses through their coupling with intracellular adaptor molecules, MyD88 and TRIF. Although it is known that triptolide inhibits NFkappaB activation and other signaling pathways downstream of TLRs, involvement of TLR cascade in triptolide activity was not reported. In this study, we show that triptolide suppresses expression of proinflammatory downstream effectors induced specifically by different TLR agonists. Also, the suppressive effect of triptolide on TLR-induced NFkappaB activation was observed when either MyD88 or TRIF was knocked out, confirming that both MyD88 and TRIF mediated NFkappaB activation may be inhibited by triptolide. Within the TLR cascade triptolide downregulates TLR4 and TRIF proteins. CONCLUSIONS: This study reveals involvement of TLR signaling in triptolide activity and further increases understanding of how triptolide activity may downregulate NFkappaB activation during inflammatory conditions.
- 198Ma, J. X.; Sun, Y. L.; Yu, Y.; Zhang, J.; Wu, H. Y.; Yu, X. F. Triptolide Enhances the Sensitivity of Pancreatic Cancer PANC-1 Cells to Gemcitabine by Inhibiting TLR4/NF-KB Signaling. Am. J. Transl. Res. 2019, 11 (6), 3750– 3760[PubMed], [CAS], Google Scholar198https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXktF2mtL4%253D&md5=965b664622a41414f31735bca66d19ccTriptolide enhances the sensitivity of pancreatic cancer PANC-1 cells to gemcitabine by inhibiting TLR4/NF-κB signalingMa, Jian-Xia; Sun, Yun-Liang; Yu, Yang; Zhang, Jian; Wu, Hong-Yu; Yu, Xiao-FengAmerican Journal of Translational Research (2019), 11 (6), 3750-3760CODEN: AJTRA7; ISSN:1943-8141. (e-Century Publishing Corp.)Background: This study aimed to investigate roles of Toll-like receptor 4 (TLR4)/nuclear factor (NF)-κB signaling in triptolide (TPL)-induced sensitivity of pancreatic cancer cells to gemcitabine (GEM). Methods: In vitro, pancreatic cancer PANC-1 cells were treated with lipopolysaccharide (LPS) to activate TLR4, TLR4-siRNA, GEM alone, or GEM plus TPL. In vivo, nude mice bearing PANC-1 cell xenografts were treated with GEM, TPL, or both. Cell proliferation was detected by MTT assay and Ki-67 staining. Apoptosis was assessed by flow cytometry and TUNEL assay. A double luciferase reporter gene was used to detect NF-κB activity. Results: The sensitivity of PANC-1 cells to GEM was reduced by LPS but enhanced by TLR4-siRNA. TPL inhibited expression of TLR4/NF-κB signaling components, which was reversed by LPS. The TPL+GEM group showed more apoptosis than the LPS+TPL+GEM group. Moreover, the activity of NF-κB and the expression of TLR4, p-p65 Survivin, CyclinD1 and Bcl-2 in the TPL+GEM group were lower than in the LPS+TPL+GEM group, whereas Bax expression was higher. The vol. of transplanted tumors in the TPL+GEM group was lower than that in the TPL or GEM group. Phospho-p65, Survivin, CyclinD1 and Bcl-2 expression in transplanted tumors was lower in TPL+GEM group than in either single drug group. The Ki-67 staining score of the TPL+GEM group was lower and tumor cells apoptosis rate was increased when compared with TPL or GEM alone. Conclusions: TPL enhances the sensitivity of pancreatic cancer PANC-1 cells to GEM by inhibiting TLR4/NF-κB signaling.
- 199Zhou, J.; Liu, Q.; Qian, R.; Liu, S.; Hu, W.; Liu, Z. Paeonol Antagonizes Oncogenesis of Osteosarcoma by Inhibiting the Function of TLR4/MAPK/NF-KB Pathway. Acta Histochem. 2020, 122 (1), 151455, DOI: 10.1016/j.acthis.2019.151455[Crossref], [PubMed], [CAS], Google Scholar199https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhvFSntrbE&md5=4694eab7e9e4427bce6f14f571080fdcPaeonol antagonizes oncogenesis of osteosarcoma by inhibiting the function of TLR4/MAPK/NF-κB pathwayZhou, Jianguo; Liu, Qinglin; Qian, Rui; Liu, Shiwei; Hu, Weiquan; Liu, ZhenyuActa Histochemica (2020), 122 (1), 151455CODEN: AHISA9; ISSN:0065-1281. (Elsevier GmbH)As the the major functional component of Paeonia suffruticosa, paeonol (PAE) has shown its potential to inhibit the progression of multiple cancer types. In the current study, the mechanism driving the effect of PAE on osteosarcoma (OS) was investigated by focusing on its influence on TLR4-mediated MAPK/NF-κB pathway. Human OS cells were firstly administrated with PAE of different concns. to assess its effect on the proliferation, apoptosis, metastasis, and TLR4/MAPK/NF-κB pathway in OS cells. Thereafter, the level of TLR4 was induced in OS cells before PAE administration to explore the role of the mol. in the anti-OS function of PAE. The results of in vitro assays were further validated with xenograft mice models. The administration of PAE of two doses both suppressed the proliferation and induced apoptosis in OS cells in a dose-dependent manner. Regarding the effect on the metastasis potential of OS cells, PAE inhibited the migration and invasion potential of the cells, but the effect did not change with concns. The administration of PAE also inhibited the expression of TLR4 and deactivated MAPK/NF-κB pathway. Moreover, the induced expression of TLR4 counteracted the anti-OS function of PAE. Further validation with xenograft models also showed that PAE inhibited solid tumor growth and TLR4 expression in OS mice. In conclusion, it was inferred that the anti-OS function of PAE depended on the inhibition of TLR4 and its downstream MAPK/NF-κB pathway.
- 200Wu, H. C.; Ge, H. M.; Zang, L. Y.; Bei, Y. C.; Niu, Z. Y.; Wei, W.; Feng, X. J.; Ding, S.; Ng, S. W.; Shen, P. P.; Tan, R. X. Diaporine, a Novel Endophyte-Derived Regulator of Macrophage Differentiation. Org. Biomol. Chem. 2014, 12 (34), 6545– 6548, DOI: 10.1039/C4OB01123F[Crossref], [PubMed], [CAS], Google Scholar200https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXhtFOnsrvN&md5=dd6aa6dad6fbe332e6d380f3fa76281cDiaporine, a novel endophyte-derived regulator of macrophage differentiationWu, Hao Chen; Ge, Hui Ming; Zang, Le Yun; Bei, Yun Cheng; Niu, Zhi Yuan; Wei, Wei; Feng, Xiu Jing; Ding, Sen; Ng, Seik Weng; Shen, Ping Ping; Tan, Ren XiangOrganic & Biomolecular Chemistry (2014), 12 (34), 6545-6548CODEN: OBCRAK; ISSN:1477-0520. (Royal Society of Chemistry)Diaporine (I), an unprecedented sym. polyketide, was characterized from an endophytic fungus. The structure of I was detd. by extensive spectroscopic analyses. I can inhibit significantly the differentiation of macrophages and has potential to induce conversion from the M2 to the M1 phenotype, in addn. to regulation of the TLR4-MAPK signal pathway and PPARγ activity.
- 201Zhuang, H.; Dai, X.; Zhang, X.; Mao, Z.; Huang, H. Sophoridine Suppresses Macrophage-Mediated Immunosuppression through TLR4/IRF3 Pathway and Subsequently Upregulates CD8+ T Cytotoxic Function against Gastric Cancer. Biomed. Pharmacother. 2020, 121, 109636, DOI: 10.1016/j.biopha.2019.109636[Crossref], [PubMed], [CAS], Google Scholar201https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXitFKitrfP&md5=0e06331e567ac23700456fd1d17ac5c5Sophoridine suppresses macrophage-mediated immunosuppression through TLR4/IRF3 pathway and subsequently upregulates CD8+ T cytotoxic function against gastric cancerZhuang, Haiwen; Dai, Xudong; Zhang, Xiaoyu; Mao, Zhongqi; Huang, HaijinBiomedicine & Pharmacotherapy (2020), 121 (), 109636CODEN: BIPHEX; ISSN:0753-3322. (Elsevier Masson SAS)Gastric cancer is one of the most common and deadly neoplasms with limited effective treatments. The emergence of the immunotherapy has brought great expectations for cancer patients. Sophoridine is extd. from the seeds of sophora alopecuroides and has various pharmacol. actions including anti-tumor, anti-inflammatory, anti- arrhythmia and anti-virus. However, the effect of Sophoridine on gastric cancer microenvironment immunity and its underling mechanism remains poorly known. This study was aimed to investigate the effect of Sophoridine on the polarization status of gastric tumor-assocd. macrophages (TAMs) and its underlying mechanism. We isolated primary bone marrow-derived macrophages (BMDMs) and primary CD8+ T cells to perform coculture assay. Sophoridine educated TAMs polarize to M1-TAMs and suppressed M2-TAMs polarization through TLR4/IRF3 axis. Sophoridine-treated TAMs exhibited stronger pro-inflammatory function through upregulation the expression of INOS, IFN-β and IL-12α, and downregulation the expression of Arg-1, CD206 and IL-10. Sophoridine -primed TAMs increased the proliferation and cytotoxic function of CD8+ T by upregulating the expression of Granzyme-B, TNF-α and Perforin, and downregulated the expression of CD8+ T cells function exhaustion markers PD-1, Tim-3 and Lag-3. Furthermore, Sophoridine inhibited the migration ability of macrophage by decrease the CCR2 expression. Thus, Sophoridine acted on macrophages and CD8+ T cells to reshape gastric cancer immune microenvironment. Our studies provided preclin. basis for clin. application of Sophoridine.
- 202Xie, X.; Ma, L.; Zhou, Y.; Shen, W.; Xu, D.; Dou, J.; Shen, B.; Zhou, C. Polysaccharide Enhanced NK Cell Cytotoxicity against Pancreatic Cancer via TLR4/MAPKs/NF-KB Pathway in Vitro/Vivo. Carbohydr. Polym. 2019, 225, 115223, DOI: 10.1016/j.carbpol.2019.115223[Crossref], [PubMed], [CAS], Google Scholar202https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhs1Kku7vJ&md5=a55edb8b29bd2c1a12b87654c157b94aPolysaccharide enhanced NK cell cytotoxicity against pancreatic cancer via TLR4/MAPKs/NF-κB pathway in vitro/vivoXie, Xin; Ma, Lingman; Zhou, Yiran; Shen, Wen; Xu, Duiyue; Dou, Jie; Shen, Baiyong; Zhou, ChanglinCarbohydrate Polymers (2019), 225 (), 115223CODEN: CAPOD8; ISSN:0144-8617. (Elsevier Ltd.)A polysaccharide isolated from Strongylocentrotus nudus eggs (SEP) reportedly displays immune activity in vivo. Here, its effect and underlying mechanism in the treatment of pancreatic cancer were investigated. SEP obviously inhibited pancreatic cancer growth by activating NK cells in vitro/vivo via TLR4/MAPKs/NF-κB signaling pathway, The tumor inhibitory rate achieved to 44.5% and 50.8% at a dose of 40 mg/kg in Bxpc-3 and SW1990 nude mice, resp. Moreover, SEP obviously augmented the Gemcitabine (GEM) antitumor effect by upregulating NKG2D, which improved the sensitivity of NK cells targeting to its ligand MICA; meanwhile, the antitumor inhibitory rate was 68.6% in BxPC-3 tumor-bearing mice. Moreover, SEP reversed GEM-induced apoptosis and atrophy in both spleen and bone marrow via suppressing ROS secretion in vivo. These results suggested that pancreatic cancer was effectively inhibited by SEP-enhanced NK cytotoxicity mediated primarily through TLR4/MAPKs/NF-κB signaling pathway, representing a potential immunotherapy candidate for the treatment of pancreatic cancer.
- 203Xia, Y.; Wang, M.; Demaria, O.; Tang, J.; Rocchi, P.; Qu, F.; Iovanna, J. L.; Alexopoulou, L.; Peng, L. A Novel Bitriazolyl Acyclonucleoside Endowed with Dual Antiproliferative and Immunomodulatory Activity. J. Med. Chem. 2012, 55 (11), 5642– 5646, DOI: 10.1021/jm300534u[ACS Full Text], [CAS], Google Scholar203https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC38XmvV2msbs%253D&md5=3157b3784449b8a713076a48e114e639A Novel Bitriazolyl Acyclonucleoside Endowed with Dual Antiproliferative and Immunomodulatory ActivityXia, Yi; Wang, Menghua; Demaria, Olivier; Tang, Jingjie; Rocchi, Palma; Qu, Fanqi; Iovanna, Juan L.; Alexopoulou, Lena; Peng, LingJournal of Medicinal Chemistry (2012), 55 (11), 5642-5646CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)A novel bitriazolyl acyclonucleoside I was discovered to exhibit powerful antiproliferative effects on different cancer cell lines through caspase-dependent apoptosis and at the same time stimulate the immune response in dendritic cells via Toll-like receptor 7 (TLR7) signaling. This promising compd. with dual anticancer and immunomodulatory activity may represent a new generation of highly efficacious drug candidates for use in cancer therapy.
- 204Zhang, L.; Shi, L.; Soars, S. M.; Kamps, J.; Yin, H. Discovery of Novel Small-Molecule Inhibitors of NF-KB Signaling with Antiinflammatory and Anticancer Properties. J. Med. Chem. 2018, 61 (14), 5881– 5899, DOI: 10.1021/acs.jmedchem.7b01557[ACS Full Text], [CAS], Google Scholar204https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhtVOmsLvK&md5=302513488d34faabe2ff128ac2c4c44cDiscovery of Novel Small-Molecule Inhibitors of NF-κB Signaling with Antiinflammatory and Anticancer PropertiesZhang, Lei; Shi, Lei; Soars, Shafer Myers; Kamps, Joshua; Yin, HangJournal of Medicinal Chemistry (2018), 61 (14), 5881-5899CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)Excessive NF-κB activation contributes to the pathogenesis of numerous diseases. Small-mol. inhibitors of NF-κB signaling have significant therapeutic potential esp. in treating inflammatory diseases and cancers. In this study, we performed a cell-based high-throughput screening to discover novel agents capable of inhibiting NF-κB signaling. On the basis of two hit scaffolds from the screening, we synthesized 69 derivs. to optimize the potency for inhibition of NF-κB activation, leading to successful discovery of the most potent compd. Z9j with over 170-fold enhancement of inhibitory activity. Preliminary mechanistic studies revealed that Z9j inhibited NF-κB signaling via suppression of Src/Syk, PI3K/Akt, and IKK/IκB pathways. This novel compd. also demonstrated antiinflammatory and anticancer activities, warranting its further development as a potential multifunctional agent to treat inflammatory diseases and cancers.
- 205Krieg, A. M. Toll-like Receptor 9 (TLR9) Agonists in the Treatment of Cancer. Oncogene 2008, 27 (2), 161– 167, DOI: 10.1038/sj.onc.1210911[Crossref], [PubMed], [CAS], Google Scholar205https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1cXitl2hsg%253D%253D&md5=d192b643f161616a6b982b8b5043cd4eToll-like receptor 9 (TLR9) agonists in the treatment of cancerKrieg, A. M.Oncogene (2008), 27 (2), 161-167CODEN: ONCNES; ISSN:0950-9232. (Nature Publishing Group)A review. Although still early in clin. development, agonists of Toll-like receptor 9 (TLR9) have demonstrated potential for the treatment of cancer. TLR9 agonists directly induce activation and maturation of plasmacytoid dendritic cells and enhance differentiation of B cells into antibody-secreting plasma cells. Preclin. and early clin. data support the use of TLR9 agonists in patients with solid tumors and hematol. malignancies. In preclin. studies, TLR9 agonists have shown activity not only as monotherapy, but also in combination with multiple other therapies, including vaccines, antibodies, cellular therapies, other immunotherapies, antiangiogenic agents, radiotherapy, cryotherapy and some chemotherapies. Phase I and II clin. trials have indicated that these agents have antitumor activity as single agents and enhance the development of antitumor T-cell responses when used as therapeutic vaccine adjuvants. The activity and safety of these novel anticancer agents are being explored in a wide range of tumor types as part of a variety of therapeutic strategies with the goal of harnessing the immune response to fight cancer.
- 206Lim, K.-H. TLR9. Cancer Ther. Targets 2017, 1–2, 495– 502, DOI: 10.1007/978-1-4419-0717-2_70
- 207Cho, H. C.; Kim, B. H.; Kim, K.; Park, J. Y.; Chang, J. H.; Kim, S. K. Cancer Immunotherapeutic Effects of Novel CpG ODN in Murine Tumor Model. Int. Immunopharmacol. 2008, 8 (10), 1401– 1407, DOI: 10.1016/j.intimp.2008.05.010[Crossref], [PubMed], [CAS], Google Scholar207https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1cXps1Ggsrk%253D&md5=10d5b7291eb9dda151cf70a58535d0bfCancer immunotherapeutic effects of novel CpG ODN in murine tumor modelCho, Hyeon Cheol; Kim, Bo Hwan; Kim, Kyunghoon; Park, Ju Youn; Chang, Jae-Ho; Kim, Soo-KiInternational Immunopharmacology (2008), 8 (10), 1401-1407CODEN: IINMBA; ISSN:1567-5769. (Elsevier B.V.)While CpG oligodeoxynucleotides (ODN) are excellent candidates for cancer immunotherapeutics, the nos. of usable CpG ODNs are limited in current clin. settings. To resolve this, we investigated whether novel CpG ODN (KSK-CpG) would be an effective immunotherapeutic in a murine tumor model by affecting in vivo and in vitro parameters, such as survival span, the no. of tumor nodules, natural killer (NK) cell and cytotoxic T lymphocyte (CTL) activity and interleukin (IL)-6 or IL-12 cytokine release in splenocytes. We found that KSK-CpG was effective in the murine cancer model by way of prolonging survival span, reducing the no. of tumor nodules, augmenting NK cell and CTL cytotoxicity, as well as evoking IL-6 and IL-12 cytokine release in splenocytes. Collectively, these data demonstrate that KSK-CpG is active against the highly malignant B16BL6 and EL4 tumor mouse model via innate immune augmentation.
- 208Qi, X. F.; Zheng, L.; Kim, C. S.; Lee, K. J.; Kim, D. H.; Cai, D. Q.; Qin, J. W.; Yu, Y. H.; Wu, Z.; Kim, S. K. CpG Oligodeoxynucleotide Induces Apoptosis and Cell Cycle Arrest in A20 Lymphoma Cells via TLR9-Mediated Pathways. Mol. Immunol. 2013, 54 (3–4), 327– 337, DOI: 10.1016/j.molimm.2013.01.001[Crossref], [PubMed], [CAS], Google Scholar208https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXjvFahs7c%253D&md5=727549908743f4102fe36fee44829afeCpG oligodeoxynucleotide induces apoptosis and cell cycle arrest in A20 lymphoma cells via TLR9-mediated pathwaysQi, Xu-Feng; Zheng, Li; Kim, Cheol-Su; Lee, Kyu-Jae; Kim, Dong-Heui; Cai, Dong-Qing; Qin, Jun-Wen; Yu, Yan-Hong; Wu, Zheng; Kim, Soo-KiMolecular Immunology (2013), 54 (3-4), 327-337CODEN: MOIMD5; ISSN:0161-5890. (Elsevier)Recent studies have suggested that the anti-cancer activity of CpG-oligodeoxynucleotides (CpG-ODNs) is owing to their immunomodulatory effects in tumor-bearing host. The purpose of this study is to investigate the directly cytotoxic activity of KSK-CpG, a novel CpG-ODN with an alternative CpG motif, against A20 and EL4 lymphoma cells in comparison with previously used murine CpG motif (1826-CpG). To evaluate the potential cytotoxic effects of KSK-CpG on lymphoma cells, cell viability assay, confocal microscopy, flow cytometry, DNA fragmentation, Western blotting, and reverse transcription-polymerase chain reaction (RT-PCR) anal. were used. We found that KSK-CpG induced direct cytotoxicity in A20 lymphoma cells, but not in EL4 lymphoma cells, at least in part via TLR9-mediated pathways. Apoptotic cell death was demonstrated to play an important role in CpG-ODNs-induced cytotoxicity. In addn., both mitochondrial membrane potential decrease and G1-phase arrest were involved in KSK-CpG-induced apoptosis in A20 cells. The activities of apoptotic mols. such as caspase-3, PARP, and Bax were increased, but the activation of p27 Kip1 and ERK were decreased in KSK-CpG-treated A20 cells. Furthermore, autocrine IFN-γ partially contributed to apoptotic cell death in KSK-CpG-treated A20 cells. Collectively, our findings suggest that KSK-CpG induces apoptotic cell death in A20 lymphoma cells at least in part by inducing G1-phase arrest and autocrine IFN-γ via increasing TLR9 expression, without the need for immune system of tumor-bearing host. This new understanding supports the development of TLR9-targeted therapy with CpG-ODN as a direct therapeutic agent for treating B lymphoma.
- 209Zhang, Y.; Lin, A.; Zhang, C.; Tian, Z.; Zhang, J. Phosphorothioate-Modified CpG Oligodeoxynucleotide (CpG ODN) Induces Apoptosis of Human Hepatocellular Carcinoma Cells Independent of TLR9. Cancer Immunol. Immunother. 2014, 63 (4), 357– 367, DOI: 10.1007/s00262-014-1518-y[Crossref], [PubMed], [CAS], Google Scholar209https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXhsFCltbc%253D&md5=68a40c2862354a9b7dfd3d74c6c8f538Phosphorothioate-modified CpG oligodeoxynucleotide (CpG ODN) induces apoptosis of human hepatocellular carcinoma cells independent of TLR9Zhang, Yuyi; Lin, Ang; Zhang, Cai; Tian, Zhigang; Zhang, JianCancer Immunology Immunotherapy (2014), 63 (4), 357-367CODEN: CIIMDN; ISSN:0340-7004. (Springer)Toll-like receptors (TLRs) expressed on cancer cells are closely assocd. with tumor development. In this study, we investigated the biol. functions of the TLR9 ligand, CpG oligodeoxynucleotide (CpG ODN), on TLR9 expressed in the cytoplasm of hepatocellular carcinoma (HCC) cells. In vitro, human HCC cell lines were transfected with phosphorothioate-modified oligodeoxynucleotides TLR9 agonist OND M362 and its neg. control ODN M362 ctrl, which inhibited the proliferation of HCC cells by inducing apoptosis without altering the cell cycle. Interestingly, ODN M362 and ODN M362 Ctrl displayed a similar proapoptotic effect on HCC, possibly related to phosphorothioate modification of the structure of CpG ODN. Although both of them resulted in the upregulation of the TLR9 receptor, their effect on HCC apoptosis was independent of TLR9. They also upregulated inflammatory cytokines, but did not activate the NF-κB signaling pathway. Finally, the activities of ODN M362 and ODN M362 Ctrl were demonstrated in nude mice inoculated with HCC cells. These findings suggest that the phosphorothioate-modified TLR9 agonist ODN M362, and its control, elicit antitumor activity in HCC cells and may serve as a novel therapeutic target for HCC therapy.
- 210Yang, L.; Sun, L.; Wu, X.; Wang, L.; Wei, H.; Wan, M.; Zhang, P.; Yu, Y.; Wang, L. Therapeutic Injection of C-Class CpG ODN in Draining Lymph Node Area Induces Potent Activation of Immune Cells and Rejection of Established Breast Cancer in Mice. Clin. Immunol. 2009, 131 (3), 426– 437, DOI: 10.1016/j.clim.2009.01.011[Crossref], [PubMed], [CAS], Google Scholar210https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1MXmtVKksbk%253D&md5=2b0f07cabde72bc64053713422485cd7Therapeutic injection of C-class CpG ODN in draining lymph node area induces potent activation of immune cells and rejection of established breast cancer in miceYang, Liang; Sun, Luguo; Wu, Xiuli; Wang, Li; Wei, Hongfei; Wan, Min; Zhang, Peiyin; Yu, Yongli; Wang, LiyingClinical Immunology (Amsterdam, Netherlands) (2009), 131 (3), 426-437CODEN: CLIIFY; ISSN:1521-6616. (Elsevier B.V.)To develop novel CpG ODNs for the treatment of breast cancer, the authors have designed a series of CpG ODNs and evaluated their anti-tumor activity in a breast cancer mouse model. Interestingly, a C-class CpG ODN, designated as YW002, showed a vigorous activity on the inhibition of tumor growth in mice and completely cured some of the tumor-bearing mice through injection at tumor draining lymph node (TDLN) area. The expansion of immune cells in the TDLN and tumor and the generation of tumor specific immune memory were found assocd. with YW002-induced anti-tumor activity in mice. These results indicate that C-class CpG ODN could be developed into a medicament in a monotherapeutic regimen for the treatment of breast cancer through injection at TDLN area in clinic.
- 211Yang, M.; Yan, Y.; Fang, M.; Wan, M.; Wu, X.; Zhang, X.; Zhao, T.; Wei, H.; Song, D.; Wang, L.; Yu, Y. MF59 Formulated with CpG ODN as a Potent Adjuvant of Recombinant HSP65-MUC1 for Inducing Anti-MUC1 + Tumor Immunity in Mice. Int. Immunopharmacol. 2012, 13 (4), 408– 416, DOI: 10.1016/j.intimp.2012.05.003[Crossref], [PubMed], [CAS], Google Scholar211https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC38XpsV2ktLg%253D&md5=9c628366b2ff0b2d1bf01c6e551b2399MF59 formulated with CpG ODN as a potent adjuvant of recombinant HSP65-MUC1 for inducing anti-MUC1+ tumor immunity in miceYang, Ming; Yan, Youyou; Fang, Mingli; Wan, Min; Wu, Xiuli; Zhang, Xiaoling; Zhao, Tiesuo; Wei, Hongfei; Song, Dandan; Wang, Liying; Yu, YongliInternational Immunopharmacology (2012), 13 (4), 408-416CODEN: IINMBA; ISSN:1567-5769. (Elsevier B.V.)MF59 is an oil-in-water emulsion adjuvant approved for influenza vaccines for human use in Europe. Due to its Th2 inducing properties, MF59 is seldom tested for cancer vaccines. In this study, MF59 formulated with a C-type CpG oligodeoxynucleotide (YW002) was tested for its Th1 adjuvant activity to induce immune responses to HSP65-MUC1, a recombinant fusion protein incorporating a mycobacterial heat shock protein (HSP65) and mucin 1, cell surface assocd. (MUC1) derived peptide. Combination of YW002 with MF59 (MF59-YW002) could confer a potent Th1 biasing property to the adjuvant, which enhanced the immunogenicity of HSP65-MUC1 to induce significantly higher levels of specific IgG2c, increased IFN-γ mRNA expression in splenocytes and the generation of antigen-specific cytotoxic T lymphocytes in mice. When prophylactically applied, MF59-YW002 adjuvant contg. HSP65-MUC1 inhibited the growth of MUC1+ B16 melanoma and prolonged the survival of tumor-bearing mice. In contrast, adjuvant contg. MF59 with HSP65-MUC1 in the absence of YW002, promoted the growth of MUC1+ B16 melanoma in mice. These results suggest that MF59 plus CpG oligodeoxynucleotide might be developed as an efficient adjuvant for tumor vaccines against melanoma, and possibly other tumors.
- 212Jordan, M.; Waxman, D. J. CpG-1826 Immunotherapy Potentiates Chemotherapeutic and Anti-Tumor Immune Responses to Metronomic Cyclophosphamide in a Preclinical Glioma Model. Cancer Lett. 2016, 373 (1), 88– 96, DOI: 10.1016/j.canlet.2015.11.029[Crossref], [PubMed], [CAS], Google Scholar212https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXhvFOqtrzE&md5=d3c11200f7abccf7edaec363ed9ad61eCpG-1826 immunotherapy potentiates chemotherapeutic and anti-tumor immune responses to metronomic cyclophosphamide in a preclinical glioma modelJordan, Marie; Waxman, David J.Cancer Letters (New York, NY, United States) (2016), 373 (1), 88-96CODEN: CALEDQ; ISSN:0304-3835. (Elsevier)Cyclophosphamide administered on an intermittent metronomic schedule induces strong immune-dependent regression in several glioma models. Here we investigate whether this immunogenic chemotherapy can be potentiated by combination with the immune stimulatory TLR9 agonist CpG-1826. CpG-1826 treatment of GL261 gliomas implanted in immune competent mice induced tumor growth delay assocd. with increased tumor recruitment of macrophages and B cells. Anti-tumor responses varied between individuals, with CpG-1826 inducing robust tumor growth delay in ∼50% of treated mice. Both high and low CpG-1826-responsive mice showed striking improvements when CpG-1826 was combined with cyclophosphamide treatment. Tumor-assocd. macrophages, B cells, dendritic cells, and cytotoxic T cells were increased, T regulatory cells were not induced, and long-term GL261 glioma regression with immune memory was achieved when CpG-1826 was combined with either single cyclophosphamide dosing (90 mg/kg) or metronomic cyclophosphamide treatment (two cycles at 45 mg/kg, spaced 12-days apart). B16F10 melanoma, a low immunogenic tumor model, also showed enhanced immune and anti-tumor responses to cyclophosphamide/CpG-1826 chemoimmunotherapy, but unlike GL261 tumors, did not regress. TLR9-based immunotherapy can thus be effectively combined with immunogenic cyclophosphamide treatment to enhance immune-based anti-tumor responses, even in poorly immunogenic cancer models.
- 213Xu, A.; Zhang, L.; Yuan, J.; Babikr, F.; Freywald, A.; Chibbar, R.; Moser, M.; Zhang, W.; Zhang, B.; Fu, Z.; Xiang, J. TLR9 Agonist Enhances Radiofrequency Ablation-Induced CTL Responses, Leading to the Potent Inhibition of Primary Tumor Growth and Lung Metastasis. Cell. Mol. Immunol. 2019, 16 (10), 820– 832, DOI: 10.1038/s41423-018-0184-y[Crossref], [PubMed], [CAS], Google Scholar213https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhsVOgtrvF&md5=891ae89dd6f7c7f9f78a99f3ef1e9c71TLR9 agonist enhances radiofrequency ablation-induced CTL responses, leading to the potent inhibition of primary tumor growth and lung metastasisXu, Aizhang; Zhang, Lifeng; Yuan, Jingying; Babikr, Fatma; Freywald, Andrew; Chibbar, Rajni; Moser, Michael; Zhang, Wenjun; Zhang, Bing; Fu, Zhaoying; Xiang, JimCellular & Molecular Immunology (2019), 16 (10), 820-832CODEN: CMIEAO; ISSN:1672-7681. (Nature Research)Radiofrequency ablation (RFA) is the most common approach to thermal ablation for cancer therapy. Unfortunately, its efficacy is limited by incomplete ablation, and further optimization of RFA is required. Here, we demonstrate that incubation at 65°C triggers more EG7 tumor cell death by necrosis than treatment at 45°C, and the 65°C-treated cells are more effective at inducing antigen-specific CD8+ cytotoxic T lymphocyte (CTL) responses after injection in mice than the 45°C-treated ones. Dendritic cells (DCs) that phagocytose 65°C-treated EG7 cells become mature with upregulated MHCII and CD80 expression and are capable of efficiently inducing effector CTLs in mouse tumor models. RFA (65°C) therapy of EG7 tumors induces large areas of tumor necrosis and stimulates CTL responses. This leads to complete regression of small (∼100 mm3) tumors but fails to suppress the growth of larger (∼350 mm3) tumors. The administration of the Toll-like receptor-9 (TLR9) agonist unmethylated cytosine-phosphorothioate-guanine oligonucleotide (CpG) to DCs phagocytosing 65°C-treated EG7 cells enhances the expression of MHCII and CD40 on DCs as well as DC-induced stimulation of CTL responses. Importantly, the intratumoral administration of CpG following RFA also increases the frequencies of tumor-assocd. immunogenic CD11b-CD11c+CD103+ DC2 and CD11b+F4/80+MHCII+ M1 macrophages and increases CD4+ and CD8+ T-cell tumor infiltration, leading to enhanced CD4+ T cell-dependent CTL responses and potent inhibition of primary RFA-treated or distant untreated tumor growth as well as tumor lung metastasis in mice bearing larger tumors. Overall, our data indicate that CpG administration, which enhances RFA-induced CTL responses and ultimately potentiates the inhibition of primary tumor growth and lung metastasis, is a promising strategy for improving RFA treatment, which may assist in optimizing this important cancer therapy.
- 214Babaer, D.; Amara, S.; McAdory, B. S.; Johnson, O.; Myles, E. L.; Zent, R.; Rathmell, J. C.; Tiriveedhi, V. Oligodeoxynucleotides ODN 2006 and M362 Exert Potent Adjuvant Effect through TLR-9/-6 Synergy to Exaggerate Mammaglobin-a Peptide Specific Cytotoxic CD8+T Lymphocyte Responses against Breast Cancer Cells. Cancers 2019, 11 (5), 672, DOI: 10.3390/cancers11050672[Crossref], [CAS], Google Scholar214https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXitV2mu7w%253D&md5=a612f4e388a95962dafc62303d5fc543Oligodeoxynucleotides ODN 2006 and M362 exert potent adjuvant effect through TLR-9/-6 synergy to exaggerate mammaglobin-a peptide specific cytotoxic CD8+T lymphocyte responses against breast cancer cellsBabaer, Duaa; Amara, Suneetha; McAdory, Brenda S.; Johnson, Owen; Myles, Elbert L.; Zent, Roy; Rathmell, Jeffrey C.; Tiriveedhi, VenkataswarupCancers (2019), 11 (5), 672CODEN: CANCCT; ISSN:2072-6694. (MDPI AG)Mammaglobin-A (MamA) is overexpressed in 40-80% of all human breast cancers. Recent phase I clin. trials of the MamA DNA vaccine showed encouraging safety outcomes. However, this vaccine elicited only a modest increase in MamA specific CD8+T lymphocyte (CTL) activation. As vaccine adjuvants play a crit. role in enhancing the immunotherapeutic efficiency of vaccines, we tested the potential role of three synthetic CpG oligodeoxynucleotides (ODN2216-class A ODN, ODN2006-class B ODN, and ODN M362-class C ODN) to further enhance MamA specific CTL responses. Towards this, na.ovrddot.ive CD8+T cells were obtained from healthy HLA-A2+ human donors. The HLA-A2 specific immunodominant epitope of MamA, MamA2.1 (LIYDSSLCDL), was utilized to activate na.ovrddot.ive CD8+T cells. The THP-1 (HLA-A2+) cells were used as antigen presenting cells to stimulate na.ovrddot.ive CD8+T cells along with (or without) co-treatment of various ODNs mentioned above. Activation of na.ovrddot.ive CD8+T cells with the MamA2.1 peptide along with ODNs demonstrated enhanced MamA specific CTL mediated cytotoxicity on AU565 (HLA-A+/MamA+) breast cancer cells following co-treatment with ODN2006 and M362 compared to ODN2216 or MamA2.1 peptide alone. However, no significant cytotoxicity was noted upon treatment of MamA2.1 activated CTLs on MCF7 (HLA-A+/MamA -) cells, suggesting that the activation of CTLs is specific to the MamA antigen. Functional characterization studies demonstrated specific IL-12 mediated cross-talk between TLR-6 and -9 in THP-1 cells following stimulation with ODN2006 and M362, which was crit. for the final cytotoxic activation of CD8+T lymphocytes. Based on these data, we conclude that ODN2006 and ODN M362 exerted a strong adjuvant effect through induction of the initial innate immune response through TLR9 upregulation followed by enhanced MamA specific CTL dependent adaptive immune responses. Our current data provide evidence for the application of Class-B/-C-CpG-ODNs as potential vaccine adjuvants towards enhancing the success of MamA based breast cancer vaccination.
- 215Kapp, K.; Volz, B.; Curran, M. A.; Oswald, D.; Wittig, B.; Schmidt, M. EnanDIM - a Novel Family of L-Nucleotide-Protected TLR9 Agonists for Cancer Immunotherapy. J. Immunother. Cancer 2019, 7, 5, DOI: 10.1186/s40425-018-0470-3[Crossref], [PubMed], [CAS], Google Scholar215https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB3cnpt1yjtA%253D%253D&md5=78d49bee02a7adf9a313eabf56fb4e30EnanDIM - a novel family of L-nucleotide-protected TLR9 agonists for cancer immunotherapyKapp Kerstin; Volz Barbara; Oswald Detlef; Schmidt Manuel; Curran Michael A; Wittig BurghardtJournal for immunotherapy of cancer (2019), 7 (1), 5 ISSN:.BACKGROUND: Toll-like receptor 9 agonists are potent activators of the immune system. Their clinical potential in immunotherapy against metastatic cancers is being evaluated across a number of clinical trials. TLR9 agonists are DNA-based molecules that contain several non-methylated CG-motifs for TLR9 recognition. Chemical modifications of DNA backbones are usually employed to prevent degradation by nucleases. These, however, can promote undesirable off-target effects and therapeutic restrictions. METHODS: Within the EnanDIM® family members of TLR9 agonists described here, D-deoxyribose nucleotides at the nuclease-accessible 3'-ends are replaced by nuclease-resistant L-deoxyribose nucleotides. EnanDIM® molecules with varying sequences were screened for their activation of human peripheral blood mononuclear cells based on secretion of IFN-alpha and IP-10 as well as activation of immune cells. Selected molecules were evaluated in mice in a maximum feasible dose study and for analysis of immune activation. The ability to modulate the tumor-microenvironment and anti-tumor responses after EnanDIM® administration was analyzed in syngeneic murine tumor models. RESULTS: The presence of L-deoxyribose containing nucleotides at their 3'-ends is sufficient to prevent EnanDIM® molecules from nucleolytic degradation. EnanDIM® molecules show broad immune activation targeting specific components of both the innate and adaptive immune systems. Activation was strictly dependent on the presence of CG-motifs, known to be recognized by TLR9. The absence of off-target effects may enable a wide therapeutic window. This advantageous anti-tumoral immune profile also promotes increased T cell infiltration into CT26 colon carcinoma tumors, which translates into reduced tumor growth. EnanDIM® molecules also drove regression of multiple other murine syngeneic tumors including MC38 colon carcinoma, B16 melanoma, A20 lymphoma, and EMT-6 breast cancer. In A20 and EMT-6, EnanDIM® immunotherapy cured a majority of mice and established persistent anti-tumor immune memory as evidenced by the complete immunity of these mice to subsequent tumor re-challenge. CONCLUSIONS: In summary, EnanDIM® comprise a novel family of TLR9 agonists that facilitate an efficacious activation of both innate and adaptive immunity. Their proven potential in onco-immunotherapy, as shown by cytotoxic activity, beneficial modulation of the tumor microenvironment, inhibition of tumor growth, and induction of long-lasting, tumor-specific memory, supports EnanDIM® molecules for further preclinical and clinical development.
- 216Jia, H.; Guo, J.; Wang, P.; Sun, K.; Chen, J.; Ren, W.; Wei, T.; Yang, Y.; Li, J.; Liu, X.; Li, R.; Zhong, J.; Wang, M.; Tian, Z.; Feng, Z.; Zhao, T. A Self-Designed CpG ODN Enhanced the Anti-Melanoma Effect of Pimozide. Int. Immunopharmacol. 2020, 83, 106397, DOI: 10.1016/j.intimp.2020.106397[Crossref], [PubMed], [CAS], Google Scholar216https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXls1Glsr4%253D&md5=3639d1766249901088e4d5ce2c5e857cA self-designed CpG ODN enhanced the anti-melanoma effect of pimozideJia, Huijie; Guo, Jing; Wang, Pingping; Sun, Ke; Chen, Jian; Ren, Wenjing; Wei, Tian; Yang, Yunfan; Li, Jie; Liu, Xiaoming; Li, Ruipeng; Zhong, Jiateng; Wang, Mingyong; Tian, Zhongwei; Feng, Zhiwei; Zhao, TiesuoInternational Immunopharmacology (2020), 83 (), 106397CODEN: IINMBA; ISSN:1567-5769. (Elsevier B.V.)Melanomas represent the deadliest form of skin cancers. Due to the intricacy of tumorigenesis, it is emergent to find effective therapies for melanomas. Researches have proved that pimozide inhibits the growth of melanoma, but the limited curing effect needs to be further improved. Nowadays, tumor immunotherapy has been widely recognized as the sole therapy that can eradicate cancers. Cytosine-phosphate-guanine oligodeoxynucleotide (CpG ODN), TLR9 receptor agonist, can significantly enhance anti-tumor immune responses. This study explored the therapeutic effect of pimozide combined with CpG ODN on melanoma-bearing mice. The results showed that pimozide combined with CpG ODN effectively inhibited the growth of melanoma and prolonged the survival of melanoma-bearing mice, inhibited the expression of MMP2 and p-Stat5, increased the infiltration of CD4+ and CD8+ T cells in tumor, raised the ratios of CD4+, CD8+ T cells and NK cells. These all indicated that the combination treatment improved the anti-tumor effect of pimozide on mice. The anti-tumor mechanism might be attributed to cell apoptosis induction, invasion inhibition, and immune regulation. A more effective combination treatment concerning with pimozide is being under investigation.
- 217Zhang, L.; Dewan, V.; Yin, H. Discovery of Small Molecules as Multi-Toll-like Receptor Agonists with Proinflammatory and Anticancer Activities. J. Med. Chem. 2017, 60 (12), 5029– 5044, DOI: 10.1021/acs.jmedchem.7b00419[ACS Full Text], [CAS], Google Scholar217https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXot1ymtrY%253D&md5=420e72a8bb3556e9e98f7a5f9f63f58eDiscovery of Small Molecules as Multi-Toll-like Receptor Agonists with Proinflammatory and Anticancer ActivitiesZhang, Lei; Dewan, Varun; Yin, HangJournal of Medicinal Chemistry (2017), 60 (12), 5029-5044CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)Therapies based on activation of multiple Toll-like receptors (TLRs) may offer superior therapeutic profiles than that of single TLR activation. To discover new small mols. that could activate multiple TLRs, the authors performed a cell-based high-throughput screening of a small-mol. library based on TLR3-mediated NF-κB activation. Subsequent structural optimization and counter-screening of other TLRs produced the first small mol. I capable of simultaneously activating TLRs 3, 8, and 9. Biochem. studies demonstrated that I could induce a strong immune response via the prodn. of various cytokines in human monocytic THP-1 cells. Furthermore, I inhibited the proliferation of HeLa cancer cells by triggering apoptosis and arresting the cell cycle at the S phase. These results showcase potential therapeutic applications of I in both vaccine adjuvants and anticancer therapies based on multi-TLR activation.
- 218Davidson, A.; Diamond, B. Autoimmune Diseases. N. Engl. J. Med. 2001, 345 (5), 340– 350, DOI: 10.1056/NEJM200108023450506[Crossref], [PubMed], [CAS], Google Scholar218https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD3MXmtVGqs7c%253D&md5=89ca13f68ee34072a70f28266ae82aa6Autoimmune diseasesDavidson, Anne; Diamond, BettyNew England Journal of Medicine (2001), 345 (5), 340-350CODEN: NEJMAG; ISSN:0028-4793. (Massachusetts Medical Society)A review discussing autoimmune diseases, which is defined as a clin. syndrome caused by the activation of T cells or B cells, or both, in the absence of an ongoing infection or other discernible cause. The classification of autoimmune disease that distinguishes diseases caused by generalized defects in lymphocyte selection or homeostasis from those caused by aberrant responses to particular antigens is discussed. The genetic susceptibility to autoimmune disease, environmental and internal triggers of autoreactivity, changes in pathol. processes as the disease progresses, multiple mechanisms of tissue injury, as well as the survey of new therapeutic approaches are also considered.
- 219Liu, Y.; Yin, H.; Zhao, M.; Lu, Q. TLR2 and TLR4 in Autoimmune Diseases: A Comprehensive Review. Clin. Rev. Allergy Immunol. 2014, 47 (2), 136– 147, DOI: 10.1007/s12016-013-8402-y[Crossref], [PubMed], [CAS], Google Scholar219https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXhsFKrt7zL&md5=d69c2e90e53688b3b9e7dcfb9c1ba726TLR2 and TLR4 in Autoimmune Diseases: a Comprehensive ReviewLiu, Yu; Yin, Heng; Zhao, Ming; Lu, QianjinClinical Reviews in Allergy & Immunology (2014), 47 (2), 136-147CODEN: CRAIF2; ISSN:1080-0549. (Springer)Autoimmune diseases are immune disorders characterized by T cell hyperactivity and B cell overstimulation leading to overprodn. of autoantibodies. Although the pathogenesis of various autoimmune diseases remains to be elucidated, environmental factors have been thought to contribute to the initiation and maintenance of auto-respond inflammation. Toll-like receptors (TLRs) are pattern recognition receptors belonging to innate immunity that recognize and defend invading microorganisms. Besides these exogenous pathogen-assocd. mol. patterns, TLRs can also bind with damage-assocd. mol. patterns produced under strike or by tissue damage or cells apoptosis. It is believed that TLRs build a bridge between innate immunity and autoimmunity. There are five adaptors to TLRs including MyD88, TRIF, TIRAP/MAL, TRAM, and SARM. Upon activation, TLRs recruit specific adaptors to initiate the downstream signaling pathways leading to the prodn. of inflammatory cytokines and chemokines. Under certain circumstances, ligation of TLRs drives to aberrant activation and unrestricted inflammatory responses, thereby contributing to the perpetuation of inflammation in autoimmune diseases. In the past, most studies focused on the intracellular TLRs, such as TLR3, TLR7, and TLR9, but recent studies reveal that cell surface TLRs, esp. TLR2 and TLR4, also play an essential role in the development of autoimmune diseases and afford multiple therapeutic targets. In this review, we summarized the biol. characteristics, signaling mechanisms of TLR2/4, the neg. regulators of TLR2/4 pathway, and the pivotal function of TLR2/4 in the pathogenesis of autoimmune diseases including rheumatoid arthritis, systemic lupus erythematosus, systemic sclerosis, Sjogren's syndrome, psoriasis, multiple sclerosis, and autoimmune diabetes.
- 220Joosten, L. A. B.; Abdollahi-Roodsaz, S.; Dinarello, C. A.; O’Neill, L.; Netea, M. G. Toll-like Receptors and Chronic Inflammation in Rheumatic Diseases: New Developments. Nat. Rev. Rheumatol. 2016, 12 (6), 344– 357, DOI: 10.1038/nrrheum.2016.61[Crossref], [PubMed], [CAS], Google Scholar220https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XnvV2ntb8%253D&md5=a561bbe778204e8e57d599efdbec093aToll-like receptors and chronic inflammation in rheumatic diseases: new developmentsJoosten, Leo A. B.; Abdollahi-Roodsaz, Shahla; Dinarello, Charles A.; O'Neill, Luke; Netea, Mihai G.Nature Reviews Rheumatology (2016), 12 (6), 344-357CODEN: NRRACB; ISSN:1759-4790. (Nature Publishing Group)In the past few years, new developments have been reported on the role of Toll-like receptors (TLRs) in chronic inflammation in rheumatic diseases. The inhibitory function of TLR10 has been demonstrated. Receptors that enhance the function of TLRs, and several TLR inhibitors, have been identified. In addn., the role of the microbiome and TLRs in the onset of rheumatic diseases has been reported. We review novel insights on the role of TLRs in several inflammatory joint diseases, including rheumatoid arthritis, systemic lupus erythematosus, gout and Lyme arthritis, with a focus on the signalling mechanisms mediated by the Toll-IL-1 receptor (TIR) domain, the exogenous and endogenous ligands of TLRs, and the current and future therapeutic strategies to target TLR signalling in rheumatic diseases.
- 221Minagar, A. Multiple Sclerosis: An Overview of Clinical Features, Pathophysiology, Neuroimaging, and Treatment Options. Colloq. Ser. Integr. Syst. Physiol. From Mol. to Funct. 2014, 6, 1– 117, DOI: 10.4199/C00116ED1V01Y201408ISP055
- 222Kumar, V. Toll-like Receptors in the Pathogenesis of Neuroinflammation. J. Neuroimmunol. 2019, 332, 16– 30, DOI: 10.1016/j.jneuroim.2019.03.012[Crossref], [PubMed], [CAS], Google Scholar222https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXmtlOms7s%253D&md5=3d8a80280856b6cea3d95d19ac195a04Toll-like receptors in the pathogenesis of neuroinflammationKumar, V.Journal of Neuroimmunology (2019), 332 (), 16-30CODEN: JNRIDW; ISSN:0165-5728. (Elsevier B.V.)Toll-like receptors (TLRs) are discovered as crucial pattern recognition receptors (PRRs) involved in the recognition of pathogen-assocd. mol. patterns (PAMPs). Later studies showed their involvement in the recognition of various damage/danger-assocd. mol. patterns (DAMPs) generated by host itself. Thus, TLRs are capable of recognizing wide-array of patterns/mols. derived from pathogens and host as well and initiating a proinflammatory immune response through the activation of NF-κB and other transcription factors causing synthesis of proinflammatory mols. The process of neuroinflammation is seen under both sterile and infectious inflammatory diseases of the central nervous system (CNS) and may lead to the development of neurodegeneration. The present article is designed to highlight the importance of TLRs in the pathogenesis of neuroinflammation under diverse conditions. TLRs are expressed by various immune cells present in CNS along with neurons. However out of thirteen TLRs described in mammals, some are present and active in these cells, while some are absent and are described in detail in main text. The role of various immune cells present in the brain and their role in the pathogenesis of neuroinflammation depending on the type of TLR expressed is described. Thereafter the role of TLRs in bacterial meningitis, viral encephalitis, stroke, Alzheimer's disease (AD), Parkinson's disease (PD), and autoimmune disease including multiple sclerosis (MS) is described. The article is designed for both neuroscientists needing information regarding TLRs in neuroinflammation and TLR biologists or immunologists interested in neuroinflammation.
- 223Hansen, B. S.; Hussain, R. Z.; Lovett-Racke, A. E.; Thomas, J. A.; Racke, M. K. Multiple Toll-like Receptor Agonists Act as Potent Adjuvants in the Induction of Autoimmunity. J. Neuroimmunol. 2006, 172 (1–2), 94– 103, DOI: 10.1016/j.jneuroim.2005.11.006[Crossref], [PubMed], [CAS], Google Scholar223https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD28XhvVWgs78%253D&md5=f224f1c0dc3fc4f84b80ae2aae3855cdMultiple toll-like receptor agonists act as potent adjuvants in the induction of autoimmunityHansen, Baranda S.; Hussain, Rehana Z.; Lovett-Racke, Amy E.; Thomas, James A.; Racke, Michael K.Journal of Neuroimmunology (2006), 172 (1-2), 94-103CODEN: JNRIDW; ISSN:0165-5728. (Elsevier B.V.)Infections can trigger or exacerbate the course of Multiple Sclerosis, and both bacterial and viral agents have been implicated. These agents are recognized by host cells via pathogen-assocd. mol. patterns activating TLRs. We investigated the role that PAMPs play in the animal model Exptl. Autoimmune Encephalomyelitis, and found various MyD88-dependent PAMPs can participate as the adjuvant to induce EAE. Studies with IRAK1-deficient mice suggest that signaling through TLRs is not required in the target organ to develop disease. This suggests that PAMPs play an important role in priming of autoreactive T cells in EAE and potentially MS.
- 224Clements, M. TLR2 and TLR4 Cascade Involved in the Multifaceted Symptoms of Experimental Autoimmune Encephalomyelitis (EAE), a Model of Multiple Sclerosis, Thesis, University of Colorado at Boulder, Boulder, CO, 2019.
- 225Touil, T.; Fitzgerald, D.; Zhang, G.-X.; Rostami, A.; Gran, B. Cutting Edge: TLR3 Stimulation Suppresses Experimental Autoimmune Encephalomyelitis by Inducing Endogenous IFN-β. J. Immunol. 2006, 177 (11), 7505– 7509, DOI: 10.4049/jimmunol.177.11.7505[Crossref], [PubMed], [CAS], Google Scholar225https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD28Xht1Wrs7fK&md5=09a4bf2fca12fb63310224ff295e50a3Cutting Edge: TLR3 Stimulation Suppresses Experimental Autoimmune Encephalomyelitis by Inducing Endogenous IFN-βTouil, Tarik; Fitzgerald, Denise; Zhang, Guang-Xian; Rostami, Abdolmohamad; Gran, BrunoJournal of Immunology (2006), 177 (11), 7505-7509CODEN: JOIMA3; ISSN:0022-1767. (American Association of Immunologists)Exptl. autoimmune encephalomyelitis is a well-characterized model of cell-mediated autoimmunity. TLRs expressed on APCs recognize microbial components and induce innate immune responses, leading to the elimination of invading infectious agents. Certain TLR agonists have been reported to have adjuvant properties in CNS autoimmune inflammatory demyelination. The authors report in this study that TLR3 stimulation by polyinosinic-polycytidylic acid, a double-stranded RNA analog, suppresses relapsing demyelination in a murine exptl. autoimmune encephalomyelitis model. Disease suppression is assocd. with the induction of endogenous IFN-β and the peripheral induction of the CC chemokine CCL2. These data indicate that a preferential activation of the MyD88-independent, type I IFN-inducing TLR pathway has immunoregulatory potential in this organ-specific autoimmune disease.
- 226Hirotani, M.; Niino, M.; Fukazawa, T.; Kikuchi, S.; Yabe, I.; Hamada, S.; Tajima, Y.; Sasaki, H. Decreased IL-10 Production Mediated by Toll-like Receptor 9 in B Cells in Multiple Sclerosis. J. Neuroimmunol. 2010, 221 (1–2), 95– 100, DOI: 10.1016/j.jneuroim.2010.02.012[Crossref], [PubMed], [CAS], Google Scholar226https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3cXks1Sjsrc%253D&md5=e0bca7d50d37aa9655731485488047eeDecreased IL-10 production mediated by Toll-like receptor 9 in B cells in multiple sclerosisHirotani, Makoto; Niino, Masaaki; Fukazawa, Toshiyuki; Kikuchi, Seiji; Yabe, Ichiro; Hamada, Shinsuke; Tajima, Yasutaka; Sasaki, HidenaoJournal of Neuroimmunology (2010), 221 (1-2), 95-100CODEN: JNRIDW; ISSN:0165-5728. (Elsevier B.V.)The complexity of the roles of Toll-like receptors (TLRs) is attributable to their ability to promote or suppress autoimmune diseases. Recent studies have demonstrated that B cells regulate autoimmune diseases, including multiple sclerosis (MS), by producing interleukin (IL)-10. By using CpG DNA as a TLR9 agonist, we investigated the immunoregulatory functions of B cell via TLR9 in MS. Our results indicate that TLR9-mediated IL-10 prodn. by B cells was significantly decreased in MS, and this decrease is likely due to decreased TLR9 expression in memory B cells, suggesting a role of TLR9 in immunoregulation in MS.
- 227Dishon, S.; Schumacher, A.; Fanous, J.; Talhami, A.; Kassis, I.; Karussis, D.; Gilon, C.; Hoffman, A.; Nussbaum, G. Development of a Novel Backbone Cyclic Peptide Inhibitor of the Innate Immune TLR/IL1R Signaling Protein MyD88. Sci. Rep. 2018, 8, 9476, DOI: 10.1038/s41598-018-27773-8[Crossref], [PubMed], [CAS], Google Scholar227https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB3c%252FgsF2itA%253D%253D&md5=8132ad8c29a425e40a973bd13d574668Development of a Novel Backbone Cyclic Peptide Inhibitor of the Innate Immune TLR/IL1R Signaling Protein MyD88Dishon Shira; Nussbaum Gabriel; Schumacher Adi; Fanous Joseph; Hoffman Amnon; Talhami Alaa; Gilon Chaim; Kassis Ibrahim; Karussis DimitriosScientific reports (2018), 8 (1), 9476 ISSN:.MyD88 is a cytoplasmic adaptor protein that plays a central role in signaling downstream of the TLRs and the IL1R superfamily. We previously demonstrated that MyD88 plays a critical role in EAE, the murine model of multiple sclerosis, and showed that the MyD88 BB-loop decoy peptide RDVLPGT ameliorates EAE. We now designed and screened a library of backbone cyclized peptides based on the linear BB loop peptide, to identify a metabolically stable inhibitor of MyD88 that retains the binding properties of the linear peptide. We identified a novel cyclic peptide protein mimetic that inhibits inflammatory responses to TLR ligands, and NFκB activation in response to IL-1 activation. The inhibitor, c(MyD 4-4), is metabolically stable in comparison to the linear peptide, blocks MyD88 in a specific manner, and inhibits MyD88 function by preventing MyD88 dimerization. Finally, treatment of mice with c(MyD 4-4) reduced the severity of clinical disease in the murine EAE model of multiple sclerosis. Thus, modulation of MyD88-dependent signaling using c(MyD 4-4) is a potential therapeutic strategy to lower innate immune inflammation in autoimmune CNS disease.
- 228Hultqvist, M.; Nandakumar, K. S.; Björklund, U.; Holmdahl, R. The Novel Small Molecule Drug Rabeximod Is Effective in Reducing Disease Severity of Mouse Models of Autoimmune Disorders. Ann. Rheum. Dis. 2009, 68 (1), 130– 135, DOI: 10.1136/ard.2007.085241[Crossref], [PubMed], [CAS], Google Scholar228https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1MXhslOlt7k%253D&md5=a82112d3c1bb173e9e2d0b2a0a071256The novel small molecule drug rabeximod is effective in reducing disease severity of mouse models of autoimmune disordersHultqvist, M.; Nandakumar, K. S.; Bjoerklund, U.; Holmdahl, R.Annals of the Rheumatic Diseases (2009), 68 (1), 130-135CODEN: ARDIAO; ISSN:0003-4967. (BMJ Publishing Group)Objectives: Autoimmune diseases such as rheumatoid arthritis (RA) and multiple sclerosis (MS) affect a relatively large portion of the population, leading to severe disability if left untreated. Even though pharmaceutics targeting the immune system have revolutionized the therapy of these diseases, there is still a need for novel, more effective therapeutic substances. One such substance is the new chem. entity 9-chloro-2,3 dimethyl-6-(N,N-dimthylamino-2-oxoethyl)-6H-indolo [2,3-b] quionoxaline, Rabeximod, currently being investigated for efficiency in treatment of human RA. In this study we aimed to evaluate Rabeximod as a treatment for autoimmune diseases, using animal models. Methods: In the present investigation we have evaluated Rabeximod as a treatment for autoimmune diseases using mouse models of RA and MS, ie, collagen-induced arthritis, collagen antibody induced arthritis and exptl. autoimmune encephalomyelitis. Results: Rabeximod efficiently prevented arthritis and encephalomyelitis in mice. In addn., this effect correlated to the timepoint when cells migrate into the joints. Conclusions: We conclude that Rabeximod reduces disease severity in animal models of autoimmunity and should be considered as a new therapeutic substance for MS and RA.
- 229Crowley, T.; Fitzpatrick, J. M.; Kuijper, T.; Cryan, J. F.; O’Toole, O.; O’Leary, O. F.; Downer, E. J. Modulation of TLR3/TLR4 Inflammatory Signaling by the GABAB Receptor Agonist Baclofen in Glia and Immune Cells: Relevance to Therapeutic Effects in Multiple Sclerosis. Front. Cell. Neurosci. 2015, 9, 284, DOI: 10.3389/fncel.2015.00284[Crossref], [PubMed], [CAS], Google Scholar229https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXlsVOrtbY%253D&md5=acfde6e98a70c0b4d73e919d9de3a8b1Modulation of TLR3/TLR4 inflammatory signaling by the GABAB receptor agonist baclofen in glia and immune cells: relevance to therapeutic effects in multiple sclerosisCrowley, Tadhg; Fitzpatrick, John-Mark; Kuijper, Teun; Cryan, John F.; O'Toole, Orna; O'Leary, Olivia F.; Downer, Eric J.Frontiers in Cellular Neuroscience (2015), 9 (), 284/1-284/12CODEN: FCNRAH; ISSN:1662-5102. (Frontiers Media S.A.)The GABAB receptor agonist, baclofen, is used to treat muscle tightness and cramping caused by spasticity in a no. of disorders including multiple sclerosis (MS), but its precise mechanism of action is unknown. Neuroinflammation drives the central pathol. in MS and is mediated by both immunoreactive glial cells and invading lymphocytes. Furthermore, a body of data indicates that the Toll-like receptor (TLR) family of innate immune receptors is implicated in MS progression. In the present study we investigated whether modulation of GABAB receptors using baclofen can exert anti-inflammatory effects by targeting TLR3 and(or) TLR4-induced inflammatory signaling in murine glial cells and human peripheral blood mononuclear cells (PBMCs) isolated from healthy control individuals and patients with the relapse-remitting (RR) form of MS. TLR3 and TLR4 stimulation promoted the nuclear sequestration of NF-κB and pro-inflammatory cytokine expression in murine glia, while TLR4, but not TLR3, promoted pro-inflammatory cytokine expression in PBMCs isolated from both healthy donors and RR-MS patients. Importantly, this effect was exacerbated in RR-MS patient immune cells. We present further evidence that baclofen dose-dependently attenuated TLR3- and TLR4-induced inflammatory signaling in primary glial cells. Pre-exposure of PBMCs isolated from healthy donors to baclofen attenuated TLR4-induced TNF-α expression, but did not affect TLR4-induced TNF-α expression in RR-MS patient PBMCs. Interestingly, mRNA expression of the GABAB receptor was reduced in PBMCs from RR-MS donors when compared to healthy controls, an effect that might contribute to the differential sensitivity to baclofen seen in healthy and RR-MS patient cells. Overall these findings indicate that baclofen differentially regulates TLR3 and TLR4 signaling in glia and immune cells, and offers insight on the role of baclofen in the treatment of neuroinflammatory disease states including MS.
- 230Li, X.; Li, T. T.; Zhang, X. H.; Hou, L. F.; Yang, X. Q.; Zhu, F. H.; Tang, W.; Zuo, J. P. Artemisinin Analogue SM934 Ameliorates Murine Experimental Autoimmune Encephalomyelitis through Enhancing the Expansion and Functions of Regulatory T Cell. PLoS One 2013, 8 (8), e74108, DOI: 10.1371/journal.pone.0074108[Crossref], [PubMed], [CAS], Google Scholar230https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXhsVWht73O&md5=282a41e6d6b1eb459bd0890a327155e7Artemisinin analogue SM934 ameliorates murine experimental autoimmune encephalomyelitis through enhancing the expansion and functions of regulatory T cellLi, Xin; Li, Tian-Tian; Zhang, Xiao-Hui; Hou, Li-Fei; Yang, Xiao-Qian; Zhu, Feng-Hua; Tang, Wei; Zuo, Jian-PingPLoS One (2013), 8 (8), e74108CODEN: POLNCL; ISSN:1932-6203. (Public Library of Science)Background: Artemisinin analog SM934 was previously reported to possess immunosuppressive properties. The aim of this study was to det. the effects and the underlying mechanisms of SM934 in murine exptl. autoimmune encephalomyelitis (EAE). Methods: Female C57BL/6 mice immunized with MOG35-55 were treated with or without SM934, then the clin. scores and other relevant parameters were assessed. Th1, Th17 and regulatory T (Treg) cell profiles were detd. through ELISA, qRT-PCR, flow cytometry and BrdU incorporation assay. The effects of SM934 on Th1, Th17 and Treg cells differentiation were explored through intracellular staining and flow cytometry examn. Results: In vivo, administration of SM934 significantly inhibited the development of EAE and suppressed the elevation of serum IL-17. Ex vivo, upon antigen-recall stimulation, IL-2, IFN-γ, IL-17 and IL-6 prodn. were decreased, whereas IL-10 and TGF-β prodn. were increased from the splenocytes isolated from SM934-treated mice. Consistently, both flow cytometry and qRT-PCR results showed that SM934 treatment significantly increased the Treg, while strongly suppressed the Th17 and Th1, responses in the peripheral. Furthermore, in the spinal lesion, SM934 treatment dramatically decreased the infiltration of CD4+ T cells, within which the Treg cells percentage was enlarged, whereas the Th17, but not Th1 percentage, was significantly decreased comparing with the vehicle-treated groups. Finally, both BrdU incorporation and in vitro Treg differentiation assays revealed that SM934 treatment could directly promote the expansion of Treg cells in vivo and in vitro. Conclusion: Taken together, this study demonstrated that SM934 treatment could ameliorate the murine EAE disease, which might be mediated by inducing Treg differentiation and expansion.
- 231Angelotti, F.; Parma, A.; Cafaro, G.; Capecchi, R.; Alunno, A.; Puxeddu, I. One Year in Review 2017: Pathogenesis of Rheumatoid Arthritis. Clin. Exp. Rheumatol. 2017, 35 (3), 368– 378[PubMed], [CAS], Google Scholar231https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC1cnpvFOmuw%253D%253D&md5=1884205970f8d572625264816ed3298bOne year in review 2017: pathogenesis of rheumatoid arthritisAngelotti Francesca; Capecchi Riccardo; Puxeddu Ilaria; Parma Alice; Cafaro Giacomo; Alunno AlessiaClinical and experimental rheumatology (2017), 35 (3), 368-378 ISSN:0392-856X.Rheumatoid arthritis (RA) is a chronic inflammatory autoimmune disease influenced by both genetic and environmental factors. It has been postulated that a high-risk genetic background, in combination with epigenetic marks and environmental exposures, leads to a cascade of events inducing synovitis and consequent destructive arthritis. The clinical picture of joint involvement in RA is the result of chronic inflammation of the synovium, characterised by interactions of resident cells such as fibroblast-like synoviocytes (FLS) with cells of the innate (e.g. macrophages, dendritic cells, mast cells and NK cells, neutrophils) and adaptive immune system (e.g. B and T lymphocytes). Currently, our understanding of the role of innate and adaptive immunity in the pathogenesis of RA is expanding. The concept of how immune responses contribute to the disease has dramatically evolved over the last 50 years. Shedding some light on the different aspects of RA pathogenesis will help to identify new targets for the development of disease-modifying therapies. Thus, in this review we report new insights in RA pathogenesis, resulting from a literature research date published in the last year.
- 232McInnes, I. B.; Schett, G. The Pathogenesis of Rheumatoid Arthritis. N. Engl. J. Med. 2011, 365 (23), 2205– 2219, DOI: 10.1056/NEJMra1004965[Crossref], [PubMed], [CAS], Google Scholar232https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3MXhs1ajsrrM&md5=31a79ccb05bca03f207b15f934b2d52dThe pathogenesis of rheumatoid arthritisMcInnes, Lain B.; Schett, GeorgNew England Journal of Medicine (2011), 365 (23), 2205-2219CODEN: NEJMAG; ISSN:0028-4793. (Massachusetts Medical Society)A review discusses key pathogenic advances in rheumatoid arthritis, genetics, environmental factors, immunol. processes, inflammation, and structural damage.
- 233Seibl, R.; Birchler, T.; Loeliger, S.; Hossle, J. P.; Gay, R. E.; Saurenmann, T.; Michel, B. A.; Seger, R. A.; Gay, S.; Lauener, R. P. Expression and Regulation of Toll-like Receptor 2 in Rheumatoid Arthritis Synovium. Am. J. Pathol. 2003, 162 (4), 1221– 1227, DOI: 10.1016/S0002-9440(10)63918-1[Crossref], [PubMed], [CAS], Google Scholar233https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD3sXjtVemtLY%253D&md5=998706b53f46d7d61408b3712edc9456Expression and regulation of Toll-like receptor 2 in rheumatoid arthritis synoviumSeibl, Reinhart; Birchler, Thomas; Loeliger, Susanne; Hossle, Johann Peter; Gay, Renate E.; Saurenmann, Traudl; Michel, Beat A.; Seger, Reinhard A.; Gay, Steffen; Lauener, Roger P.American Journal of Pathology (2003), 162 (4), 1221-1227CODEN: AJPAA4; ISSN:0002-9440. (American Society for Investigative Pathology)Toll-like receptors (TLRs) are involved in mediating cell activation on stimulation with microbial constituents. The authors investigated the role for TLRs in synovial fibroblast (SF) activation in rheumatoid arthritis (RA). The authors analyzed whether stimulation with interleukin-1β and tumor necrosis factor-α, cytokines present in RA synovium, influences expression of TLR genes in SFs. The effects were compared with those of treatment with lipopolysaccharide and a synthetic lipopeptide (sBLP). Gene expression was examd. using quant. polymerase chain reaction. TLR2-mediated cell activation was investigated by electromobility shift assay for nuclear factor-.vkappa.B. To localize TLR2 expression in joint tissue sections of RA patients were stained using in situ hybridization. Expression of TLR2 in RA SFs was increased after treatment with interleukin-1β, tumor necrosis factor-α, lipopolysaccharide, and sBLP. Nuclear factor-.vkappa.B translocation in SFs was triggered by TLR2-mediated cell stimulation. Synovial tissues from RA joints expressed TLR2 predominantly at sites of attachment and invasion into cartilage and bone. The obsd. elevated expression of TLR2 in RA SFs could be a consequence of direct exposure to microbial compds. or of the presence of inflammatory mediators in the joint. TLR-assocd. signaling pathways may contribute to the pathogenesis of RA, either by initiating or perpetuating activation of SFs.
- 234Huang, Q. Q.; Ma, Y.; Adebayo, A.; Pope, R. M. Increased Macrophage Activation Mediated through Toll-like Receptors in Rheumatoid Arthritis. Arthritis Rheum. 2007, 56 (7), 2192– 2201, DOI: 10.1002/art.22707[Crossref], [PubMed], [CAS], Google Scholar234https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2sXovFSgtrk%253D&md5=b77bc498d424d14e73b9a99dd7df0beeIncreased macrophage activation mediated through Toll-like receptors in rheumatoid arthritisHuang, QiQuan; Ma, Yingyu; Adebayo, Adedamola; Pope, Richard M.Arthritis & Rheumatism (2007), 56 (7), 2192-2201CODEN: ARHEAW; ISSN:0004-3591. (John Wiley & Sons, Inc.)Macrophages are the major source of inflammation mediators that are important in the pathogenesis of rheumatoid arthritis (RA). This study was undertaken to analyze macrophages obtained from the joints of RA patients in order to characterize the expression of Toll-like receptor 2 (TLR-2) and TLR-4 and the responses to TLR ligation. Cells were isolated from the synovial fluid (SF) of RA patients or patients with other forms of inflammatory arthritis. Cell surface TLR-2 and TLR-4 expression and intracellular tumor necrosis factor α (TNFα) and interleukin-8 (IL-8) expression by CD14+ macrophages were detd. by flow cytometry. Peptidoglycan (PG) and lipopolysaccharide (LPS) were used as ligands for TLR-2 and TLR-4, resp. The expression of TLR-2 and TLR-4 was increased on CD14+ macrophages from the joints of RA patients compared with that on control in vitro-differentiated macrophages or control peripheral blood monocytes. Neither TLR-2 expression nor TLR-4 expression differed between RA and other forms of inflammatory arthritis. However, PG- and LPS-induced TNFα expression and IL-8 expression were greater with RA SF macrophages than with those obtained from the joints of patients with other forms of inflammatory arthritis or with control macrophages. PG-induced TNFα expression and IL-8 expression were highly correlated with TLR-2 expression in normal macrophages, but not with that in macrophages obtained from joints of RA patients or patients with other forms of inflammatory arthritis. TLR-2 and TLR-4 ligation resulted in increased activation of RA synovial macrophages compared with those from patients with other forms of inflammatory arthritis or compared with control macrophages. Factors other than the level of TLR-2 and TLR-4 expression contributed to the increased activation of RA SF macrophages. These observations support the notion of a potential role for activation through TLR-2 and TLR-4 in the inflammation and joint destruction of RA.
- 235Ospelt, C.; Brentano, F.; Rengel, Y.; Stanczyk, J.; Kolling, C.; Tak, P. P.; Gay, R. E.; Gay, S.; Kyburz, D. Overexpression of Toll-like Receptors 3 and 4 in Synovial Tissue from Patients with Early Rheumatoid Arthritis: Toll-like Receptor Expression in Early and Longstanding Arthritis. Arthritis Rheum. 2008, 58 (12), 3684– 3692, DOI: 10.1002/art.24140[Crossref], [PubMed], [CAS], Google Scholar235https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1MXmt1ymsg%253D%253D&md5=c075b4c3a5fe9241ddcb77a0efc57a1dOverexpression of toll-like receptors 3 and 4 in synovial tissue from patients with early rheumatoid arthritis: toll-like receptor expression in early and longstanding arthritisOspelt, Caroline; Brentano, Fabia; Rengel, Yvonne; Stanczyk, Joanna; Kolling, Christoph; Tak, Paul P.; Gay, Renate E.; Gay, Steffen; Kyburz, DiegoArthritis & Rheumatism (2008), 58 (12), 3684-3692CODEN: ARHEAW; ISSN:0004-3591. (John Wiley & Sons, Inc.)To analyze the expression, regulation, and biol. relevance of Toll-like receptors (TLRs) 1-10 in synovial and skin fibroblasts and to det. the expression levels of TLRs 2, 3, and 4 in synovial tissues from patients with early rheumatoid arthritis (RA), longstanding RA, and osteoarthritis (OA). Expression of TLRs 1-10 in RA synovial fibroblasts (RASFs), OASFs, and skin fibroblasts was analyzed by real-time polymerase chain reaction (PCR). Fibroblasts were stimulated with tumor necrosis factor α, interleukin-1β (IL-1β), bacterial lipopeptide, poly(I-C), lipopolysaccharide, and flagellin. Prodn. of IL-6 was detd. by ELISA and induction of TLRs 2-5, matrix metalloproteinases (MMPs) 3 and 13 mRNA by real-time PCR. Expression of TLRs 2-4 in synovial tissues was analyzed by immunohistochem. Synovial fibroblasts expressed TLRs 1-6, but not TLRs 7-10. Among the expressed TLRs, TLR-3 and TLR-4 were the most abundant in synovial fibroblasts, and stimulation of synovial fibroblasts with the TLR-3 ligand poly(I-C) led to the most pronounced increase in IL-6, MMP-3, and MMP-13. In contrast, skin fibroblasts did not up-regulate MMP-3 or MMP-13 after stimulation with any of the tested stimuli. In synovial tissues from patients with early RA, TLR-3 and TLR-4 were highly expressed and were comparable to the levels of patients with longstanding RA. These expression levels were elevated as compared with those in OA. Our findings of high expression of TLRs, particularly TLRs 3 and 4, at an early stage of RA and the reactivity of synovial fibroblasts in vitro to TLR ligands suggest that TLR signaling pathways resulting in persistent inflammation and joint destruction are activated early in the disease process.
- 236Roelofs, M. F.; Joosten, L. A. B.; Abdollahi-Roodsaz, S.; Van Lieshout, A. W. T.; Sprong, T.; Van Den Hoogen, F. H.; Van Den Berg, W. B.; Radstake, T. R. D. J. The Expression of Toll-like Receptors 3 and 7 in Rheumatoid Arthritis Synovium Is Increased and Costimulation of Toll-like Receptors 3, 4, and 7/8 Results in Synergistic Cytokine Production by Dendritic Cells. Arthritis Rheum. 2005, 52 (8), 2313– 2322, DOI: 10.1002/art.21278[Crossref], [PubMed], [CAS], Google Scholar236https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2MXpslGhtro%253D&md5=77c89e1c04a3e4cffcbccb27c052ec86The expression of Toll-like receptors 3 and 7 in rheumatoid arthritis synovium is increased and costimulation of Toll-like receptors 3, 4 and 7/8 results in synergistic cytokine production by dendritic cellsRoelofs, M. F.; Joosten, L. A. B.; Abdollahi-Roodsaz, S.; van Lieshout, A. W. T.; Sprong, T.; van den Hoogen, F. H.; van den Berg, W. B.; Radstake, T. R. D. J.Arthritis & Rheumatism (2005), 52 (8), 2313-2322CODEN: ARHEAW; ISSN:0004-3591. (John Wiley & Sons, Inc.)Objective. To evaluate the expression of Toll-like receptors (TLRs) 3 and 7 in synovium and to study potential differences in the maturation and cytokine prodn. mediated by TLR-2, TLR-3, TLR-4, and TLR-7/8 by dendritic cells (DCs) from rheumatoid arthritis (RA) patients and DCs from healthy controls. Methods. Synovial expression of TLR-3 and TLR-7 in RA was studied using immunohistochem. Monocyte-derived DCs from RA patients and healthy controls were cultured for 6 days and subsequently stimulated for 48 h via TLR-mediated pathways (lipoteichoic acid, Pam3Cys, and fibroblast-stimulating lipopeptide 1 for TLR-2, poly[I-C] for TLR-3, lipopolysaccharide and extra domain A for TLR-4, and R848 for TLR-7/8). Phenotypic DC maturation was measured using flow cytometry. The secretion of tumor necrosis factor α (TNFα), interleukin-6 (IL-6), IL-10, and IL-12 was measured using the Bio-Plex system. Cell lines expressing TLR-2 and TLR-4 were used for the detection of TLR-2 and TLR-4 ligands in serum and synovial fluid from RA patients. Results. TLR-3 and TLR-7 were highly expressed in RA synovium. All TLR ligands elicited phenotypic DC maturation equally between DCs from RA patients and those from healthy controls. TLR-2- and TLR-4-mediated stimulation of DCs from RA patients resulted in markedly higher prodn. of inflammatory mediators (TNFα and IL-6) compared with DCs from healthy controls. In contrast, upon stimulation of TLR-3 and TLR-7/8, the level of cytokine prodn. was equal between DCs from RA patients and those from healthy controls. Remarkably, both TLR-3 and TLR-7/8 stimulation resulted in a skewed balance toward IL-12. Intriguingly, the combined stimulation of TLR-4 and TLR-3-7/8 resulted in a marked synergy with respect to the prodn. of inflammatory mediators. As a proof of concept, TLR-4 ligands were increased in the serum and synovial fluid of RA patients. Conclusion. TLRs are involved in the regulation of DC activation and cytokine prodn. The authors hypothesize that various TLR ligands in the joint trigger multiple TLRs simultaneously, favoring the breakthrough of tolerance in RA.
- 237Hayashi, T.; Gray, C. S.; Chan, M.; Tawatao, R. I.; Ronacher, L.; McGargill, M. A.; Datta, S. K.; Carson, D. A.; Corr, M. Prevention of Autoimmune Disease by Induction of Tolerance to Toll-like Receptor 7. Proc. Natl. Acad. Sci. U. S. A. 2009, 106 (8), 2764– 2769, DOI: 10.1073/pnas.0813037106[Crossref], [PubMed], [CAS], Google Scholar237https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1MXislahtrg%253D&md5=eb595d350e90fc374113c0c1e13d2a89Prevention of autoimmune disease by induction of tolerance to Toll-like receptor 7Hayashi, Tomoko; Gray, Christine S.; Chan, Michael; Tawatao, Rommel I.; Ronacher, Lisa; McGargill, Maureen A.; Datta, Sandip K.; Carson, Dennis A.; Corr, MaripatProceedings of the National Academy of Sciences of the United States of America (2009), 106 (8), 2764-2769CODEN: PNASA6; ISSN:0027-8424. (National Academy of Sciences)Activation of Toll-like receptors (TLR) contributes to the initiation and maintenance of chronic inflammation in autoimmune diseases, yet repeated exposure to a TLR agonist can induce hyporesponsiveness to subsequent TLR stimulation. Here, the authors used a synthetic TLR7 agonist, 9-benzyl-8-hydroxy-2-(2-methoxyethoxy) adenine (SM360320, 1V136) to study TLR7 induced attenuation of inflammatory responses and its application to autoimmune diseases. Repeated low dose administration of this TLR7 agonist induced hyporesponsiveness or tolerance to TLR2, -7, and -9 activators and limited the course of neural inflammation in an exptl. allergic encephalomyelitis model. The hyporesponsiveness did not depend on T or B lymphocytes, but did require bone marrow derived cells. In addn., TLR7 tolerance reduced inflammation in a passive antibody mediated arthritis model. TLR7 tolerance did not cause global immunosuppression, because susceptibility to Listeria monocytogenes infection was not altered. The mechanism of TLR7 tolerance involved the up-regulation of 2 inhibitors of TLR signaling: interleukin 1 receptor assocd. kinase (IRAK) M, and Src homol. 2 domain-contg. inositol polyphosphate phosphatase (SHIP)-1. These findings suggest that induction of TLR7 tolerance might be a new therapeutic approach to subdue inflammation in autoimmune diseases.
- 238Sacre, S. M.; Lo, A.; Gregory, B.; Simmonds, R. E.; Williams, L.; Feldmann, M.; Brennan, F. M.; Foxwell, B. M. Inhibitors of TLR8 Reduce TNF Production from Human Rheumatoid Synovial Membrane Cultures. J. Immunol. 2008, 181 (11), 8002– 8009, DOI: 10.4049/jimmunol.181.11.8002[Crossref], [PubMed], [CAS], Google Scholar238https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1cXhtl2gsLzF&md5=216674863649d4b20a20caa8d46b1206Inhibitors of TLR8 Reduce TNF Production from Human Rheumatoid Synovial Membrane CulturesSacre, Sandra M.; Lo, Alexandra; Gregory, Bernard; Simmonds, Rachel E.; Williams, Lynn; Feldmann, Marc; Brennan, Fionula M.; Foxwell, Brian M.Journal of Immunology (2008), 181 (11), 8002-8009CODEN: JOIMA3; ISSN:0022-1767. (American Association of Immunologists)The advent of anti-TNF biologicals has been a seminal advance in the treatment of rheumatoid arthritis (RA) and has confirmed the important role of TNF in disease pathogenesis. However, it is unknown what sustains the chronic prodn. of TNF. In this study, we have investigated the anti-inflammatory properties of mianserin, a serotonin receptor antagonist. We discovered mianserin was able to inhibit the endosomal TLRs 3, 7, 8, and 9 in primary human cells and inhibited the spontaneous release of TNF and IL-6 from RA synovial membrane cultures. This suggested a role for these TLRs in prodn. of TNF and IL-6 from RA which was supported by data from chloroquine, an inhibitor of endosomal acidification (a prerequisite for TLRs 3, 7, 8, and 9 activation) which also inhibited prodn. of these cytokines from RA synovial cultures. Only stimulation of TLR 3 or 8 induced TNF from these cultures, indicating that TLR7 and TLR9 were of less consequence in this model. The key observation that indicated the importance of TLR8 was the inhibition of spontaneous TNF prodn. by imiquimod, which we discovered to be an inhibitor of TLR8. Together, these data suggest that TLR8 may play a role in driving TNF prodn. in RA. Because this receptor can be inhibited by small m.w. mols., it may prove to be an important therapeutic target.
- 239Lacerte, P.; Brunet, A.; Egarnes, B.; Duchêne, B.; Brown, J. P.; Gosselin, J. Overexpression of TLR2 and TLR9 on Monocyte Subsets of Active Rheumatoid Arthritis Patients Contributes to Enhance Responsiveness to TLR Agonists. Arthritis Res. Ther. 2016, 18, 10, DOI: 10.1186/s13075-015-0901-1[Crossref], [PubMed], [CAS], Google Scholar239https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XitVOis7nJ&md5=b7aa7530a2e3f72909cb5edcb52fb798Overexpression of TLR2 and TLR9 on monocyte subsets of active rheumatoid arthritis patients contributes to enhance responsiveness to TLR agonistsLacerte, Patricia; Brunet, Alexandre; Egarnes, Benoit; Duchene, Benjamin; Brown, Jacques P.; Gosselin, JeanArthritis Research & Therapy (2016), 18 (), 10/1-10/14CODEN: ARTRCV; ISSN:1478-6362. (BioMed Central Ltd.)Background: Synovial infiltration of monocytes is commonly assocd. with inflammation in rheumatoid arthritis (RA). Toll-like receptors (TLRs) are innate sensors that recognize cell debris and microbial components in host, a process contributing to maintain chronic inflammation in RA. We assessed the expression levels of TLR2 and TLR9 in monocyte subsets of active RA patients and characterized their cytokine profiles in response to synthetic and viral TLR2 and TLR9 agonists, including Epstein-Barr virus (EBV) which is suspected to contribute to RA symptoms. Methods: Prevalence of monocyte subsets CD14 CD16 , CD14 CD16 and CD14low CD16 was evaluated in blood and synovial fluids of active RA patients and levels of TLR2 and TLR9 in monocyte subsets were measured by flow cytometry. Enriched monocytes derived from RA patients and healthy donors were stimulated in vitro with synthetic TLR2 and TLR9 agonists and with EBV particles or viral DNA. Intracellular cytokine profiles were detd. in resp. monocyte subsets. Finally, the presence of EBV genome was evaluated by real-time PCR in blood and synovial monocytes of RA patients. Results: Nos. of CD14 CD16 and CD14low CD16 were found to increase in blood of RA patients compared to healthy controls, while all three subsets were detected in synovial fluids. TLR2 is abundantly expressed on blood and synovial CD14 CD16 and CD14 CD16 monocytes from RA patients. Levels of TLR9 were increased on all three subsets of blood monocytes but markedly enhanced in monocytes isolated from synovial fluids. Compared to healthy controls, CD14 CD16 monocytes of RA patients displayed an enlarged capacity to produce proinflammatory cytokines after stimulation with synthetic TLR2 and TLR9 agonists while both CD14 CD16 and CD14 CD16 monocytes showed increased response to EBV stimulation. The presence of EBV genome was also detected in monocytes and neutrophils of a significant proportion of patients. Conclusion: Patients with active RA show an increased expression of TLR2 and TLR9 on monocyte subsets and display higher prodn. of inflammatory cytokines in response to TLR agonists. The presence of EBV genome in monocytes and neutrophils reinforces the suspected role of the virus in the exacerbation of RA symptoms.
- 240Nic An Ultaigh, S.; Saber, T. P.; McCormick, J.; Connolly, M.; Dellacasagrande, J.; Keogh, B.; McCormack, W.; Reilly, M.; O’Neill, L. A.; McGuirk, P.; Fearon, U.; Veale, D. J. Blockade of Toll-like Receptor 2 Prevents Spontaneous Cytokine Release from Rheumatoid Arthritis Ex Vivo Synovial Explant Cultures. Arthritis Res. Ther. 2011, 13, R33, DOI: 10.1186/ar3261
- 241Monnet, E.; Choy, E. H.; McInnes, I.; Kobakhidze, T.; De Graaf, K.; Jacqmin, P.; Lapeyre, G.; De Min, C. Efficacy and Safety of NI-0101, an Anti-Toll-like Receptor 4 Monoclonal Antibody, in Patients with Rheumatoid Arthritis after Inadequate Response to Methotrexate: A Phase II Study. Ann. Rheum. Dis. 2020, 79, 316– 323, DOI: 10.1136/annrheumdis-2019-216487[Crossref], [PubMed], [CAS], Google Scholar241https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhslGgsb%252FM&md5=3c6f20c3b076daa62889b6b7e26705c6Efficacy and safety of NI-0101, an anti-toll-like receptor 4 monoclonal antibody, in patients with rheumatoid arthritis after inadequate response to methotrexate: a phase II studyMonnet, Emmanuel; Choy, Ernest H.; Mcinnes, Iain; Kobakhidze, Tamta; de Graaf, Kathy; Jacqmin, Philippe; Lapeyre, Genevieve; de Min, CristinaAnnals of the Rheumatic Diseases (2020), 79 (3), 316-323CODEN: ARDIAO; ISSN:0003-4967. (BMJ)Anti-citrullinated protein antibodies (ACPAs) form immune complexes with citrullinated proteins binding toll-like receptor (TLR) 4, which has been proposed as a mediator of rheumatoid arthritis (RA). NI-0101 is a first-in-class humanised monoclonal antibody blocking TLR4, as confirmed by inhibition of in vivo lipopolysaccharide-induced cytokine release in healthy volunteers. This study was design to confirm preclin. investigations supporting a biomarker-driven approach for treatment of patients with RA who present pos. for these immune complexes. Methods Placebo-controlled, double-blind, randomised (2:1) trial of the tolerability and efficacy of NI-0101 (5mg/kg, every 2 wk for 12 wk) vs. placebo in ACPA-pos. RA patients with inadequate response to methotrexate. Efficacy measures included Disease Activity Score (28-joint count) with C reactive protein (DAS28-CRP), European League Against Rheumatism (EULAR) good and moderate responses, and American College of Rheumatol. (ACR) 20, ACR50 and ACR70 responses. Subgroup analyses defined on biomarkers were conducted. Pharmacokinetics, pharmacodynamics and safety were reported. Results 90 patients were randomised (NI-0101 (61) and placebo (29)); 86 completed the study. No significant between-group difference was obsd. for any of the efficacy endpoints. Subgroup analyses using baseline parameters as covariants did not reveal any population responding to NI-0101. Treatment-emergent adverse events occurred in 51.7% of patients who received placebo vs. 52.5% for NI-0101. Conclusions We demonstrate for the first time that in RA, a human immune-mediated inflammatory disease, blocking the TLR4 pathway alone does not improve disease parameters. Successful targeting of innate immune pathways in RA may require broader and/or earlier inhibitory approaches.
- 242Monnet, E.; Shang, L.; Lapeyre, G.; DeGraaf, K.; Hatterer, E.; Buatois, V.; Elson, G.; Ferlin, W.; Gabay, C.; Sokolove, J.; Jones, S. A.; Choy, E. H.; McInnes, I. B.; Kosco-Vilbois, M.; de Min, C. AB0451 NI-0101, a Monoclonal Antibody Targeting Toll Like Receptor 4 (TLR4) Being Developed for Rheumatoid Arthritis (RA) Treatment with a Potential for Personalized Medicine. Ann. Rheum. Dis. 2015, 74, 1046, DOI: 10.1136/annrheumdis-2015-eular.3801
- 243Park, S. J.; Lee, A. N.; Youn, H. S. TBK1-Targeted Suppression of TRIF-Dependent Signaling Pathway of Toll-like Receptor 3 by Auranofin. Arch. Pharmacal Res. 2010, 33 (6), 939– 945, DOI: 10.1007/s12272-010-0618-2[Crossref], [PubMed], [CAS], Google Scholar243https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3cXosVWks7Y%253D&md5=e117c172b506aa93dd79bb69e3bf2838TBK1-targeted suppression of TRIF-dependent signaling pathway of toll-like receptor 3 by auranofinPark, Se-Jeong; Lee, A-Neum; Youn, Hyung-SunArchives of Pharmacal Research (2010), 33 (6), 939-945CODEN: APHRDQ; ISSN:0253-6269. (Pharmaceutical Society of Korea)Toll-like receptors (TLRs) play an important role in induction of innate immune responses. The stimulation of TLRs by microbial components triggers two branches of downstream signaling pathways: myeloid differential factor 88 (MyD88)- and toll-interleukin-1 receptor domain-contg. adapter inducing interferon-β (TRIF)-dependent signaling pathways. Auranofin, a sulfur-contg. gold compd. (Au[I]), has been widely used for the treatment of rheumatoid arthritis. Since dysregulation of TLRs can lead to severe systemic inflammatory and joint destructive process in rheumatoid arthritis, auranofin-mediated modulation of TLR activation may have therapeutic potential against such diseases. Previously, we demonstrated that auranofin suppressed TLR4 signaling pathway by inhibiting TLR4 dimerization induced by LPS. Here, we examd. the effect of auranofin on signal transduction via the TRIF-dependent pathway induced by a TLR3 agonist. Auranofin inhibited nuclear factor-κB and interferon (IFN) regulatory factor 3 (IRF3) activation induced by polyinosinic-polycytidylic acid (poly[I:C]). Auranofin inhibited poly[I:C]-induced phosphorylation of IRF3 as well as IFN-inducible genes such as IFN inducible protein-10. Furthermore, auranofin inhibited TBK1 kinase activity in vitro. All the results suggest that auranofin suppress TLR signaling at multiple steps.
- 244Hultqvist, M.; Nandakumar, K. S.; Björklund, U.; Holmdahl, R. Rabeximod Reduces Arthritis Severity in Mice by Decreasing Activation of Inflammatory Cells. Ann. Rheum. Dis. 2010, 69 (8), 1527– 1532, DOI: 10.1136/ard.2009.121178[Crossref], [PubMed], [CAS], Google Scholar244https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3cXhtVyktL7J&md5=04be5860a67307a3bb4ea98af0df3d92Rabeximod reduces arthritis severity in mice by decreasing activation of inflammatory cellsHultqvist, Malin; Nandakumar, Kutty Selva; Bjoerklund, Ulf; Holmdahl, RikardAnnals of the Rheumatic Diseases (2010), 69 (8), 1527-1532CODEN: ARDIAO; ISSN:0003-4967. (BMJ Publishing Group)Objectives: The novel small mol. 9-chloro-2,3-dimethyl-6-(N,N-dimethylaminoethylamino-2-oxoethyl)-6H-indolo[2,3-b] quinoxaline (Rabeximod) reduces severity of arthritis in rodent models of rheumatoid arthritis (RA) and multiple sclerosis (MS). This study aimed to investigate the cellular target in vivo. Methods: Collagen antibody-induced arthritis (CAIA) is induced by monoclonal collagen type II antibodies and enhanced by lipopolysaccharide. It was investigated how and when Rabeximod operates on inflammatory cells after stimulation of either Toll-like receptor (TLR)4 (lipopolysaccharide) or TLR2 (lipomannan) in mice lacking functional signalling through TLR4 due to a spontaneous deletion of the Tlr4 gene. Results: Rabeximod efficiently prevented arthritis during the time window when TLR2 or TLR4 ligands activate inflammatory macrophages. The effect operated downstream of TLR activation as Rabeximod was highly therapeutic in CAIA enhanced through TLR2 stimuli in TLR4 deficient mice. In addn., it was found that the arthritis ameliorating effect of Rabeximod was time dependent, since inhibition of tumor necrosis factor α prodn. from macrophages in vitro was more-pronounced if administered close to stimulation. Conclusions: Rabeximod suppresses arthritis by preventing activation of inflammatory cells, most likely macrophages, in a time dependent fashion, downstream of TLR2 and TLR4 stimulation.
- 245Samarpita, S.; Kim, J. Y.; Rasool, M. K.; Kim, K. S. Investigation of Toll-like Receptor (TLR) 4 Inhibitor TAK-242 as a New Potential Anti-Rheumatoid Arthritis Drug. Arthritis Res. Ther. 2020, 22, 16, DOI: 10.1186/s13075-020-2097-2[Crossref], [PubMed], [CAS], Google Scholar245https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXkvVGhsL4%253D&md5=448f59784a2d776c09aba7f339319496Investigation of toll-like receptor (TLR) 4 inhibitor TAK-242 as a new potential anti-rheumatoid arthritis drugSamarpita, Snigdha; Kim, Joo Young; Rasool, Mahaboob Khan; Kim, Kyoung SooArthritis Research & Therapy (2020), 22 (1), 16CODEN: ARTRCV; ISSN:1478-6362. (BioMed Central Ltd.)Abstr.: Background: Proper blocking of toll-like receptor (TLR) activation during disease progression has been reported to have inhibitory effect on the pathogenesis of rheumatoid arthritis (RA). We tested whether the TLR4 inhibitor TAK-242 had potential as a remedy for rheumatoid arthritis. Methods: The therapeutic effect of TAK-242 was tested in vitro using the human rheumatoid fibroblast-like synoviocyte (FLS) line MH7A or primary human FLS and in an adjuvant-induced arthritis (AIA) rat model. Results: TAK-242 dose dependently inhibited the increased expression of IL-6, IL-8, MMP-1, and VEGF in LPS-stimulated MH7A cells. It also inhibited the expression of IL-6 and IL-8 in poly(I:C), TLR3 activator-stimulated primary FLS, but not in IL-1β-stimulated primary FLS. These findings suggest that TAK-242 blocks a specific signaling pathway to some degree. Further, TAK-242 slightly inhibited mobilization of NF-κB into nuclei. In the AIA rat model, TAK-242 significantly reversed the body wt. and paw thickness of AIA rats to the normal state at a dose of 5 mg/kg, but not at 3 mg/kg, and reduced the increased serum level of IL-6 and VEGF in AIA rats. It also significantly ameliorated inflammatory symptoms of joint tissues at day 21 of treatment, according to histol. and RT-PCR. Conclusions: Based on the drug repositioning concept, TAK-242, which is used for the treatment of TLR4-mediated inflammatory diseases, shows potential for cost-effective development as a remedy for rheumatoid arthritis or to control the progression of RA.
- 246Danto, S. I.; Shojaee, N.; Singh, R. S. P.; Li, C.; Gilbert, S. A.; Manukyan, Z.; Kilty, I. Safety, Tolerability, Pharmacokinetics, and Pharmacodynamics of PF-06650833, a Selective Interleukin-1 Receptor-Associated Kinase 4 (IRAK4) Inhibitor, in Single and Multiple Ascending Dose Randomized Phase 1 Studies in Healthy Subjects. Arthritis Res. Ther. 2019, 21, 269, DOI: 10.1186/s13075-019-2008-6[Crossref], [PubMed], [CAS], Google Scholar246https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXitl2ltrzP&md5=599d00ecb52c094cea8e8322fd957f98Safety, tolerability, pharmacokinetics, and pharmacodynamics of PF-06650833, a selective interleukin-1 receptor-associated kinase 4 (IRAK4) inhibitor, in single and multiple ascending dose randomized phase 1 studies in healthy subjectsDanto, Spencer I.; Shojaee, Negin; Singh, Ravi Shankar P.; Li, Cheryl; Gilbert, Steven A.; Manukyan, Zorayr; Kilty, IainArthritis Research & Therapy (2019), 21 (1), 269CODEN: ARTRCV; ISSN:1478-6362. (BioMed Central Ltd.)Background: PF-06650833 is a potent, selective inhibitor of interleukin-1 receptor-assocd. kinase 4 (IRAK4). Two randomized, double-blind, sponsor-open phase 1 studies evaluated the safety, pharmacokinetics, and pharmacodynamics of single (SAD) and multiple ascending doses (MAD) of PF-06650833 immediate-release (IR) and modified-release (MR) oral formulations in healthy adult subjects. Methods: Study 1 (NCT02224651) was a 96-day, placebo-substitution, SAD study of once-daily (QD) oral PF-06650833 IR 1 to 6000 mg and MR 30 to 300 mg in fasted and fed states. Study 2 (NCT02485769) was a 14-day, placebo-controlled, MAD study of PF-06650833 IR 25 to 750 mg twice daily, IR 1000 mg four times per day, IR 330 mg three times per day, and MR 300 mg QD. Results: PF-06650833 was generally well tolerated, with no dose-limiting treatment-emergent adverse events (TEAEs) identified in either study. TEAEs were generally mild in severity, with headache, gastrointestinal disorders, and acne most commonly reported. No serious AEs or deaths were reported. A max. tolerated dose was not established in either study. In the SAD study, food intake delayed absorption of IR 30 mg and increased total exposure by 33%. Delayed absorption was achieved with the MR formulation (Tmax of 1 h vs. 8 h for IR 100 mg and MR 100 mg formulations, resp.). Food had no effect on total exposure for MR 30 mg, but reduced half-life 1.8-fold and increased Cmax by 62%. In the MAD study, accumulation ranged from 0.9-fold to 1.4-fold for AUCtau and 0.9-fold to 1.3-fold for Cmax. Less than 1% of the dose was recovered unchanged in urine for all dose groups, with renal clearance ranging from 14 to 23 mL/min for IR < 750 mg and MR 300 mg. There was a sustained decrease in serum high-sensitivity C-reactive protein for IR ≥ 250 mg and MR 300 mg. Based on the cholesterol/hydroxycholesterol ratio, no apparent CYP3A induction or inhibition was obsd. Conclusions: PF-06650833, the first IRAK4 inhibitor to enter clin. development, has a favorable safety and pharmacokinetic profile and has shown evidence of pharmacol. effect. The data support continued evaluation in human clin. trials for the treatment of rheumatic and autoimmune diseases. Trial registration: Clinicaltrials.gov, NCT02224651, registered 25 August 2014; NCT02485769, registered 30 June 2015.
- 247Zhang, S.; Hu, Z.; Tanji, H.; Jiang, S.; Das, N.; Li, J.; Sakaniwa, K.; Jin, J.; Bian, Y.; Ohto, U.; Shimizu, T.; Yin, H. Small-Molecule Inhibition of TLR8 through Stabilization of Its Resting State. Nat. Chem. Biol. 2018, 14 (1), 58– 64, DOI: 10.1038/nchembio.2518[Crossref], [PubMed], [CAS], Google Scholar247https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXhvVaksrjN&md5=1b43da16d6670324d77bb5e2c417cfe6Small-molecule inhibition of TLR8 through stabilization of its resting stateZhang, Shuting; Hu, Zhenyi; Tanji, Hiromi; Jiang, Shuangshuang; Das, Nabanita; Li, Jing; Sakaniwa, Kentaro; Jin, Jin; Bian, Yanyan; Ohto, Umeharu; Shimizu, Toshiyuki; Yin, HangNature Chemical Biology (2018), 14 (1), 58-64CODEN: NCBABT; ISSN:1552-4450. (Nature Research)Endosomal Toll-like receptors (TLR3, TLR7, TLR8, and TLR9) are highly analogous sensors for various viral or bacterial RNA and DNA mol. patterns. Nonetheless, few small mols. can selectively modulate these TLRs. In this manuscript, we identified the first human TLR8-specific small-mol. antagonists via a novel inhibition mechanism. Crystal structures of two distinct TLR8-ligand complexes validated a unique binding site on the protein-protein interface of the TLR8 homodimer. Upon binding to this new site, the small-mol. ligands stabilize the preformed TLR8 dimer in its resting state, preventing activation. As a proof of concept of their therapeutic potential, we have demonstrated that these drug-like inhibitors are able to suppress TLR8-mediated proinflammatory signaling in various cell lines, human primary cells, and patient specimens. These results not only suggest a novel strategy for TLR inhibitor design, but also shed crit. mechanistic insight into these clin. important immune receptors.
- 248Schrezenmeier, E.; Dörner, T. Mechanisms of Action of Hydroxychloroquine and Chloroquine: Implications for Rheumatology. Nat. Rev. Rheumatol. 2020, 16 (3), 155– 166, DOI: 10.1038/s41584-020-0372-x[Crossref], [PubMed], [CAS], Google Scholar248https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXjs12lt7o%253D&md5=ff48f9141342d1007f5a633ba01f0c51Mechanisms of action of hydroxychloroquine and chloroquine: implications for rheumatologySchrezenmeier, Eva; Doerner, ThomasNature Reviews Rheumatology (2020), 16 (3), 155-166CODEN: NRRACB; ISSN:1759-4790. (Nature Research)A review. Abstr.: Despite widespread clin. use of antimalarial drugs such as hydroxychloroquine and chloroquine in the treatment of rheumatoid arthritis (RA), systemic lupus erythematosus (SLE) and other inflammatory rheumatic diseases, insights into the mechanism of action of these drugs are still emerging. Hydroxychloroquine and chloroquine are weak bases and have a characteristic 'deep' vol. of distribution and a half-life of around 50 days. These modes of action, together with the drug's chem. properties, might explain the clin. efficacy and well-known adverse effects (such as retinopathy) of these drugs. The unknown dose-response relationships of these drugs and the lack of definitions of the min. dose needed for clin. efficacy and what doses are toxic pose challenges to clin. practice. Further challenges include patient non-adherence and possible context-dependent variations in blood drug levels. Available mechanistic data give insights into the immunomodulatory potency of hydroxychloroquine and provide the rationale to search for more potent and/or selective inhibitors.
- 249Crispín, J. C.; Liossis, S. N. C.; Kis-Toth, K.; Lieberman, L. A.; Kyttaris, V. C.; Juang, Y. T.; Tsokos, G. C. Pathogenesis of Human Systemic Lupus Erythematosus: Recent Advances. Trends Mol. Med. 2010, 16 (2), 47– 57, DOI: 10.1016/j.molmed.2009.12.005[Crossref], [PubMed], [CAS], Google Scholar249https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3cXitVKgsbg%253D&md5=fc33acf6d94ca93ecd6181d71a71dd13Pathogenesis of human systemic lupus erythematosus: recent advancesCrispin, Jose C.; Liossis, Stamatis-Nick C.; Kis-Toth, Katalin; Lieberman, Linda A.; Kyttaris, Vasileios C.; Juang, Yuang-Taung; Tsokos, George C.Trends in Molecular Medicine (2010), 16 (2), 47-57CODEN: TMMRCY; ISSN:1471-4914. (Elsevier B.V.)A review. Systemic lupus erythematosus (SLE) is an autoimmune disease with manifestations derived from the involvement of multiple organs including the kidneys, joints, nervous system and hematopoietic organs. Immune system aberrations, as well as heritable, hormonal and environmental factors interplay in the expression of organ damage. Recent contributions from different fields have developed our understanding of SLE and reshaped current pathogenic models. Here, we review recent findings that deal with (i) genes assocd. with disease expression; (ii) immune cell mol. abnormalities that lead to autoimmune pathol.; (iii) the role of hormones and sex chromosomes in the development of disease; and (iv) environmental and epigenetic factors thought to contribute to the expression of SLE. Finally, we highlight mol. defects intimately assocd. with the disease process of SLE that might represent ideal therapeutic targets and disease biomarkers.
- 250Berden, J. H. M. Lupus Nephritis. Kidney Int. 1997, 52 (2), 538– 558, DOI: 10.1038/ki.1997.365[Crossref], [PubMed], [CAS], Google Scholar250https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADyaK2svgvFKmsQ%253D%253D&md5=96cf334679e4ef09dd4622ed92bf7ea3Lupus nephritisBerden J HKidney international (1997), 52 (2), 538-58 ISSN:0085-2538.There is no expanded citation for this reference.
- 251Kruse, K.; Janko, C.; Urbonaviciute, V.; Mierke, C. T.; Winkler, T. H.; Voll, R. E.; Schett, G.; Muñoz, L. E.; Herrmann, M. Inefficient Clearance of Dying Cells in Patients with SLE: Anti-DsDNA Autoantibodies, MFG-E8, HMGB-1 and Other Players. Apoptosis 2010, 15 (9), 1098– 1113, DOI: 10.1007/s10495-010-0478-8[Crossref], [PubMed], [CAS], Google Scholar251https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3cXhtVyrurfK&md5=655157e3ce81245332a1d35304f1a17eInefficient clearance of dying cells in patients with SLE: anti-dsDNA autoantibodies, MFG-E8, HMGB-1 and other playersKruse, Kristin; Janko, Christina; Urbonaviciute, Vilma; Mierke, Claudia T.; Winkler, Thomas H.; Voll, Reinhard E.; Schett, Georg; Munoz, Luis E.; Herrmann, MartinApoptosis (2010), 15 (9), 1098-1113CODEN: APOPFN; ISSN:1360-8185. (Springer)A review. Systemic lupus erythematosus (SLE) is a complex disease resulting from inflammatory responses of the immune system against several autoantigens. Inflammation is conditioned by the continuous presence of autoantibodies and leaked autoantigens, e.g. from not properly cleared dying and dead cells. Various sol. mols. and biophys. properties of the surface of apoptotic cells play significant roles in the appropriate recognition and further processing of dying and dead cells. We exemplarily discuss how Milk fat globule epidermal growth factor 8 (MFG-E8), biophys. membrane alterations, High mobility group box 1 (HMGB1), C-reactive protein (CRP), and anti-nuclear autoantibodies may contribute to the etiopathogenesis of the disease. Up to date knowledge about these key elements may provide new insights that lead to the development of new treatment strategies of the disease.
- 252Lartigue, A.; Colliou, N.; Calbo, S.; François, A.; Jacquot, S.; Arnoult, C.; Tron, F.; Gilbert, D.; Musette, P. Critical Role of TLR2 and TLR4 in Autoantibody Production and Glomerulonephritis in Lpr Mutation-Induced Mouse Lupus. J. Immunol. 2009, 183 (10), 6207– 6216, DOI: 10.4049/jimmunol.0803219[Crossref], [PubMed], [CAS], Google Scholar252https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1MXhtlKhsbnM&md5=181eaee137dcdee345ca0592bba70a06Critical Role of TLR2 and TLR4 in Autoantibody Production and Glomerulonephritis in lpr Mutation-Induced Mouse LupusLartigue, Aurelia; Colliou, Natacha; Calbo, Sebastien; Francois, Arnault; Jacquot, Serge; Arnoult, Christophe; Tron, Francois; Gilbert, Daniele; Musette, PhilippeJournal of Immunology (2009), 183 (10), 6207-6216CODEN: JOIMA3; ISSN:0022-1767. (American Association of Immunologists)Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by pathogenic autoantibodies directed against nuclear Ags and immune complex deposits in damaged organs. Environmental factors have been thought to play a role in the onset of the disease. The recognition of these factors is mediated by TLRs, in particular TLR2 and TLR4 which bind pathogen-assocd. mol. patterns of Gram+ and Gram- bacteria, resp. The authors attempted to det. the role of these TLRs in SLE by creating TLR2- or TLR4-deficient C57BL/6lpr/lpr mice. These mice developed a less severe disease and fewer immunol. alterations. Indeed, in C57BL/6lpr/lpr-TLR2 or -TLR4-deficient mice, glomerular IgG deposits and mesangial cell proliferation were dramatically decreased and antinuclear, anti-dsDNA, and anti-cardiolipin autoantibody titers were significantly reduced. However, the response against nucleosome remained unaffected, indicating a role of TLR2 and TLR4 in the prodn. of Abs directed against only certain categories of SLE-related autoantigens. Anal. of B cell phenotype showed a significant redn. of marginal zone B cells, particularly in C57BL/6lpr/lpr-TLR4-deficient mice, suggesting an important role of TLR4 in the sustained activation of these cells likely involved in autoantibody prodn. Interestingly, the lack of TLR4 also affected the prodn. of cytokines involved in the development of lupus disease.
- 253Liu, B.; Yang, Y.; Dai, J.; Medzhitov, R.; Freudenberg, M. A.; Zhang, P. L.; Li, Z. TLR4 Up-Regulation at Protein or Gene Level Is Pathogenic for Lupus-Like Autoimmune Disease. J. Immunol. 2006, 177 (10), 6880– 6888, DOI: 10.4049/jimmunol.177.10.6880[Crossref], [PubMed], [CAS], Google Scholar253https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD28XhtFGrtr3P&md5=61a5b310bb7b26247f0cb419c825ccdbTLR4 Up-Regulation at Protein or Gene Level Is Pathogenic for Lupus-Like Autoimmune DiseaseLiu, Bei; Yang, Yi; Dai, Jie; Medzhitov, Ruslan; Freudenberg, Marina A.; Zhang, Ping L.; Li, ZihaiJournal of Immunology (2006), 177 (10), 6880-6888CODEN: JOIMA3; ISSN:0022-1767. (American Association of Immunologists)TLR4 is the receptor for the Gram-neg. bacterial cell wall component LPS. TLR4 signaling is controlled by both pos. and neg. regulators to balance optimal immune response and potential sepsis. Unchecked TLR4 activation might result in autoimmune diseases, a hypothesis that has not been formally resolved. In this study, we found that TLR4 signaling to LPS can be pos. enforced by expressing gp96 on cell surfaces through the chaperone function of, but not the direct signaling by, gp96; TLR4 as well as the commensal flora are essential for the prodn. of anti-dsDNA Ab and the immune complex-mediated glomerulonephritis in transgenic mice that express surface gp96. Moreover, a similar constellation of autoimmunity was evident in mice that encode multiple copies of tlr4 gene. Our study has revealed that increased TLR4 signaling alone without exogenous insult can break immunol. tolerance. It provides a strong exptl. evidence for TLR4 dysregulation as an etiol. of lupus-like renal disease.
- 254Patole, P. S.; Gröne, H. J.; Segerer, S.; Ciubar, R.; Belemezova, E.; Henger, A.; Kretzler, M.; Schlöndorff, D.; Anders, H. J. Viral Double-Stranded RNA Aggravates Lupus Nephritis through Toll-like Receptor 3 on Glomerular Mesangial Cells and Antigen-Presenting Cells. J. Am. Soc. Nephrol. 2005, 16 (5), 1326– 1338, DOI: 10.1681/ASN.2004100820[Crossref], [PubMed], [CAS], Google Scholar254https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2MXksF2gsL0%253D&md5=e70cc091377dce345254dd13f9ddd839Viral double-stranded RNA aggravates lupus nephritis through Toll-like receptor 3 on glomerular mesangial cells and antigen-presenting cellsPatole, Prashant S.; Groene, Hermann-Josef; Segerer, Stephan; Ciubar, Raluca; Belemezova, Emilia; Henger, Anna; Kretzler, Matthias; Schloendorff, Detlef; Anders, Hans-JoachimJournal of the American Society of Nephrology (2005), 16 (5), 1326-1338CODEN: JASNEU; ISSN:1046-6673. (American Society of Nephrology)How viral infections trigger autoimmunity is poorly understood. A role for Toll-like receptor 3 (TLR3) was hypothesized in this context as viral double-stranded RNA (dsRNA) activates dendritic cells to secrete type I interferons and cytokines that are known to be assocd. with the disease activity in systemic lupus erythematosus (SLE). Immunostaining of nephritic kidney sections of autoimmune MRLlpr/lpr mice revealed TLR3 expression in infiltrating antigen-presenting cells as well as in glomerular mesangial cells. TLR3-pos. cultured mesangial cells that were exposed to synthetic polyinosinic-cytidylic acid (pI:C) RNA in vitro produced CCL2 and IL-6. PI:C RNA activated macrophages and dendritic cells, both isolated from MRLlpr/lpr mice, to secrete multiple proinflammatory factors. In vivo, a single injection of pI:C RNA increased serum IL-12p70, IL-6, and IFN-α levels. A course of 50 μg of pI:C RNA given every other day from weeks 16 to 18 of age aggravated lupus nephritis in pI:C-treated MRLlpr/lpr mice. Serum DNA autoantibody levels were unaltered upon systemic exposure to pI:C RNA in MRLlpr/lpr mice, as pI:C RNA, in contrast to CpG-DNA, failed to induce B cell activation. It therefore was concluded that viral dsRNA triggers disease activity of lupus nephritis by mechanisms that are different from those of bacterial DNA. In contrast to CpG-DNA/TLR9 interaction, pI:C RNA/TLR3-mediated disease activity is B cell independent, but activated intrinsic renal cells, e.g., glomerular mesangial cells, to produce cytokines and chemokines, factors that can aggravate autoimmune tissue injury, e.g., lupus nephritis.
- 255Kono, D. H.; Haraldsson, M. K.; Lawson, B. R.; Pollard, K. M.; Koh, Y. T.; Du, X.; Arnold, C. N.; Baccala, R.; Silverman, G. J.; Beutler, B. A.; Theofilopoulos, A. N. Endosomal TLR Signaling Is Required for Anti-Nucleic Acid and Rheumatoid Factor Autoantibodies in Lupus. Proc. Natl. Acad. Sci. U. S. A. 2009, 106 (29), 12061– 12066, DOI: 10.1073/pnas.0905441106[Crossref], [PubMed], [CAS], Google Scholar255https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1MXps1anu74%253D&md5=3812823416bb9e99967500d6ae3102ecEndosomal TLR signaling is required for anti-nucleic acid and rheumatoid factor autoantibodies in lupusKono, Dwight H.; Haraldsson, M. Katarina; Lawson, Brian R.; Pollard, K. Michael; Koh, Yi Ting; Du, Xin; Arnold, Carrie N.; Baccala, Roberto; Silverman, Gregg J.; Beutler, Bruce A.; Theofilopoulos, Argyrios N.Proceedings of the National Academy of Sciences of the United States of America (2009), 106 (29), 12061-12068, S12061/1-S12061/8CODEN: PNASA6; ISSN:0027-8424. (National Academy of Sciences)Using the Unc93b1 3d mutation that selectively abolishes nucleic acid-binding Toll-like receptor (TLR) (TLR3, -7, -9) signaling, the authors show these endosomal TLRs are required for optimal prodn. of IgG autoAbs, IgM rheumatoid factor, and other clin. parameters of disease in 2 lupus strains, B6-FasPrlpr and BXSB. Strikingly, treatment with lipid A, an autoAb-inducing TLR4 agonist, could not overcome this requirement. The 3d mutation slightly reduced complete Freund's adjuvant (CFA)-mediated antigen presentation, but did not affect T-independent type 1 or alum-mediated T-dependent humoral responses or TLR-independent IFN prodn. induced by cytoplasmic nucleic acids. These findings suggest that nucleic acid-sensing TLRs might act as an Achilles' heel in susceptible individuals by providing a crit. pathway by which relative tolerance for nucleic acid-contg. antigens is breached and systemic autoimmunity ensues. Importantly, this helps provide an explanation for the high frequency of anti-nucleic acid Abs in lupus-like systemic autoimmunity.
- 256Lyn-Cook, B. D.; Xie, C.; Oates, J.; Treadwell, E.; Word, B.; Hammons, G.; Wiley, K. Increased Expression of Toll-like Receptors (TLRs) 7 and 9 and Other Cytokines in Systemic Lupus Erythematosus (SLE) Patients: Ethnic Differences and Potential New Targets for Therapeutic Drugs. Mol. Immunol. 2014, 61 (1), 38– 43, DOI: 10.1016/j.molimm.2014.05.001[Crossref], [PubMed], [CAS], Google Scholar256https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXps12itrg%253D&md5=6ed3e427b3b6074c768ba3badce67f27Increased expression of Toll-like receptors (TLRs) 7 and 9 and other cytokines in systemic lupus erythematosus (SLE) patients: Ethnic differences and potential new targets for therapeutic drugsLyn-Cook, Beverly D.; Xie, Chenghui; Oates, Jarren; Treadwell, Edward; Word, Beverly; Hammons, George; Wiley, KennethMolecular Immunology (2014), 61 (1), 38-43CODEN: MOIMD5; ISSN:0161-5890. (Elsevier)Increased expression of pro-inflammatory cytokines such as interferon, tumor necrosis factors (TNFs) and specific interleukins (ILs) has been found in a no. of autoimmune diseases, including systemic lupus erythematosus (SLE). These cytokines are induced by toll-like receptors (TLRs). Toll-like receptors are activated in response to accumulation of apoptotic bodies. These receptors play crit. roles in innate immune systems. Increased levels of interferon-alpha (INF-α) have also been found in many SLE patients and often correlate with disease severity. The objectives of this study were to examine the expression of selected TLRs and cytokines that have been identified in animal models and some limited human studies in a group of African Americans (AA) and European Americans (EA) women with lupus in comparison to age-matched non-lupus women. Blood samples were consecutively obtained by informed consent from 286 patients, 153 lupus and 136 non-lupus, seen in the rheumatol. clinics at East Carolina University. Cytokines were analyzed from blood serum using enzyme linked immunoassay (ELISA) for IL-6 and INF-α. Total RNA was isolated, using a Paxgene kit, from peripheral blood mononuclear cells of African American and European American women blood samples. Quant. real-time PCR using the CFX real-time system was conducted on all samples to det. TLRs 7 and 9, as well as INF-α expression. Toll-like receptor 7 (p < 0.01) and 9 (p = 0.001) expression levels were significantly increased in lupus patients compared to age-matched controls. African American women with lupus had a 2-fold increase in TLR-9 expression level when compared to their healthy controls or European American lupus patients. However, there was no ethnic difference in expression of TLR-7 in lupus patients. INF-α expression was significantly higher in lupus patients (p < 0.0001) and also showed ethnic difference in expression. Serum levels revealed significant increases in expression of IL-6, IFN-γ and TNF-α in lupus patients compared to non-lupus patients. African American women with lupus had significantly higher serum levels of IL-6 and TNF-α. African American women with lupus demonstrated increased levels of specific pro-inflammatory cytokines and Toll-like receptors when compared to EA women. Increased expression in these lupus patients provides an opportunity for targeting with antagonist as a new therapy for systemic lupus erythematosus.
- 257Tran, N. L.; Manzin-Lorenzi, C.; Santiago-Raber, M. L. Toll-like Receptor 8 Deletion Accelerates Autoimmunity in a Mouse Model of Lupus through a Toll-like Receptor 7-Dependent Mechanism. Immunology 2015, 145 (1), 60– 70, DOI: 10.1111/imm.12426[Crossref], [PubMed], [CAS], Google Scholar257https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXmtlCltrg%253D&md5=f89e9fa89336cf8585ee60a99047dbf8Toll-like receptor 8 deletion accelerates autoimmunity in a mouse model of lupus through a Toll-like receptor 7-dependent mechanismTran, Ngoc Lan; Manzin-Lorenzi, Celine; Santiago-Raber, Marie-LaureImmunology (2015), 145 (1), 60-70CODEN: IMMUAM; ISSN:0019-2805. (Wiley-Blackwell)Summary : Systemic lupus erythematosus is an autoimmune disorder characterized by increased levels of lymphocyte activation, antigen presentation by dendritic cells, and the formation of autoantibodies. This leads to immune complex-mediated glomerulonephritis. Toll-like receptor 7 (T7) and TLR9 localize to the endosomal compartment and play important roles in the generation of autoantibodies against nuclear components, as they recognize RNA and DNA, resp. In contrast, very little is known about endogenous TLR8 activation in mice. We therefore tested whether TLR8 could affect autoimmune responses in a murine model of lupus. We introduced a Tlr8 null mutation into C57BL/6 mice congenic for the Nba2 (NZB autoimmunity 2) locus and bearing the Yaa (Y-linked autoimmune acceleration) mutation contg. a tlr8 duplicated gene, and monitored disease development, autoantibody prodn., and glomerulonephritis-assocd. mortality. Cellular responses were investigated in female Nba2.TLR8-/- mice bearing no copy of tlr8. The TLR8 deficiency accelerated disease progression and mortality, increased the no. of circulating antibodies and activated monocytes, and heightened cellular responses to TLR7 ligation. TLR8-deficient antigen-presenting cells exhibited increased levels of MHC class II expression. The ability of dendritic cells to present antigens to allogeneic T cells after TLR7 ligation was also improved by TLR8 deficiency. TLR8 deletion accelerated autoimmunity in lupus-prone mice in response to TLR7 activation. Antigen-presenting cell function seemed to play a key role in mediating the effects of TLR8 deficiency.
- 258Capolunghi, F.; Rosado, M. M.; Cascioli, S.; Girolami, E.; Bordasco, S.; Vivarelli, M.; Ruggiero, B.; Cortis, E.; Insalaco, A.; Fantò, N.; Gallo, G.; Nucera, E.; Loiarro, M.; Sette, C.; De santis, R.; Carsetti, R.; Ruggiero, V. Pharmacological Inhibition of TLR9 Activation Blocks Autoantibody Production in Human B Cells from SLE Patients. Rheumatology 2010, 49 (12), 2281– 2289, DOI: 10.1093/rheumatology/keq226[Crossref], [PubMed], [CAS], Google Scholar258https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3cXhsVejsbvL&md5=edc6431fd556925d261aef28885ce317Pharmacological inhibition of TLR9 activation blocks autoantibody production in human B cells from SLE patientsCapolunghi, Federica; Rosado, Maria M.; Cascioli, Simona; Girolami, Elia; Bordasco, Silvia; Vivarelli, Marina; Ruggiero, Barbara; Cortis, Elisabetta; Insalaco, Antonella; Fanto, Nicola; Gallo, Grazia; Nucera, Eleonora; Loiarro, Maria; Sette, Claudio; De Santis, Rita; Carsetti, Rita; Ruggiero, VitoRheumatology (Oxford, United Kingdom) (2010), 49 (12), 2281-2289CODEN: RUMAFK; ISSN:1462-0324. (Oxford University Press)Toll-like receptor 9 (TLR9), which recognizes hypomethylated DNA [cytosine-phosphate-guanine (CpG)], plays a role in the maintenance of serol. memory and has been recently implicated in the pathogenesis of SLE. We previously reported that in vitro TLR9 triggers memory B-cell differentiation into antibody-producing cells, and that the MyD88-inhibitor ST2825 blocks TLR9-induced plasma cell (PC) generation. Here, we investigated whether memory B cells produce autoantibodies in SLE patients with active disease or in clin. remission, and whether ST2825 could inhibit PC generation in SLE patients. Peripheral blood mononuclear cells from 10 SLE patients in clin. remission and 2 with active SLE were cultured in the presence of CpG with or without ST2825. Phenotypical anal. of CpG-stimulated cells was performed by flow cytometry. Supernatants were collected to measure antibody prodn. by ELISA and to detect autoantibodies by IF. CpG-induced TLR9 stimulation caused autoantibody secretion in patients with active disease and in the majority of patients in clin. remission. Inhibition of MyD88 completely blocked the de novo generation of PCs and the secretion of autoantibodies. Autoreactive B cells persist in SLE patients during disease remission in the circulating B-cell memory pool. TLR9-dependent activation of memory B cells by pathogens could be one of the mechanisms triggering relapses in SLE. Compds. targeting the TLR/MyD88 pathway may be used as novel therapeutic tools to treat acute disease and to prevent relapses in SLE patients.
- 259Li, B.; Xia, Y.; Hu, B. Infection and Atherosclerosis: TLR-Dependent Pathways. Cell. Mol. Life Sci. 2020, 77, 2751– 2769, DOI: 10.1007/s00018-020-03453-7[Crossref], [PubMed], [CAS], Google Scholar259https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXislertLg%253D&md5=07704c5f6e50f4ad7f71ca73ac4662acInfection and atherosclerosis: TLR-dependent pathwaysLi, Bowei; Xia, Yuanpeng; Hu, BoCellular and Molecular Life Sciences (2020), 77 (14), 2751-2769CODEN: CMLSFI; ISSN:1420-682X. (Birkhaeuser Basel)Abstr.: Atherosclerotic vascular disease (ASVD) is a chronic process, with a progressive course over many years, but it can cause acute clin. events, including acute coronary syndromes (ACS), myocardial infarction (MI) and stroke. In addn. to a series of typical risk factors for atherosclerosis, like hyperlipidemia, hypertension, smoking and obesity, emerging evidence suggests that atherosclerosis is a chronic inflammatory disease, suggesting that chronic infection plays an important role in the development of atherosclerosis. Toll-like receptors (TLRs) are the most characteristic members of pattern recognition receptors (PRRs), which play an important role in innate immune mechanism. TLRs play different roles in different stages of infection of atherosclerosis-related pathogens such as Chlamydia pneumoniae (C. pneumoniae), periodontal pathogens including Porphyromonas gingivalis (P. gingivalis), Helicobacter pylori (H. pylori) and human immunodeficiency virus (HIV). Overall, activation of TLR2 and 4 seems to have a profound impact on infection-related atherosclerosis. This article reviews the role of TLRs in the process of atherosclerosis after C. pneumoniae and other infections and the current status of treatment, with a view to providing a new direction and potential therapeutic targets for the study of ASVD.
- 260Zhou, Y.; Little, P. J.; Downey, L.; Afroz, R.; Wu, Y.; Ta, H. T.; Xu, S.; Kamato, D. The Role of Toll-like Receptors in Atherothrombotic Cardiovascular Disease. ACS Pharmacol. Transl. Sci. 2020, 3 (3), 457– 471, DOI: 10.1021/acsptsci.9b00100[ACS Full Text], [CAS], Google Scholar260https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXisVSgsrY%253D&md5=3c7a9c4c6f0599a63cf5dfd8f785d4b5The Role of Toll-like Receptors in Atherothrombotic Cardiovascular DiseaseZhou, Ying; Little, Peter J.; Downey, Liam; Afroz, Rizwana; Wu, Yuao; Ta, Hang T.; Xu, Suowen; Kamato, DanielleACS Pharmacology & Translational Science (2020), 3 (3), 457-471CODEN: APTSFN; ISSN:2575-9108. (American Chemical Society)A review. Toll-like receptors (TLRs) are dominant components of the innate immune system. Activated by both pathogen-assocd. mol. patterns and damage-assocd. mol. patterns, TLRs underpin the pathol. of numerous inflammation related diseases that include not only immune diseases, but also cardiovascular disease (CVD), diabetes, obesity, and cancers. Growing evidence has demonstrated that TLRs are involved in multiple cardiovascular pathophysiologies, such as atherosclerosis and hypertension. Specifically, a trial called the Canakinumab Anti-inflammatory Thrombosis Outcomes Study showed the use of an antibody that neutralizes interleukin-1β, reduces the recurrence of cardiovascular events, demonstrating inflammation as a therapeutic target and also the research value of targeting the TLR system in CVD. In this review, we provide an update of the interplay between TLR signaling, inflammatory mediators, and atherothrombosis, with an aim to identify new therapeutic targets for atherothrombotic CVD.
- 261Adamczak, D. M. The Role of Toll-like Receptors and Vitamin D in Cardiovascular Diseases—a Review. Int. J. Mol. Sci. 2017, 18 (11), 2252, DOI: 10.3390/ijms18112252[Crossref], [CAS], Google Scholar261https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXitVOgtb7P&md5=f78e0032068738867f154e85c55bee37The role of toll-like receptors and vitamin d in cardiovascular diseases-a reviewAdamczak, Daria M.International Journal of Molecular Sciences (2017), 18 (11), 2252/1-2252/23CODEN: IJMCFK; ISSN:1422-0067. (MDPI AG)Cardiovascular diseases are the leading cause of mortality worldwide. Therefore, a better understanding of their pathomechanisms and the subsequent implementation of optimal prophylactic and therapeutic strategies are of utmost importance. A growing body of evidence states that low-grade inflammation is a common feature for most of the cardiovascular diseases in which the contributing factors are the activation of toll-like receptors (TLRs) and vitamin D deficiency. In this article, available data concerning the assocn. of cardiovascular diseases with TLRs and vitamin D status are reviewed, followed by a discussion of new possible approaches to cardiovascular disease management.
- 262Balistreri, C. R.; Ruvolo, G.; Lio, D.; Madonna, R. Toll-like Receptor-4 Signaling Pathway in Aorta Aging and Diseases: “Its Double Nature.. J. Mol. Cell. Cardiol. 2017, 110, 38– 53, DOI: 10.1016/j.yjmcc.2017.06.011[Crossref], [PubMed], [CAS], Google Scholar262https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXht1Sjs7jP&md5=dae8d3f2bea57480c0918bd5074d2464Toll-like receptor-4 signaling pathway in aorta aging and diseases: "its double nature"Balistreri, Carmela Rita; Ruvolo, Giovanni; Lio, Domenico; Madonna, RosalindaJournal of Molecular and Cellular Cardiology (2017), 110 (), 38-53CODEN: JMCDAY; ISSN:0022-2828. (Elsevier B.V.)Recent advances in the field of innate immunity have revealed a complex role of innate immune signaling pathways in both tissue homeostasis and disease. Among them, the Toll-like receptor 4 (TLR-4) pathways has been linked to various pathophysiol. conditions, such as cardiovascular diseases (CVDs). This has been interrogated by developing multiple lab. tools that have shown in animal models and clin. conditions, the involvement of the TLR-4 signaling pathway in the pathophysiol. of different CVDs, such as atherosclerosis, ischemic heart disease, heart failure, ischemia-reperfusion injury and aorta aneurysm. Among these, aorta aneurysm, a very complex pathol. condition with uncertain etiol. and fatal complications (i.e. dissection and rupture), has been assocd. with the occurrence of high risk cardiovascular conditions, including thrombosis and embolism. In this review, we discuss the possible role of TLR-4 signaling pathway in the development of aorta aneurysm, considering the emerging evidence from ongoing investigations. Our message is that emphasizing the role of TLR-4 signaling pathway in aorta aneurysm may serve as a starting point for future studies, leading to a better understanding of the pathophysiol. basis and perhaps the effective treatment of this difficult human disease.
- 263Bomfim, G. F.; Echem, C.; Martins, C. B.; Costa, T. J.; Sartoretto, S. M.; Dos Santos, R. A.; Oliveira, M. A.; Akamine, E. H.; Fortes, Z. B.; Tostes, R. C.; Webb, R. C.; Carvalho, M. H. C. Toll-like Receptor 4 Inhibition Reduces Vascular Inflammation in Spontaneously Hypertensive Rats. Life Sci. 2015, 122, 1– 7, DOI: 10.1016/j.lfs.2014.12.001[Crossref], [PubMed], [CAS], Google Scholar263https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXhslymsg%253D%253D&md5=082297038c8e78db63b1c84b60e04bb3Toll-like receptor 4 inhibition reduces vascular inflammation in spontaneously hypertensive ratsBomfim, G. F.; Echem, C.; Martins, C. B.; Costa, T. J.; Sartoretto, S. M.; Dos Santos, R. A.; Oliveira, M. A.; Akamine, E. H.; Fortes, Z. B.; Tostes, R. C.; Webb, R. C.; Carvalho, M. H. C.Life Sciences (2015), 122 (), 1-7CODEN: LIFSAK; ISSN:0024-3205. (Elsevier B.V.)Hypertension is assocd. with increased levels of circulating cytokines and recent studies have shown that innate immunity contributes to hypertension. The mechanisms which hypertension stimulates immune response remain unclear, but may involve formation of neo-antigens that activate the immune system. Toll like receptor 4 (TLR4) is an innate immune receptor that binds a wide spectrum of exogenous (lipopolysaccharide) and endogenous ligands. TLR4 signaling leads to activation of nuclear factor kappa B (NFκB) and transcription of genes involved in inflammatory response. We previously demonstrated that TLR4 blockade reduces blood pressure and the augmented vascular contractility in spontaneously hypertensive rats (SHR). Here we hypothesized that inhibition of TLR4 ameliorates the vascular inflammatory process by a NFκB signaling pathway.SHR and Wistar rats were treated with anti-TLR4 antibody (1 μg/day) or unspecific IgG for 15 days (i.p.).Anti-TLR4 treatment decreased prodn. of reactive oxygen species and expression of IL-6 cytokine in mesenteric resistance arteries from SHR, when compared with IgG-treated SHR. Anti-TLR4 treatment also abolished the increased vascular reactivity to noradrenaline obsd. in IgG-treated SHR, as described before, and inhibition of NFκB decreased noradrenaline responses only in IgG-treated SHR. Mesenteric arteries from SHR treated with anti-TLR4 displayed decreased expression of MyD88, but not TRIF, key mols. in TLR4 signaling. Phosphorylation of p38 and NF-κB p65 were decreased in arteries from anti-TLR4-treated SHR vs. IgG-treated SHR.Together, these results suggest that TLR4 is a key player in hypertension and vascular inflammatory process by a NFκB signaling pathway.
- 264Kim, J.; Yoo, J. Y.; Suh, J. M.; Park, S.; Kang, D.; Jo, H.; Bae, Y. S. The Flagellin-TLR5-Nox4 Axis Promotes the Migration of Smooth Muscle Cells in Atherosclerosis. Exp. Mol. Med. 2019, 51, 78, DOI: 10.1038/s12276-019-0275-6[Crossref], [PubMed], [CAS], Google Scholar264https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB3MzmtVCmuw%253D%253D&md5=e60a36c397872efe63f007a81fe46c5bThe flagellin-TLR5-Nox4 axis promotes the migration of smooth muscle cells in atherosclerosisKim Jinoh; Yoo Jung-Yeon; Suh Jung Min; Park Sujin; Kang Dongmin; Bae Yun Soo; Jo HanjoongExperimental & molecular medicine (2019), 51 (7), 78 ISSN:.We hypothesized that NADPH oxidase 4 (Nox4) is involved in the formation of neointimal atherosclerotic plaques through the migration of smooth muscle cells (SMCs) in response to flagellin. Here, we demonstrate that TLR5-mediated Nox4 activation regulates the migration of SMCs, leading to neointimal plaque formation in atherosclerosis. To investigate the molecular mechanism by which the TLR5-Nox4 cascade mediates SMC migration, we analyzed the signaling cascade in primary vascular SMCs (VSMCs) from wild-type (WT) or Nox4 KO mice. Stimulation of VSMCs from Nox4 KO mice with flagellin failed to induce H2O2 production and Rac activation compared with stimulation of VSMCs from WT mice. Moreover, the migration of Nox4-deficient VSMCs was attenuated in response to flagellin in transwell migration and wound healing assays. Finally, we performed partial carotid artery ligation in ApoE KO and Nox4ApoE DKO mice fed a high-fat diet (HFD) with or without recombinant FliC (rFliC) injection. Injection of rFliC into ApoE KO mice fed a HFD resulted in significantly increased SMC migration into the intimal layer, whereas SMC accumulation was not detected in Nox4ApoE DKO mice. We conclude that activation of the TLR5-Nox4 cascade plays an important role in the formation of neointimal atherosclerotic plaques.
- 265Fukuda, D.; Nishimoto, S.; Aini, K.; Tanaka, A.; Nishiguchi, T.; Kim-Kaneyama, J. R.; Lei, X. F.; Masuda, K.; Naruto, T.; Tanaka, K.; Higashikuni, Y.; Hirata, Y.; Yagi, S.; Kusunose, K.; Yamada, H.; Soeki, T.; Imoto, I.; Akasaka, T.; Shimabukuro, M.; Sata, M. Toll-like Receptor 9 Plays a Pivotal Role in Angiotensin II-Induced Atherosclerosis. J. Am. Heart Assoc. 2019, 8 (7), e010860, DOI: 10.1161/JAHA.118.010860[Crossref], [PubMed], [CAS], Google Scholar265https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXpslGltg%253D%253D&md5=6f924b44510681f83c0694a2e503c0edToll-like receptor 9 plays a pivotal role in angiotensin II-induced atherosclerosisFukuda, Daiju; Nishimoto, Sachiko; Aini, Kunduziayi; Tanaka, Atsushi; Nishiguchi, Tsuyoshi; Kim-Kaneyama, Joo-ri; Lei, Xiao-Feng; Masuda, Kiyoshi; Naruto, Takuya; Tanaka, Kimie; Higashikuni, Yasutomi; Hirata, Yoichiro; Yagi, Shusuke; Kusunose, Kenya; Yamada, Hirotsugu; Soeki, Takeshi; Imoto, Issei; Akasaka, Takashi; Shimabukuro, Michio; Sata, MasatakaJournal of the American Heart Association (2019), 8 (7), e010860/1-e010860/24CODEN: JAHABZ; ISSN:2047-9980. (Wiley-Blackwell)Background--Toll-like receptor (TLR) 9 recognizes bacterial DNA, activating innate immunity, whereas it also provokes inflammation in response to fragmented DNA released from mammalian cells. We investigated whether TLR9 contributes to the development of vascular inflammation and atherogenesis using apolipoprotein E-deficient (Apoe-/-) mice. Methods and Results--Tlr9-deficient Apoe-/- (Tlr9±/±Apoe-/-) mice and Apoe-/- mice on a Western-type diet received s.c. angiotensin II infusion (1000 ng/kg per min) for 28 days. Angiotensin II increased the plasma level of doublestranded DNA, an endogenous ligand of TLR9, in these mice. Genetic deletion or pharmacol. blockade of TLR9 in angiotensin II-infused Apoe-/- mice attenuated atherogenesis in the aortic arch (P<0.05), reduced the accumulation of lipid and macrophages in atherosclerotic plaques, and decreased RNA expression of inflammatory mols. in the aorta with no alteration of metabolic parameters. On the other hand, restoration of TLR9 in bone marrow in Tlr9-/-Apoe-/- mice promoted atherogenesis in the aortic arch (P<0.05). A TLR9 agonist markedly promoted proinflammatory activation of Apoe-/- macrophages, partially through p38 mitogen-activated protein kinase signaling. In addn., genomic DNA extd. from macrophages promoted inflammatory mol. expression more effectively in Apoe-/- macrophages than in Tlr9-/-Apoe-/- macrophages. Furthermore, in humans, circulating double-stranded DNA in the coronary artery pos. correlated with inflammatory features of coronary plaques detd. by optical coherence tomog. in patients with acute myocardial infarction (P<0.05). Conclusions--TLR9 plays a pivotal role in the development of vascular inflammation and atherogenesis through proinflammatory activation of macrophages. TLR9 may serve as a potential therapeutic target for atherosclerosis.
- 266Navi, A.; Patel, H.; Shaw, S.; Baker, D.; Tsui, J. Therapeutic Role of Toll-like Receptor Modification in Cardiovascular Dysfunction. Vasc. Pharmacol. 2013, 58 (3), 231– 239, DOI: 10.1016/j.vph.2012.10.001[Crossref], [PubMed], [CAS], Google Scholar266https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC38Xhs1ajtbnN&md5=d98e13fa22c261806718e7dab082c2b5Therapeutic role of toll-like receptor modification in cardiovascular dysfunctionNavi, Ali; Patel, Hemanshu; Shaw, Sidney; Baker, Daryll; Tsui, JaniceVascular Pharmacology (2013), 58 (3), 231-239CODEN: VPAHAJ; ISSN:1537-1891. (Elsevier B.V.)A review. Toll-like receptors (TLR) are key pattern recognition receptors in the innate immune system. The TLR-mediated immune response against pathogens is usually protective however inappropriate TLR activation may lead to excessive tissue damage. It is well recognized that TLRs respond to a variety of endogenous as well as exogenous ligands. By responding to endogenous ligands that are exposed during cellular damage, TLRs have been implicated in a range of pathol. conditions assocd. with cardiovascular dysfunction. Increasing knowledge on the mechanisms involved in TLR signalling has encouraged the exploration of therapeutic pharmacol. modulation of TLR activation in conditions such as atherosclerosis, ischemic heart disease, heart failure and ischemic reperfusion injury. The aim of this review is to explore the translational potentials of TLR modification in cardiovascular dysfunction, where these agents have been studied.
- 267Wang, Z.; Wang, Z.; Zhu, J.; Long, X.; Yan, J. Vitamin K2 Can Suppress the Expression of Toll-like Receptor 2 (TLR2) and TLR4, and Inhibit Calcification of Aortic Intima in ApoE–/– Mice as Well as Smooth Muscle Cells. Vascular 2018, 26 (1), 18– 26, DOI: 10.1177/1708538117713395[Crossref], [PubMed], [CAS], Google Scholar267https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXisVykuro%253D&md5=30735e224447f17d69449eb747e8dda5Vitamin K2 can suppress the expression of Toll-like receptor 2 (TLR2) and TLR4, and inhibit calcification of aortic intima in ApoE-/- mice as well as smooth muscle cellsWang, Zhaojun; Wang, Zhongqun; Zhu, Jie; Long, Xinguang; Yan, JinchuanVascular (2018), 26 (1), 18-26CODEN: VASCBO; ISSN:1708-539X. (Sage Publications Ltd.)Background and objectives: Vascular calcification is a common complication in atherosclerosis. Accumulating evidence showed that Toll-like receptors (TLRs) mediate pro-inflammatory and atherosclerosis. Recent studies demonstrated that vascular calcification is one of the detrimental effects of vitamin K (Vit K) antagonists. However, the effects of Vit K on the expression of TLR2 and 4 and intimal calcification in artery remained unidentified. Methods and results: Eighteen ApoE-/- mice were randomly divided into model group, Vit K-treated group, and control group. The mice of model and Vit K-treated group were fed with high-fat diet, while control group mice were fed with normal diet. Mice of Vit K-treated group were administered orally with vitamin K2 (40 mg.kg-1.day-1) for 12 wk. Twelve weeks later the aortic sections of mice were acquired and stained with hematoxylin and eosin and von Kossa, resp. Calcium content and activity of alk. phosphatase (ALP) at aortic tissues were measured. The expression levels of TLR2 and TLR4 in aorta sections were detected by immunohistochemisty and RT-PCR, resp. The effects of Vit K on cellular calcification were further studied in A7r5 SMCs. Results demonstrated that high-fat diet induced typical atherosclerosis with intimal calcification in ApoE-/- mice, while in Vit K-treated group atherosclerosis and calcium deposits were not serious; Vit K2 also inhibited cellular calcification in A7r5 SMCs. Quant. anal. showed that calcium and ALP activity at aortic tissues in the Vit K-treated mice were significantly lower than that of the model group (P < 0.01); Compared to the control group, the expression levels of TLR2 and TLR4 in the model group were significantly higher (P < 0.05), while in Vit K-treated group the levels of TLR2 and 4 were significantly lower than that in the model group. Furthermore, the content of calcium was pos. related to the expression levels of TLR2 and TLR4 mRNA at aortic tissues (r = 0.77 and r = 0.79, resp., both P < 0.001). Conclusion: VitK2 can inhibit intimal calcification of aortic artery induced by high-fat diet in ApoE-/- mice and A7r5 SMCs calcification induced by β-sodium glycerophosphate, and meanwhile can reduce the expression of TLR2 and TLR4. These results suggested that the effects of VitK2 on vascular calcification may be assocd. with the expression of TLR2 and TLR4.
- 268Owens, A. P.; Passam, F. H.; Antoniak, S.; Marshall, S. M.; McDaniel, A. L.; Rudel, L.; Williams, J. C.; Hubbard, B. K.; Dutton, J. A.; Wang, J.; Tobias, P. S.; Curtiss, L. K.; Daugherty, A.; Kirchhofer, D.; Luyendyk, J. P.; Moriarty, P. M.; Nagarajan, S.; Furie, B. C.; Furie, B.; Johns, D. G.; Temel, R. E.; Mackman, N. Monocyte Tissue Factor - Dependent Activation of Coagulation in Hypercholesterolemic Mice and Monkeys Is Inhibited by Simvastatin. J. Clin. Invest. 2012, 122 (2), 558– 568, DOI: 10.1172/JCI58969[Crossref], [PubMed], [CAS], Google Scholar268https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC38XitVelsrw%253D&md5=319ddc5550b72a81b97b04aaa5b5444bMonocyte tissue factor-dependent activation of coagulation in hypercholesterolemic mice and monkeys is inhibited by simvastatinOwens, A. Phillip, III; Passam, Freda H.; Antoniak, Silvio; Marshall, Stephanie M.; McDaniel, Allison L.; Rudel, Lawrence; Williams, Julie C.; Hubbard, Brian K.; Dutton, Julie-Ann; Wang, Jianguo; Tobias, Peter S.; Curtiss, Linda K.; Daugherty, Alan; Kirchhofer, Daniel; Luyendyk, James P.; Moriarty, Patrick M.; Nagaraian, Shanmugam; Furie, Barbara C.; Furie, Bruce; Johns, Douglas G.; Temei, Ryan E.; Mackman, NigelJournal of Clinical Investigation (2012), 122 (2), 558-568CODEN: JCINAO; ISSN:0021-9738. (American Society for Clinical Investigation)Hypercholesterolemia is a major risk factor for atherosclerosis. It also is assocd. with platelet hyperactivity, which increases morbidity and mortality from cardiovascular disease. However, the mechanisms by which hypercholesterolemia produces a procoagulant state remain undefined. Atherosclerosis is assocd. with accumulation of oxidized lipoproteins within atherosclerotic lesions. Small quantities of oxidized lipoproteins are also present in the circulation of patients with coronary artery disease. We therefore hypothesized that hypercholesterolemia leads to elevated levels of oxidized LDL (oxLDL) in plasma and that this induces expression of the procoagulant protein tissue factor (TF) in monocytes. In support of this hypothesis, we report here that oxLDL induced TF expression in human monocytic cells and monocytes. In addn., patients with familial hypercholesterolemia had elevated levels of plasma microparticle (MP) TF activity. Furthermore, a high-fat diet induced a time-dependent increase in plasma MP TF activity and activation of coagulation in both LDL receptor-deficient mice and African green monkeys. Genetic deficiency of TF in bone marrow cells reduced coagulation in hypercholesterolemic mice, consistent with a major role for monocyte-derived TF in the activation of coagulation. Similarly, a deficiency of either TLR4 or TLR6 reduced levels of MP TF activity. Simvastatin treatment of hypercholesterolemic mice and monkeys reduced oxLDL, monocyte TF expression, MP TF activity, activation of coagulation, and inflammation, without affecting total cholesterol levels. Our results suggest that the prothrombotic state assocd. with hypercholesterolemia is caused by oxLDL-mediated induction of TF expression in monocytes via engagement of a TLR4/TLR6 complex.
- 269Farkas, D.; Thompson, A. A. R.; Bhagwani, A. R.; Hultman, S.; Ji, H.; Kotha, N.; Farr, G.; Arnold, N. D.; Braithwaite, A.; Casbolt, H.; Cole, J. E.; Sabroe, I.; Monaco, C.; Cool, C. D.; Goncharova, E. A.; Lawrie, A.; Farkas, L. Toll-like Receptor 3 Is a Therapeutic Target for Pulmonary Hypertension. Am. J. Respir. Crit. Care Med. 2019, 199 (2), 199– 210, DOI: 10.1164/rccm.201707-1370OC[Crossref], [PubMed], [CAS], Google Scholar269https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhtFKhsr3O&md5=21bb56cfdeecc85cbfd5478051c57059Toll-like receptor 3 is a therapeutic target for pulmonary hypertensionFarkas, Daniela; Thompson, A. A. Roger; Bhagwani, Aneel R.; Hultman, Schuyler; Ji, Hyun; Kotha, Naveen; Farr, Grant; Arnold, Nadine D.; Braithwaite, Adam; Casbolt, Helen; Cole, Jennifer E.; Sabroe, Ian; Monaco, Claudia; Cool, Carlyne D.; Goncharova, Elena A.; Lawrie, Allan; Farkas, LaszloAmerican Journal of Respiratory and Critical Care Medicine (2019), 199 (2), 199-210CODEN: AJCMED; ISSN:1073-449X. (American Thoracic Society)Rationale: Pulmonary arterial hypertension (PAH) is characterized by vascular cell proliferation and endothelial cell apoptosis. TLR3 (Toll-like receptor 3) is a receptor for double-stranded RNA and has been recently implicated in vascular protection. Objectives: To study the expression and role of TLR3 in PAH and to det. whether a TLR3 agonist reduces pulmonary hypertension in preclin. models. Methods: Lung tissue and endothelial cells from patients with PAH were investigated by polymerase chain reaction, immunofluorescence, and apoptosis assays. TLR3-/- and TLR3+/+ mice were exposed to chronic hypoxia and SU5416. Chronic hypoxia or chronic hypoxia/ SU5416 rats were treated with the TLR3 agonist polyinosinic/ polycytidylic acid (Poly[I:C]). Measurements and Main Results: TLR3 expression was reduced in PAH patient lung tissue and endothelial cells, and TLR3-/- mice exhibited more severe pulmonary hypertension following exposure to chronic hypoxia/SU5416. TLR3 knockdown promoted doublestranded RNA signaling via other intracellular RNA receptors in endothelial cells. This was assocd. with greater susceptibility to apoptosis, a known driver of pulmonary vascular remodeling. Poly(I:C) increased TLR3 expression via IL-10 in rat endothelial cells. In vivo, high-dose Poly(I:C) reduced pulmonary hypertension in both rat models in proof-of-principle expts. In addn., Poly(I:C) also reduced right ventricular failure in established pulmonary hypertension. Conclusions: Our work identifies a novel role for TLR3 in PAH based on the findings that reduced expression of TLR3 contributes to endothelial apoptosis and pulmonary vascular remodeling.
- 270Wang, P.-F.; Fang, H.; Chen, J.; Lin, S.; Liu, Y.; Xiong, X.-Y.; Wang, Y.-C.; Xiong, R.-P.; lv, F.-L.; Wang, J.; Yang, Q.-W. Polyinosinic-Polycytidylic Acid Has Therapeutic Effects against Cerebral Ischemia/Reperfusion Injury through the Downregulation of TLR4 Signaling via TLR3. J. Immunol. 2014, 192 (10), 4783– 4794, DOI: 10.4049/jimmunol.1303108[Crossref], [PubMed], [CAS], Google Scholar270https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXntlGhtb0%253D&md5=a7b67aefbbe936ede6bad136cb991e91Polyinosinic-Polycytidylic Acid Has Therapeutic Effects against Cerebral Ischemia/Reperfusion Injury through the Downregulation of TLR4 Signaling via TLR3Wang, Peng-Fei; Fang, Huang; Chen, Jing; Lin, Sen; Liu, Yong; Xiong, Xiao-Yi; Wang, Yan-Chun; Xiong, Ren-Ping; Lv, Feng-Lin; Wang, Jian; Yang, Qing-WuJournal of Immunology (2014), 192 (10), 4783-4794CODEN: JOIMA3; ISSN:0022-1767. (American Association of Immunologists)Recent reports have shown that preconditioning with the TLR3 ligand polyinosinic-polycytidylic acid (poly(I:C)) protects against cerebral ischemia/reperfusion (I/R) injury. However, it is unclear whether poly(I:C) treatment after cerebral I/R injury is also effective. We used mouse/rat middle cerebral artery occlusion and cell oxygen-glucose deprivation models to evaluate the therapeutic effects and mechanisms of poly(I:C) treatment. Poly(I:C) was i.p. injected 3 h after ischemia (treatment group). Cerebral infarct vols. and brain edemas were significantly reduced, and neurol. scores were significantly increased. TNF-α and IL-1β levels were markedly decreased, whereas IFN-β levels were greatly increased, in the ischemic brain tissues, cerebral spinal fluid, and serum. Injuries to hippocampal neurons and mitochondria were greatly reduced. The nos. of TUNEL-pos. and Fluoro-Jade B+ cells also decreased significantly in the ischemic brain tissues. Poly(I:C) treatment increased the levels of Hsp27, Hsp70, and Bcl2 and decreased the level of Bax in the ischemic brain tissues. Moreover, poly(I:C) treatment attenuated the levels of TNF-α and IL-1β in serum and cerebral spinal fluid of mice stimulated by LPS. However, the protective effects of poly(I:C) against cerebral ischemia were abolished in TLR3-/- and TLR4-/-mice. Poly(I:C) downregulated TLR4 signaling via TLR3. Poly(I:C) treatment exhibited obvious protective effects 14 d after ischemia and was also effective in the rat permanent middle cerebral artery occlusion model. The results suggest that poly(I:C) exerts therapeutic effects against cerebral I/R injury through the downregulation of TLR4 signaling via TLR3. Poly(I:C) is a promising new drug candidate for the treatment of cerebral infarcts.
- 271Chen, G.; Chen, X. L.; Xu, C. B.; Lin, J.; Luo, H. L.; Xie, X.; Li, J. Toll-like Receptor Protein 4 Monoclonal Antibody Inhibits MmLDL-Induced Endothelium-Dependent Vasodilation Dysfunction of Mouse Mesenteric Arteries. Microvasc. Res. 2020, 127, 103923, DOI: 10.1016/j.mvr.2019.103923[Crossref], [PubMed], [CAS], Google Scholar271https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhslygsbbE&md5=ba9bc2713bc766633db7a1744bf49d93Toll-like receptor protein 4 monoclonal antibody inhibits mmLDL-induced endothelium-dependent vasodilation dysfunction of mouse mesenteric arteriesChen, Gen; Chen, Xiao-Lan; Xu, Cang-Bao; Lin, Jie; Luo, Hong-Li; Xie, Xi; Li, JieMicrovascular Research (2020), 127 (), 103923CODEN: MIVRA6; ISSN:0026-2862. (Elsevier Inc.)Minimally modified low-d. lipoprotein (mmLDL) is a risk factor for cardiovascular disease. This study was designed to investigate the effect of a Toll-like receptor 4 monoclonal antibody (TLR4 mAb) on mmLDL-induced endothelium-dependent vasodilation (EDV) impairment in mouse mesenteric arteries and to explore the underlying mechanism. Animals were divided into a normal control group, an mmLDL treatment group, and a TLR4 mAb intervention group. The serum concns. of IL-1β and TNF-α were detected using enzyme-linked immunosorbent assays (ELISAs). EDV function was measured using a microvascular tension tracing method. The protein levels and mRNA expression of IL-1β and TNF-α in vascular tissue were detected using western blot anal. and reverse transcription polymerase chain reaction, resp. TLR4 mAb improved mmLDL-induced EDV functional impairment in a dose-dependent manner. TLR4 mAb significantly upregulated KCa3.1 and KCa2.3 channel protein levels and downregulated TNF-α and IL-1β expression. These effects were possibly assocd. with the competitive antagonism of TLR4 mAb on the TLR4 signaling pathway and the downstream NF-κB p65 and p38 MAPK pathways, which are activated by mmLDL. In conclusion, pretreatment with TLR4 mAb lessens mmLDL-induced EDV dysfunction and inhibits overexpression of inflammatory factors. Regulation of the TLR4 pathway, as well as its downstream NF-κB p65 and p38 MAPK pathways, may be an effective strategy for the prevention and treatment of cardiovascular diseases.
- 272Huggins, C.; Pearce, S.; Peri, F.; Neumann, F.; Cockerill, G.; Pirianov, G. A Novel Small Molecule TLR4 Antagonist (IAXO-102) Negatively Regulates Non-Hematopoietic Toll like Receptor 4 Signalling and Inhibits Aortic Aneurysms Development. Atherosclerosis 2015, 242 (2), 563– 570, DOI: 10.1016/j.atherosclerosis.2015.08.010[Crossref], [PubMed], [CAS], Google Scholar272https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXhsVensrrL&md5=ea6fc3cddf6afb908508e6a0b9e8c32fA novel small molecule TLR4 antagonist (IAXO-102) negatively regulates non-hematopoietic toll like receptor 4 signalling and inhibits aortic aneurysms developmentHuggins, Christopher; Pearce, Stuart; Peri, Francesco; Neumann, Frank; Cockerill, Gillian; Pirianov, GrishaAtherosclerosis (Amsterdam, Netherlands) (2015), 242 (2), 563-570CODEN: ATHSBL; ISSN:0021-9150. (Elsevier B.V.)The toll-like receptors (TLRs), including TLR4, have been shown to play a crucial role in vascular inflammatory diseases, such as atherosclerosis and aneurysm. The main goal of this study was to det. the potential of IAXO-102 (Innaxon, Tewkesbury), a novel small mol. TLR4 antagonist, to modulate non-hematopoietic TLR4 proinflammatory signalling and inhibit exptl. abdominal aortic aneurysm (AAA) development. Human umbilical vein endothelial cells (HUVEC) and Angiotensin II-induced exptl. AAA development were our in vitro and in vivo models resp. Western blotting, antibody array and ELISA approaches were used to explore the effect of IAXO-102 on TLR4 functional activity on two levels: modulation of TLR4-induced mitogen activated protein kinases (MAPK) and p65 NF-kB phosphorylation and expression of TLR4 dependent proinflammatory proteins. Following activation of TLR4, in vitro/in vivo data revealed that IAXO-102 inhibited MAPK and p65 NF-kB phosphorylation assocd. with down regulation of the expression of TLR4 and TLR4 dependent proinflammatory proteins. Furthermore, IAXO-102 decreased Angiotensin II-induced aortic expansion, rupture and incidence of AAA. These results demonstrate the ability of IAXO-102 to neg. regulate TLR4 signalling and to inhibit exptl. AAA development, suggesting the potential therapeutic use of this TLR4 antagonist for pharmacol. intervention of AAA.
- 273Sun, M.; Deng, B.; Zhao, X.; Gao, C.; Yang, L.; Zhao, H.; Yu, D.; Zhang, F.; Xu, L.; Chen, L.; Sun, X. Isoflurane Preconditioning Provides Neuroprotection against Stroke by Regulating the Expression of the TLR4 Signalling Pathway to Alleviate Microglial Activation. Sci. Rep. 2015, 5, 11445, DOI: 10.1038/srep11445[Crossref], [PubMed], [CAS], Google Scholar273https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC2MbkvFCnsA%253D%253D&md5=b298a4a81cca128e4e377d96b5f000b3Isoflurane preconditioning provides neuroprotection against stroke by regulating the expression of the TLR4 signalling pathway to alleviate microglial activationSun Meiyan; Deng Bin; Zhao Xiaoyong; Gao Changjun; Yang Lu; Zhao Hui; Yu Daihua; Sun Xude; Deng Bin; Xu Lixian; Zhao Xiaoyong; Zhang Feng; Chen LeiScientific reports (2015), 5 (), 11445 ISSN:.Excessive microglial activation often contributes to inflammation-mediated neurotoxicity in the ischemic penumbra during the acute stage of ischemic stroke. Toll-like receptor 4 (TLR4) has been reported to induce microglial activation via the NF-κB pathway. Isoflurane preconditioning (IP) can provide neuroprotection and inhibit microglial activation. In this study, we investigated the roles of the TLR4 signalling pathway in IP to exert neuroprotection following ischemic stroke in vivo and in vitro. The results showed that 2% IP alleviated neurological deficits, reduced the infarct volume, attenuated apoptosis and weakened microglial activation in the ischemic penumbra. Furthermore, IP down-regulated the expression of HSP 60, TLR4 and MyD88 and up-regulated inhibitor of IκB-α expression compared with I/R group in vivo. In vitro, 2% IP and a specific inhibitor of TLR4, CLI-095, down-regulated the expression of TLR4, MyD88, IL-1β, TNF-α and Bax, and up-regulated IκB-α and Bcl-2 expression compared with OGD group. Moreover, IP and CLI-095 attenuated microglial activation-induced neuronal apoptosis, and overexpression of the TLR4 gene reversed the neuroprotective effects of IP. In conclusion, IP provided neuroprotection by regulating TLR4 expression directly, alleviating microglial activation and neuroinflammation. Thus, inhibiting the activation of microglial activation via TLR4 may be a new avenue for stroke treatment.
- 274Kapelouzou, A.; Giaglis, S.; Peroulis, M.; Katsimpoulas, M.; Moustardas, P.; Aravanis, C. V.; Kostakis, A.; Karayannakos, P. E.; Cokkinos, D. V. Overexpression of Toll-Like Receptors 2, 3, 4, and 8 Is Correlated to the Vascular Atherosclerotic Process in the Hyperlipidemic Rabbit Model: The Effect of Statin Treatment. J. Vasc. Res. 2017, 54 (3), 156– 169, DOI: 10.1159/000457797[Crossref], [PubMed], [CAS], Google Scholar274https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXps1aqs7s%253D&md5=fadabffe75a2b796dfffdd9e61a588dbOverexpression of Toll-Like Receptors 2, 3, 4, and 8 Is Correlated to the Vascular Atherosclerotic Process in the Hyperlipidemic Rabbit Model: The Effect of Statin TreatmentKapelouzou, Alkistis; Giaglis, Stavros; Peroulis, Michalis; Katsimpoulas, Michalis; Moustardas, Petros; Aravanis, Chrysostomos V.; Kostakis, Alkiviadis; Karayannakos, Panagiotis E.; Cokkinos, Dennis V.Journal of Vascular Research (2017), 54 (3), 156-169CODEN: JVREE9; ISSN:1018-1172. (S. Karger AG)Background: Atherosclerosis is the major cause of cardiovascular disease; hypercholesterolemia is a major risk factor. We hypothesized that specific TLR members (TLR2, TLR3, TLR4, TLR8) may play a role in atherosclerosis progression and its accompanying inflammatory response. We detd. the assocn. of atherosclerotic lesions and TLR mRNA expression in different aortic sites. We also assessed the effects of fluvastatin (Flu) treatment on TLR expression and plaque characteristics. Methods: Male rabbits, fed with an atherogenic diet for a duration of 3 mo, were screened for advanced atherosclerotic lesions in the aorta. Addnl. animals received normal diet or normal diet plus Flu for 1 addnl. month. TLR mRNA expression in various thoracic and abdominal aortic segments was assessed, together with atherosclerotic changes. Results: After high lipid diet, the atherosclerotic burden increased more in the abdominal than in the thoracic aorta; TLR2, 3, 4, and 8 also increased significantly. Flu decreased atherosclerotic plaque, calcium deposition, lipid cores, intraplaque hemorrhage, erythrocyte membranes, endothelial cells, and macrophage infiltration, while increasing smooth muscle cells in plaques of both aortic segments; it also lowered TLR2, 3, 4, and 8 expression in all aortic segments to a stronger degree than resumption of normal diet. There was a strong assocn. between blood and tissue parameters during exptl. period and finally a strong correlation found between these parameters with mRNA of TLR2, 3, 4, and 8 in various stages. Conclusion: For the first time TLR2, 3, 4, and 8 mRNA expression is prospectively explored after hypercholesterolemic diet in the rabbit model. TLR2, 3, 4, and 8 mRNA expression is strongly upregulated and correlates with the progression of atherosclerosis in the aorta. Flu significantly inhibited this progress and reduced inflammation via TLR downregulation which was strongly assocd. with regression of plaque morphol. and atherosclerosis promoting factors.
- 275Koulis, C.; Chen, Y. C.; Hausding, C.; Ahrens, I.; Kyaw, T. S.; Tay, C.; Allen, T.; Jandeleit-Dahm, K.; Sweet, M. J.; Akira, S.; Bobik, A.; Peter, K.; Agrotis, A. Protective Role for Toll-like Receptor-9 in the Development of Atherosclerosis in Apolipoprotein e-Deficient Mice. Arterioscler., Thromb., Vasc. Biol. 2014, 34 (3), 516– 525, DOI: 10.1161/ATVBAHA.113.302407[Crossref], [PubMed], [CAS], Google Scholar275https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXislGksbk%253D&md5=efc3b8511f4b8b152c0f795d3255434bProtective Role for Toll-Like Receptor-9 in the Development of Atherosclerosis in Apolipoprotein E-Deficient MiceKoulis, Christine; Chen, Yung-Chih; Hausding, Christian; Ahrens, Ingo; Kyaw, Tin Soe; Tay, Christopher; Allen, Terri; Jandeleit-Dahm, Karin; Sweet, Matthew J.; Akira, Shizuo; Bobik, Alexander; Peter, Karlheinz; Agrotis, AlexArteriosclerosis, Thrombosis, and Vascular Biology (2014), 34 (3), 516-525CODEN: ATVBFA; ISSN:1079-5642. (Lippincott Williams & Wilkins)OBJECTIVE-: Atherosclerosis is driven by inflammatory reactions that are shared with the innate immune system. Toll-like receptor-9 (TLR9) is an intracellular pattern recognition receptor of the innate immune system that is currently under clin. investigation as a therapeutic target in inflammatory diseases. Here, we investigated whether TLR9 has a role in the development of atherosclerosis in apolipoprotein E-deficient (ApoE) mice. APPROACH AND RESULTS-: Newly generated double-knockout ApoE:TLR9 mice and control ApoE mice were fed a high-fat diet from 8 wk and effects on lesion size, cellular compn., inflammatory status, and plasma lipids were assessed after 8, 12, 15, and 20 wk. All 4 time points demonstrated exacerbated atherosclerotic lesion severity in ApoE:TLR9 mice, with a corresponding increase in lipid deposition and accumulation of macrophages, dendritic cells, and CD4 T cells. Although ApoE:TLR9 mice exhibited an increase in plasma very low-d. lipoprotein/low-d.-lipoprotein cholesterol, the very low-d. lipoprotein/low-d. lipoprotein:high-d. lipoprotein ratio was unaltered because of a parallel increase in plasma high-d. lipoprotein cholesterol. As a potential mechanism accounting for plaque progression in ApoE:TLR9 mice, CD4 T-cell accumulation was further investigated and depletion of these cells in ApoE:TLR9 mice significantly reduced lesion severity. As a final translational approach, administration of a TLR9 agonist (type B CpG oligodeoxynucleotide 1668) to ApoE mice resulted in a redn. of lesion severity. CONCLUSIONS-: Genetic deletion of the innate immune receptor TLR9 exacerbated atherosclerosis in ApoE mice fed a high-fat diet. CD4 T cells were identified as potential mediators of this effect. A type B CpG oligodeoxynucleotide TLR9 agonist reduced lesion severity, thus identifying a novel therapeutic approach in atherosclerosis.
- 276McCarthy, C. G.; Wenceslau, C. F.; Goulopoulou, S.; Baban, B.; Matsumoto, T.; Webb, R. C. Chloroquine Suppresses the Development of Hypertension in Spontaneously Hypertensive Rats. Am. J. Hypertens. 2017, 30 (2), 173– 181, DOI: 10.1093/ajh/hpw113[Crossref], [PubMed], [CAS], Google Scholar276https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXivV2mt7w%253D&md5=a4a44ff4227e4bd68fc63620570a4873Chloroquine suppresses the development of hypertension in spontaneously hypertensive ratsMcCarthy, Cameron G.; Wenceslau, Camilla F.; Goulopoulou, Styliani; Baban, Babak; Matsumoto, Takayuki; Webb, R. ClintonAmerican Journal of Hypertension (2017), 30 (2), 173-181CODEN: AJHYE6; ISSN:1941-7225. (Oxford University Press)BACKGROUND Innate immune system responses to damage-assocd. mol. patterns (DAMPs) are involved in hypertension. However, the mechanisms of this contribution are not well understood. Circulating mitochondrial DNA is a DAMP that activates Toll-like receptor (TLR) 9 and is elevated in spontaneously hypertensive rats (SHR). Therefore, we hypothesized that lysosomotropic agent chloroquine (CQ) would impair TLR9 signaling, as well as prevent the development of hypertension and immune cell recruitment to the vasculature, in SHR. METHODS Initially, adult SHR and Wistar-Kyoto (WKY) rats (12 wk old), as well as a group of young SHR (5 wk old), were treated with CQ (40 mg/kg/ day) or vehicle (saline) via i.p. injections for 21 days and then TLR9-myeloid differentiation primary response protein (MyD88) signaling proteins were assessed in mesenteric resistance arteries (MRA) via western blot. Subsequently, young SHR and WKY were treated from 5-8 wk of age and then were allowed to mature without further treatment. Blood pressure was measured pretreatment, posttreatment, and after maturation, and immune cell recruitment to the vasculature was measured via flow cytometry after maturation. RESULTS In MRA from adult SHR, CQ increased the expression of MyD88- dependent proteins, whereas young SHR MRA exhibited a decrease. This inhibition was subsequently assocd. with suppression of blood pressure, as well as decreased counts of circulating T cells and vascular infiltrating leukocytes in SHR, when CQ was administered during the prehypertensive phase. CONCLUSIONS These data bring into question the participation of TLRs during the maintenance phase of hypertension and promote the exploration of innate immune system therapy during the crit. developmental phase.
- 277Carullo, G.; Governa, P.; Leo, A.; Gallelli, L.; Citraro, R.; Cione, E.; Caroleo, M. C.; Biagi, M.; Aiello, F.; Manetti, F. Quercetin-3-Oleate Contributes to Skin Wound Healing Targeting FFA1/GPR40. ChemistrySelect 2019, 4 (29), 8429– 8433, DOI: 10.1002/slct.201902572[Crossref], [CAS], Google Scholar277https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhsFChtr7J&md5=a24e4e5d93c3dbe919b3e2c7200f9413Quercetin-3-Oleate Contributes to Skin Wound Healing Targeting FFA1/GPR40Carullo, Gabriele; Governa, Paolo; Leo, Antonio; Gallelli, Luca; Citraro, Rita; Cione, Erika; Caroleo, Maria Cristina; Biagi, Marco; Aiello, Francesca; Manetti, FabrizioChemistrySelect (2019), 4 (29), 8429-8433CODEN: CHEMUD; ISSN:2365-6549. (Wiley-VCH Verlag GmbH & Co. KGaA)The hybrid mol. Quercetin-3-oleate (AV2), accommodates within the binding pocket for allosteric full GPR40 agonists. AV2 endorses skin wound healing acting as a promoter of keratinocytes proliferation and overcomes immunosuppressive conditions in vitro. AV2 stimulated HaCaT wound healing by 51% compared to the untreated control, at the concn. of 1 μM with slight TGF-β prodn. and MMP-9 release. Pretreatment with the known GPR40 antagonist DC260126 abolished its wound healing power. Docking simulations suggested that both mols. share the same binding site.
- 278Carullo, G.; Perri, M.; Manetti, F.; Aiello, F.; Caroleo, M. C.; Cione, E. Quercetin-3-Oleoyl Derivatives as New GPR40 Agonists: Molecular Docking Studies and Functional Evaluation. Bioorg. Med. Chem. Lett. 2019, 29 (14), 1761– 1764, DOI: 10.1016/j.bmcl.2019.05.018[Crossref], [PubMed], [CAS], Google Scholar278https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXpvVGrt7k%253D&md5=16b3502e11ef0aa88ccc19769a769f24Quercetin-3-oleoyl derivatives as new GPR40 agonists: Molecular docking studies and functional evaluationCarullo, Gabriele; Perri, Mariarita; Manetti, Fabrizio; Aiello, Francesca; Caroleo, Maria Cristina; Cione, ErikaBioorganic & Medicinal Chemistry Letters (2019), 29 (14), 1761-1764CODEN: BMCLE8; ISSN:0960-894X. (Elsevier B.V.)The G-protein-coupled receptor 40 (GPR40) is an attractive mol. target for the treatment of type 2 diabetes mellitus. Previously, based on the natural oleic acid substrate, an exogenous ligand for this receptor, named AV1, was synthesized. In this context, here we validated the activity of AV1 as a full agonist, while the corresponding catechol analog, named AV2, was investigated for the first time. The ligand-protein interaction between this new mol. and the receptor was highlighted in the lower portion of the GPR40 groove that generally accommodates DC260126. The functional assays performed have demonstrated that AV2 is a suitable GPR40 partial agonist, showing a therapeutic potential and representing a useful tool in the management of type 2 diabetes.
- 279Westwell-Roper, C.; Nackiewicz, D.; Dan, M.; Ehses, J. A. Toll-like Receptors and NLRP3 as Central Regulators of Pancreatic Islet Inflammation in Type 2 Diabetes. Immunol. Cell Biol. 2014, 92 (4), 314– 323, DOI: 10.1038/icb.2014.4[Crossref], [PubMed], [CAS], Google Scholar279https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXitFahsbw%253D&md5=d60d7895df6722e5646f1f32c44b274fToll-like receptors and NLRP3 as central regulators of pancreatic islet inflammation in type 2 diabetesWestwell-Roper, Clara; Nackiewicz, Dominika; Dan, Meixia; Ehses, Jan A.Immunology & Cell Biology (2014), 92 (4), 314-323CODEN: ICBIEZ; ISSN:0818-9641. (NPG Nature Asia-Pacific)A review. The global health and economic burden of type 2 diabetes (T2D) has reached staggering proportions. Current projections est. that 592 million people will have diabetes by 2035. T2D-which comprises 90% of cases-is a complex disease, in most cases resulting from a combination of predisposing genes and an unhealthy environment. Clin. onset of the disease occurs when pancreatic β cells fail in the face of insulin resistance. It has long been appreciated that chronic activation of the innate immune system is assocd. with T2D, and many organs crit. to the regulation of glucose homeostasis show signs of a chronic inflammatory process, including the pancreatic islets of Langerhans. Recent clin. trials using IL-1-targeting agents have confirmed that inflammation contributes to β-cell failure in humans with T2D. However, little is known about the nature of the pro-inflammatory response within the islet, and there is considerable debate about the triggers for islet inflammation, which may be systemically derived and/or tissue-specific. In this review, we present evidence that Toll-like receptors 2 and 4 and the NLRP3 (Nucleotide-binding oligomerization domain, Leucine-rich Repeat and Pyrin domain contg. 3) inflammasome are triggers for islet inflammation in T2D and propose that the activation of macrophages by these triggers mediates islet endocrine cell dysfunction. Therapeutically targeting these receptors may improve hyperglycemia and protect the β cell in T2D.
- 280Rada, I.; Deldicque, L.; Francaux, M.; Zbinden-Foncea, H. Toll like Receptor Expression Induced by Exercise in Obesity and Metabolic Syndrome: A Systematic Review. Exerc. Immunol. Rev. 2018, 24 (14), 60– 71[PubMed], [CAS], Google Scholar280https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC1MrjsVKqsA%253D%253D&md5=be3fef2390848c11473f8880b1ad1cecToll like receptor expression induced by exercise in obesity and metabolic syndrome: A systematic reviewRada Isabel; Zbinden-Foncea Hermann; Deldicque Louise; Francaux MarcExercise immunology review (2018), 24 (), 60-71 ISSN:1077-5552.BACKGROUND: Obesity and metabolic syndrome are disorders that correlate with the activation of pro-inflammatory pathways and cytokine production, to which Toll like receptors (TLR) contribute. Exercise may act as an anti-inflammatory modulator, but there is no consensus about the role of the TLR in this tuning. The present styudy aims to systematically review the current evidence on exercise-induced TLR regulation in animals and humans suffering from obesity and metabolic syndrome. METHODS: Pubmed and Scopus databases were searched for publications from 1990 to September 2015. Search terms included: "Toll like Receptor", "TLR", "exercise", "obesity", "diabetes", and "metabolic syndrome". Elegibility criteria comprised: randomized control trials, cross-sectional and cohort studies; human or animal models with metabolic syndrome; any type of exercise; TLR expression measurement in any tissue by a clearly reported technique. The quality of selected studies was assessed using a modified version of the Downs and Black Quality Assessment Checklist. Data of study design; population; exercise type, timing and training elements; measurement technique, tissue analyzed and main outcome were extracted and categorized to facilitate data synthesis. RESULTS: 17 studies were included, of which 11 publications obtained a high, 5 a moderate and 1 a low score for quality assessment. A total of 8 human studies were analyzed: 6 studies used endurance continuous or interval training protocols, 1 study resistance training and the remaining study was performed following a marathon race. Blood cells were analyzed in seven studies, of which four studies sampled peripheral blood mononuclear cells (PBMC), three analyzed whole blood and one study sampled skeletal muscle. Nine animal studies were included: 8 used endurance training and 1 acute aerobic exercise. A variety of tissues samples were explored such as PBMC, skeletal muscle, adipose, vascular and nervous tissue. Globally, the animal studies showed a marked tendency towards a down-regulation of TLR2 and 4 expression accompagnied with, a reduced activation of nuclear factorkappaB (NF-κB) signaling and cytokine production, and an improvement in insulin sensitivity and body composition. CONCLUSION: While animal studies showed a marked tendency towards TLR2 and 4 down-regulation after chronic endurance exercise, the current evidence in human is not sufficiently robust to conclude any role of TLR in the anti-inflammatory properties of exercise.
- 281Singh, K.; Singh, K.; Agrawal, N. K.; Gupta, S. K.; Mohan, G.; Chaturvedi, S. Genetic and Epigenetic Alterations in Toll like Receptor 2 and Wound Healing Impairment in Type 2 Diabetes Patients. J. Diabetes Complications 2015, 29 (2), 222– 229, DOI: 10.1016/j.jdiacomp.2014.11.015[Crossref], [PubMed], [CAS], Google Scholar281https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC2MvhvFGjtg%253D%253D&md5=424f8411970997e79f65b58e42d1c0ecGenetic and epigenetic alterations in Toll like receptor 2 and wound healing impairment in type 2 diabetes patientsSingh Kanhaiya; Agrawal Neeraj K; Gupta Sanjeev K; Mohan Gyanendra; Chaturvedi Sunanda; Singh KiranJournal of diabetes and its complications (2015), 29 (2), 222-9 ISSN:.AIM: Persistent hyperglycemic microenvironment in type 2 diabetes mellitus (T2DM) leads to the development of secondary complications like wound healing impairment. Proper co-ordination of innate immune system plays an integral role in wound healing. Toll like receptors (TLRs) are prominent contributors for the induction of the innate immune and inflammation response. TLR2 is an important extracellular member in mammalian TLR family and has been shown to be a potent player in the wound healing mechanism. METHODS: Expressional status of TLR2 was seen in wounds of T2DM cases with respect to the severity of wounds in 110 human lower extremity wounds. The methylation status of TLR2 promoter was also examined. RESULTS: Although TLR2 transcripts were downregulated in T2DM wounds compared to control, their levels tend to increase with the severity of T2DM wounds. The methylation status of TLR2 gene promoter was not significantly different among different grades of wounds in T2DM subjects. The CpG sites investigated were totally or partially methylated in majority of DFU cases. CONCLUSION: TLR2 down regulation in wounds of T2DM patients compared to non diabetic patients may lead to development of non healing chronic ulcers in them.
- 282Zaharieva, E.; Velikova, T.; Tsakova, A.; Kamenov, Z. Reduced Soluble Toll-like Receptors 2 in Type 2 Diabetes. Arch. Physiol. Biochem. 2018, 124 (4), 326– 329, DOI: 10.1080/13813455.2017.1401642[Crossref], [PubMed], [CAS], Google Scholar282https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXhvVGisLbI&md5=eee76d8c72d30d9dc2e0ffbf7c3a5b14Reduced soluble Toll-like receptors 2 in type 2 diabetesZaharieva, Emanuela; Velikova, Tsvetelina; Tsakova, Adelina; Kamenov, ZdravkoArchives of Physiology and Biochemistry (2018), 124 (4), 326-329CODEN: APBIF5; ISSN:1381-3455. (Taylor & Francis Ltd.)Sol. forms of Toll-like receptors (sTLR) 2 and 4 exert neg. regulatory control on membrane-bound receptor activation. The study ests. the sTLR2 and sTLR4's serum levels in type 2 diabetes (T2D) and evaluates their relationship with metabolic and inflammatory parameters. Sixty three patients with T2D and 25 controls were enrolled. sTLR were assayed through ELISA. Inflammatory markers included Interleukin 6 (IL-6), high sensitivity C-reactive protein (hs-CRP) and tumor necrosis factor α. Anal. demonstrated lower sTLR2 level in T2D than in control subjects (1.15 ± 0.65 vs. 1.44 ± 0.60 ng/mL, p = .019) while sTLR4 level remained similar (0.09 ± 0.16 vs. 0.07 ± 0.12 ng/mL, p > .05) despite higher IL-6 (2.65 ± 2.46 vs. 1.44 ± 0.22 pg/mL, p = .005) and hs-CRP (2.79 ± 2.89 vs. 0.70 ± 0.89 mg/l, p < .001) concns. Neither sTLR correlated with BMI, HbA1c, plasma glucose and analyzed cytokines (p > .05). The sTLR2 serum level in T2D patients was reduced despite elevated inflammatory parameters.
- 283Pahwa, R.; Jialal, I. Hyperglycemia Induces Toll-Like Receptor Activity Through Increased Oxidative Stress. Metab. Syndr. Relat. Disord. 2016, 14 (5), 239– 241, DOI: 10.1089/met.2016.29006.pah[Crossref], [PubMed], [CAS], Google Scholar283https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XotF2itbc%253D&md5=2d951bfe1da46e44796a8591b906c582Hyperglycemia Induces Toll-Like Receptor Activity Through Increased Oxidative StressPahwa, Roma; Jialal, IshwarlalMetabolic Syndrome and Related Disorders (2016), 14 (5), 239-241CODEN: MSRDBF; ISSN:1540-4196. (Mary Ann Liebert, Inc.)Hyperglycemia-induced oxidative stress and inflammation are central in the genesis of diabetic vascular complications. Toll-like receptors (TLRs) play a crucial role in promoting inflammatory responses and are known to be activated in diabetic patients. Also in animal models, they have been shown to have a role in the pathogenesis of diabetic vasculopathies. However, the mechanisms underlying this increase in TLR activity in diabetes are not well documented. Since increased reactive oxygen species (ROS) are also produced in various tissues under diabetic conditions, we postulated that ROS act as a potential activator of TLR. Several studies support our hypothesis that hyperglycemia-induced oxidative stress appears to be an important factor in promoting TLR activity in monocytes, both microvascular and macrovascular endothelial cells and cardiomyocytes and in animal models. Most importantly, the increase in ROS and TLR activity is ameliorated with antioxidant strategies. Thus, targeting ROS/NADPH oxidase with small mol. inhibitors could be a promising strategy to reduce both oxidative stress and TLR-mediated inflammation in diabetic vascular diseases.
- 284Sepehri, Z.; Kiani, Z.; Nasiri, A. A.; Kohan, F. Toll-like Receptor 2 and Type 2 Diabetes. Cell. Mol. Biol. Lett. 2016, 21, 2, DOI: 10.1186/s11658-016-0002-4[Crossref], [PubMed], [CAS], Google Scholar284https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXkslGkurc%253D&md5=1d9c8b6fc26cc61be2d2ad9a693d408fToll-like receptor 2 and type 2 diabetesSepehri, Zahra; Kiani, Zohre; Nasiri, Ali Akbar; Kohan, FarhadCellular & Molecular Biology Letters (2016), 21 (), 2/1-2/9CODEN: CMBLFF; ISSN:1689-1392. (BioMed Central Ltd.)Innate immunity plays a crucial role in the pathogenesis of type 2 diabetes and related complications. Since the toll-like receptors (TLRs) are central to innate immunity, it appears that they are important participants in the development and pathogenesis of the disease. Previous investigations demonstrated that TLR2 homodimers and TLR2 heterodimers with TLR1 or TLR6 activate innate immunity upon recognition of damage-assocd. mol. patterns (DAMPs). Several DAMPs are released during type 2 diabetes, so it may be hypothesized that TLR2 is significantly involved in its progression. Here, we review recent data on the important roles and status of TLR2 in type 2 diabetes and related complications.
- 285Sepehri, Z.; Kiani, Z.; Javadian, F.; Akbar Nasiri, A.; Kohan, F.; Sepehrikia, S.; Javan Siamardi, S.; Aali, H.; Daneshvar, H.; Kennedy, D. TLR3 and Its Roles in the Pathogenesis of Type 2 Diabetes. Cell. Mol. Biol. 2015, 61 (3), 46– 50, DOI: 10.14715/cmb/2015.61.3.10[Crossref], [PubMed], [CAS], Google Scholar285https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC2MbktlKltw%253D%253D&md5=3af868c2bdc95ffa4ae41e53100ee2bfTLR3 and its roles in the pathogenesis of type 2 diabetesSepehri Z; Aali H; Kiani Z; Javadian F; Akbar Nasiri A; Kohan F; Sepehrikia S; Javan Siamardi S; Daneshvar H; Kennedy DCellular and molecular biology (Noisy-le-Grand, France) (2015), 61 (3), 46-50 ISSN:.Type 2 diabetes (T2D) is the most prevalent non—infectious disease and leads to several complications including nephropathy and retinopathy. The mechanisms and signaling molecules responsible for the development and progression of T2D, as well as its associated complications are yet to be identified. It would appear that genetic backgrounds and immunological parameters of people susceptible to T2D may play important roles in induction of T2D. TLRs participate in several cellular pathways which can induce activation of proliferation. However, in contradiction, these pathways can also be associated with apoptosis. The multiple roles of TLRs and their signaling molecules associated with T2D pathways makes them candidates for the induction of immune—regulated diseases like T2D. TLR3 has been identified as an intracellular ligand and subsequently activates signaling molecules via the TRIF pathway. Therefore, the alteration of expression of TLR3 and their functions may lead to inappropriate induction of immune system functions that are related to T2D disease. The aim of this review was to collect recent data regarding the roles of TLR3 in the progression and pathogenesis of T2D.
- 286Rogero, M. M.; Calder, P. C. Obesity, Inflammation, Toll-like Receptor 4 and Fatty Acids. Nutrients 2018, 10 (4), 432, DOI: 10.3390/nu10040432[Crossref], [CAS], Google Scholar286https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXitlOjtLrO&md5=204e9f3af12041c00699b9197bb87954Obesity, inflammation, toll-like receptor 4 and fatty acidsRogero, Marcelo Macedo; Calder, Philip C.Nutrients (2018), 10 (4), 432/1-432/19CODEN: NUTRHU; ISSN:2072-6643. (MDPI AG)A review. Obesity leads to an inflammatory condition that is directly involved in the etiol. of cardiovascular diseases, type 2 diabetes mellitus, and certain types of cancer. The classic inflammatory response is an acute reaction to infections or to tissue injuries, and it tends to move towards resoln. and homeostasis. However, the inflammatory process that was obsd. in individuals affected by obesity and metabolic syndrome differs from the classical inflammatory response in certain respects. This inflammatory process manifests itself systemically and it is characterized by a chronic low-intensity reaction. The toll-like receptor 4 (TLR4) signaling pathway is acknowledged as one of the main triggers of the obesity-induced inflammatory response. The aim of the present review is to describe the role that is played by the TLR4 signaling pathway in the inflammatory response and its modulation by satd. and omega-3 polyunsatd. fatty acids. Studies indicate that satd. fatty acids can induce inflammation by activating the TLR4 signaling pathway. Conversely, omega-3 polyunsatd. fatty acids, such as eicosapentaenoic acid and docosahexaenoic acid, exert anti-inflammatory actions through the attenuation of the activation of the TLR4 signaling pathway by either lipopolysaccharides or satd. fatty acids.
- 287Portou, M. J.; Yu, R.; Baker, D.; Xu, S.; Abraham, D.; Tsui, J. Hyperglycaemia and Ischaemia Impair Wound Healing via Toll-like Receptor 4 Pathway Activation in Vitro and in an Experimental Murine Model. Eur. J. Vasc. Endovasc. Surg. 2020, 59 (1), 117– 127, DOI: 10.1016/j.ejvs.2019.06.018[Crossref], [PubMed], [CAS], Google Scholar287https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB3MjpslSktw%253D%253D&md5=a0e2b88ca875c416f67e4b0f69e0c23eHyperglycaemia and Ischaemia Impair Wound Healing via Toll-like Receptor 4 Pathway Activation in vitro and in an Experimental Murine ModelPortou Mark J; Yu Rebekah; Baker Daryll; Tsui Janice; Xu Shiwen; Abraham DavidEuropean journal of vascular and endovascular surgery : the official journal of the European Society for Vascular Surgery (2020), 59 (1), 117-127 ISSN:.OBJECTIVE: Diabetes mellitus has reached epidemic proportions. Foot ulceration is a multifactorial complication of diabetes associated with marked morbidity and mortality. Innate immune Toll-like receptor 4 (TLR4) mediated inflammation has been implicated in the systemic pathogenesis of diabetes and may contribute to impairment of wound healing. This study investigates the effect of high glucose and hypoxic conditions on TLR4 activation and signalling in vitro and in vivo. METHODS: Fibroblasts cultured at physiological glucose concentration (5.5 mM) were exposed to glucose concentrations from 0 mM to 25 mM, with duplicates placed in a hypoxic chamber. TLR4 inhibition was assessed in the 25 mM glucose groups. Diabetes was induced in wild type (WT) and TLR4 knockout (KO) C57BL/6 mice by intraperitoneal injection of low dose streptozocin (STZ). Hindlimb ischaemia was induced by femoral artery ligation four weeks post streptozocin, and a full thickness 4 mm skin wound inflicted below the knee. Wound healing was assessed via digital planimetry on days 3, 7, and 14 post surgery. RESULTS: Hypoxic and high glucose (25 mM) conditions led to an increase in TLR4 protein expression, apoptosis, and interleukin (IL)-6 release. Inhibition with a TLR4 neutralising antibody and specific TLR4 antagonist ameliorated the effects of high glucose and ischaemia (p < .05). In vivo, wound healing was significantly impaired in the diabetic ischaemic group at day 14 (p < .05). Diabetic ischaemic wounds in TLR4 KO mice exhibited significantly improved healing rates compared with those in WT mice at all time points. CONCLUSION: Hypoxia stimulates upregulation of TLR4 protein expression and this effect is exaggerated by hyperglycaemia. In TLR4 KO mice, there is a significant improvement in the healing of diabetic ischaemic wounds compared with WT. It is suggested that a synergistic effect between hypoxia and hyperglycaemia impairing wound healing exists, through TLR4 mediated inflammation.
- 288Karpova, T.; de Oliveira, A. A.; Naas, H.; Priviero, F.; Nunes, K. P. Blockade of Toll-like Receptor 4 (TLR4) Reduces Oxidative Stress and Restores Phospho-ERK1/2 Levels in Leydig Cells Exposed to High Glucose. Life Sci. 2020, 245, 117365, DOI: 10.1016/j.lfs.2020.117365[Crossref], [PubMed], [CAS], Google Scholar288https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXivVegurc%253D&md5=d4d153386a039d18cc21911a15664737Blockade of Toll-like receptor 4 (TLR4) reduces oxidative stress and restores phospho-ERK1/2 levels in Leydig cells exposed to high glucoseKarpova, Tatiana; Almeida de Oliveira, Amanda; Naas, Huda; Priviero, Fernanda; Nunes, Kenia PedrosaLife Sciences (2020), 245 (), 117365CODEN: LIFSAK; ISSN:0024-3205. (Elsevier B.V.)Hyperglycemia in combination with oxidative stress plays a significant pathophysiol. role in diabetic testicular dysfunction, often leading to infertility. Activation of Toll-like receptor 4 (TLR4) has been reported to mediate oxidative stress during diabetes. However, engagement of the TLR4 signaling pathway in diabetic testicular dysfunction has not been previously explored. Herein, we investigated the role of TLR4 in reactive oxygen species (ROS) prodn. and in the phosphorylation status of ERK1/2 in primary Leydig cells exposed to high glucose and in testis isolated from diabetic rats. Testicular levels of TLR4 and phospho-ERK1/2 were detd. by Western blotting. ROS prodn. was detected with a fluorescent probe. Addnl., primary Leydig cells were exposed to normal (5.5 mmol/l) or elevated (33 mmol/l) glucose concns. and treated with or without a TLR4 inhibitor, CLI095 (10-5 mol/l) for 24 h, followed by evaluation of TLR4 and phospho-ERK1/2 expression levels by Western blotting and immunofluorescence staining, resp. We show that high glucose induces the expression of TLR4 in Leydig cells. Addnl., we demonstrate that blockade of this receptor in this cell population reduces oxidative stress and restores the levels of phospho-ERK1/2. Our findings provide new insight into TLR4 interaction with ROS and MEK/ERK pathway in Leydig cells exposed to high glucose and present a rationale for the development of new therapeutics for diabetic testicular dysfunction.
- 289Wang, H.; Zhang, Q.; Chai, Y.; Liu, Y.; Li, F.; Wang, B.; Zhu, C.; Cui, J.; Qu, H.; Zhu, M. 1,25(OH)2D3 Downregulates the Toll-like Receptor 4-Mediated Inflammatory Pathway and Ameliorates Liver Injury in Diabetic Rats. J. Endocrinol. Invest. 2015, 38 (10), 1083– 1091, DOI: 10.1007/s40618-015-0287-6[Crossref], [PubMed], [CAS], Google Scholar289https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XhvFSju7k%253D&md5=7c79f07bbd93d28fcba6ba9012b185ae1,25(OH)2D3 downregulates the Toll-like receptor 4-mediated inflammatory pathway and ameliorates liver injury in diabetic ratsWang, H.; Zhang, Q.; Chai, Y.; Liu, Y.; Li, F.; Wang, B.; Zhu, C.; Cui, J.; Qu, H.; Zhu, M.Journal of Endocrinological Investigation (2015), 38 (10), 1083-1091CODEN: JEIND7; ISSN:0391-4097. (Springer International Publishing AG)Background: Fatty acid deposition in the liver can activate a no. of pro-inflammatory signaling pathways such as the Toll-like receptor 4 (TLR4) pathway, which may be important in the pathogenesis of nonalcoholic steatohepatitis. 1,25(OH)2D3 downregulates the expression of TLR4 and may represent a novel treatment strategy for reducing hepatocyte injury. Therefore, in this study, we investigated the protective effects of 1,25(OH)2D3 on diabetic liver injury in vivo. Methods: Streptozotocin (STZ)-induced diabetic rats were randomly divided into five groups and treated with low-dose 1,25(OH)2D3 (0.025 μg/kg/day), medium-dose 1,25(OH)2D3 (0.15 μg/kg/day), high-dose 1,25(OH)2D3 (0.3 μg/kg/day), insulin (protamine zinc insulin 16 U/kg/day, s.c. injection), or no intervention (the control group). Sixteen weeks later, the rats were killed, and blood samples were obtained to test lipid profiles and hepatic function. The infiltration of inflammatory cells, the level of fibrosis, and the expression levels of TLR4, nuclear factor-kappa B (NF-κB), and tumor necrosis factor-α (TNF-α) in the liver were analyzed. The hepatocytes were treated with vehicle control, LPS (100 ng), high fat [DMEM + FFA (0.1 mM: palmitic acid, oleic acid, 1:2)], LPS + high fat, vehicle + 1,25(OH)2D3 (10-7 M), LPS + 1,25(OH)2D3, high fat + 1,25(OH)2D3, or LPS + high fat + 1,25(OH)2D3. RNA and protein were extd. to detect the expression of TLR4 and downstream inflammatory factors such as NF-κB, TNF-α, and IL-6. Groups of data were compared by single factor variance anal. Results: High-dose 1,25(OH)2D3 administration for 16 wk downregulated the expression of TLR4, NF-κB, and TNF-α in the liver tissue of diabetic rats and attenuated hepatic inflammation and fibrosis, as shown by immunohistochem. staining, hematoxylin and eosin staining, Masson's trichrome staining, reverse transcription polymerase chain reaction (RT-PCR), and western blotting. In vitro, hepatocytes treated with high fat or LPS exhibited significantly increased expression of TLR4, NF-κB, and downstream inflammatory factors (P < 0.05). Intervention with 1,25(OH)2D3 decreased the expression of TLR4, NF-κB, and inflammatory factors (P < 0.05). Conclusions: 1,25(OH)2D3 exhibited protective effects against diabetes-related liver injury, possibly through downregulation of components of the TLR4 signaling pathway.
- 290Yu, R.; Bo, H.; Villani, V.; Spencer, P. J.; Fu, P. The Inhibitory Effect of Rapamycin on Toll Like Receptor 4 and Interleukin 17 in the Early Stage of Rat Diabetic Nephropathy. Kidney Blood Pressure Res. 2016, 41 (1), 55– 69, DOI: 10.1159/000368547[Crossref], [PubMed], [CAS], Google Scholar290https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28Xjt1ejuro%253D&md5=c33e3ec28adbd56d8d86acedaf10fe85The Inhibitory Effect of Rapamycin on Toll Like Receptor 4 and Interleukin 17 in the Early Stage of Rat Diabetic NephropathyYu, Ruichao; Bo, Hong; Villani, Vincenzo; Spencer, Philip J.; Fu, PingKidney & Blood Pressure Research (2016), 41 (1), 55-69CODEN: KBPRFC; ISSN:1420-4096. (S. Karger AG)Background/Aims: There is increasing evidence showing that innate immune responses and inflammatory processes play an important role in the development and progression of diabetic nephropathy (DN). The potential effect of innate immunity in the early stage of DN is still unclear. Toll-Like-Receptor 4 (TLR4) is vigorously involved in the progress of kidney diseases in a sterile environment. The activation of the interleukin 17 (IL-17) pathway produces inflammatory cytokines, appearing in various kidney diseases. Unfortunately the relationship between TLR4 and IL-17 has not been investigated in diabetic nephropathy to date. The aim of this study is to investigate whether mammalian target of rapamycin (mTOR) inhibition may be dependent on TLR4 signaling and the pro-inflammatory factor IL-17 to delay the progression of DN. Methods: Streptozotocin (STZ)-induced diabetic rats were randomly assigned to 3 exptl. groups: a diabetic nephropathy group (DN, n = 6); and a diabetic nephropathy treated with rapamycin group (Rapa, n = 6) and a control group (Control, n =6). Body wt., fasting blood sugar, and 24h urine albumin were assessed at week 2, week 4 and week 8. Renal tissues were harvested for H&E, PAS staining, as well as an immunohistochem. assay for TLR4 and IL-17. TLR4 quant. expression was measured by Western-Blot anal. and RT-PCR. Results: Our results demonstrated that the expression of both TLR4 and IL-17 were upregulated in early stage DN and reduced by rapamycin. TLR4 and IL-17 both increased and pos. related to 24h urinary albumin and kidney/wt. ratio. However, neither TLR4 nor IL-17 made a significant difference on fasting blood sugar. Conclusions: Taken together, our results confirm and extend previous studies identifying the significance of the TLR4 and Th17 pathways in development of early stage DN. Furthermore, we suggest this overexpression of TLR4 might be involved in the immunopathogenesis of DN through activation of Th17 cells. Rapamycin may attenuate DN via redn. of the TLR4 signaling pathway and Th17 cells signaling. Although the underlying mechanisms need to be explored, the obsd. increase of TLR4 and IL-17 during the early stages of DN and their suppression with rapamycin treatment suggest the importance of TLR4 and IL-17 in DN pathophysiol.
- 291Lin, M.; Yiu, W. H.; Li, R. X.; Wu, H. J.; Wong, D. W. L.; Chan, L. Y. Y.; Leung, J. C. K.; Lai, K. N.; Tang, S. C. W. The TLR4 Antagonist CRX-526 Protects against Advanced Diabetic Nephropathy. Kidney Int. 2013, 83 (5), 887– 900, DOI: 10.1038/ki.2013.11[Crossref], [PubMed], [CAS], Google Scholar291https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXntVWqtbk%253D&md5=4697ed2343a5e2e12656f0110351808aThe TLR4 antagonist CRX-526 protects against advanced diabetic nephropathyLin, Miao; Yiu, Wai Han; Li, Rui Xi; Wu, Hao Jia; Wong, Dickson W. L.; Chan, Loretta Y. Y.; Leung, Joseph C. K.; Lai, Kar Neng; Tang, Sydney C. W.Kidney International (2013), 83 (5), 887-900CODEN: KDYIA5; ISSN:0085-2538. (Nature Publishing Group)We recently showed that Toll-like receptor (TLR) TLR4 was overexpressed in the human diabetic kidney, which could promote tubular inflammation. Here we explored whether the TLR4 antagonist, CRX-526, has therapeutic potential to attenuate renal injuries and slow the progression of advanced diabetic nephropathy in wild-type and endothelial nitric oxide synthase (eNOS) knockout mice. In the latter, the endogenous TLR4 ligand, high-mobility group box 1, was upregulated more than in wild-type animals. Four weeks after streptozotocin induction of diabetes, mice were injected with either CRX-526 or vehicle for 8 wk. CRX-526 significantly reduced albuminuria and blood urea nitrogen without altering blood glucose and systolic blood pressure in diabetic mice. Glomerular hypertrophy, glomerulosclerosis, and tubulointerstitial injury were attenuated by CRX-526, which was assocd. with decreased chemokine (C-C motif) ligand (CCL)-2, osteopontin, CCL-5 overexpression, subsequent macrophage infiltration, and collagen deposition. These effects were assocd. with inhibition of TGF-β overexpression and NF-κB activation. In vitro, CRX-526 inhibited high glucose-induced osteopontin upregulation and NF-κB nuclear translocation in cultured human proximal tubular epithelial cells. Thus, we provided evidence that inhibition of TLR4 with the synthetic antagonist CRX-526 conferred renoprotective effects in eNOS knockout diabetic mice with advanced diabetic nephropathy. Kidney International (2013) 83, 887-900; doi:10.1038/ki.2013.11; published online 20 Feb. 2013.
- 292Dasu, M. R.; Ramirez, S.; Isseroff, R. R. Toll-like Receptors and Diabetes: A Therapeutic Perspective. Clin. Sci. 2012, 122 (5), 203– 214, DOI: 10.1042/CS20110357[Crossref], [PubMed], [CAS], Google Scholar292https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3MXhsVCksLjL&md5=fe91e352c631e9a5745ca7cb4c691a6dToll-like receptors and diabetes: a therapeutic perspectiveDasu, Mohan R.; Ramirez, Sandra; Isseroff, Roslyn R.Clinical Science (2012), 122 (5/6), 203-214CODEN: CSCIAE; ISSN:0143-5221. (Portland Press Ltd.)A review. Diabetes is a multifactorial metabolic disorder that leads to a no. of complications. Diabetes is estd. to affect 36 million people in the U.S.A., and the prevalence of diagnosed and undiagnosed diabetes is at 9.3% and continues to rise. Evidence from exptl. animal models as well as humans has indicated that systemic inflammation plays a role in the pathophysiol. processes of diabetes and is facilitated by innate immune responses. TLRs (Toll-like receptors) are key innate immune receptors that recognize conserved PAMPs (pathogen-assocd. mol. patterns), induce inflammatory responses essential for host defences and initiate an adaptive immune response. Although TLR expression is increased in a plethora of inflammatory disorders, the effects of metabolic aberrations on TLRs and their role in diabetes and its complications is still emerging. In the present paper, we provide a systematic review on how TLRs play a detrimental role in the pathogenic processes [increased blood sugar, NEFAs (non-esterified free' fatty acids), cytokines and ROS (reactive oxygen species)] that manifest diabetes. Furthermore, we will highlight some of the therapeutic strategies targeted at decreasing TLRs to abrogate inflammation in diabetes that may eventually result in decreased complications.
- 293Hayward, J. H.; Lee, S. J. A Decade of Research on TLR2 Discovering Its Pivotal Role in Glial Activation and Neuroinflammation in Neurodegenerative Diseases. Exp. Neurobiol. 2014, 23 (2), 138– 147, DOI: 10.5607/en.2014.23.2.138[Crossref], [PubMed], [CAS], Google Scholar293https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC2cfmsFyhsA%253D%253D&md5=eccb103351c7f6f5f44ed90478ddf6b7A Decade of Research on TLR2 Discovering Its Pivotal Role in Glial Activation and Neuroinflammation in Neurodegenerative DiseasesHayward Jin Hee; Lee Sung JoongExperimental neurobiology (2014), 23 (2), 138-47 ISSN:1226-2560.Toll-like receptors (TLRs) belong to a class of pattern recognition receptors that play an important role in host defense against pathogens. TLRs on innate immune cells recognize a wide variety of pathogen-associated molecular patterns (PAMPs) and trigger innate immune responses. Later, it was revealed that the same receptors are also utilized to detect tissue damage to trigger inflammatory responses in the context of non-infectious inflammation. In the nervous system, different members of the TLR family are expressed on glial cells including astrocytes, microglia, oligodendrocytes, and Schwann cells, implicating their putative role in innate/inflammatory responses in the nervous system. In this regard, we have investigated the function of TLRs in neuroinflammation. We discovered that a specific member of the TLR family, namely TLR2, functions as a master sentry receptor to detect neuronal cell death and tissue damage in many different neurological conditions including nerve transection injury, intracerebral hemorrhage, traumatic brain injury, and hippocampal excitotoxicity. In this review, we have summarized our research for the last decade on the role of TLR2 in neuroinflammation in the above neurological disorders. Our data suggest that TLR2 can be an efficient target to regulate unwanted inflammatory response in these neurological conditions.
- 294Rangasamy, S. B.; Jana, M.; Roy, A.; Corbett, G. T.; Kundu, M.; Chandra, S.; Mondal, S.; Dasarathi, S.; Mufson, E. J.; Mishra, R. K.; Luan, C. H.; Bennett, D. A.; Pahan, K. Selective Disruption of TLR2-MyD88 Interaction Inhibits Inflammation and Attenuates Alzheimer’s Pathology. J. Clin. Invest. 2018, 128 (10), 4297– 4312, DOI: 10.1172/JCI96209[Crossref], [PubMed], [CAS], Google Scholar294https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB3c%252FmsFGrsg%253D%253D&md5=92f997711b4deb1df2b09bd4e80e1ceaSelective disruption of TLR2-MyD88 interaction inhibits inflammation and attenuates Alzheimer's pathologyRangasamy Suresh B; Jana Malabendu; Roy Avik; Corbett Grant T; Kundu Madhuchhanda; Chandra Sujyoti; Mondal Susanta; Dasarathi Sridevi; Pahan Kalipada; Mufson Elliott J; Mishra Rama K; Luan Chi-Hao; Bennett David A; Pahan KalipadaThe Journal of clinical investigation (2018), 128 (10), 4297-4312 ISSN:.Induction of TLR2 activation depends on its association with the adapter protein MyD88. We have found that TLR2 and MyD88 levels are elevated in the hippocampus and cortex of patients with Alzheimer's disease (AD) and in a 5XFAD mouse model of AD. Since there is no specific inhibitor of TLR2, to target induced TLR2 from a therapeutic angle, we engineered a peptide corresponding to the TLR2-interacting domain of MyD88 (TIDM) that binds to the BB loop of only TLR2, and not other TLRs. Interestingly, WT TIDM peptide inhibited microglial activation induced by fibrillar Aβ1-42 and lipoteichoic acid, but not 1-methyl-4-phenylpyridinium, dsRNA, bacterial lipopolysaccharide, flagellin, or CpG DNA. After intranasal administration, WT TIDM peptide reached the hippocampus, reduced hippocampal glial activation, lowered Aβ burden, attenuated neuronal apoptosis, and improved memory and learning in 5XFAD mice. However, WT TIDM peptide was not effective in 5XFAD mice lacking TLR2. In addition to its effects in 5XFAD mice, WT TIDM peptide also suppressed the disease process in mice with experimental allergic encephalomyelitis and collagen-induced arthritis. Therefore, selective targeting of the activated status of 1 component of the innate immune system by WT TIDM peptide may be beneficial in AD as well as other disorders in which TLR2/MyD88 signaling plays a role in disease pathogenesis.
- 295Kwon, S.; Iba, M.; Masliah, E.; Kim, C. Targeting Microglial and Neuronal Toll-like Receptor 2 in Synucleinopathies. Exp. Neurobiol. 2019, 28 (5), 547– 553, DOI: 10.5607/en.2019.28.5.547[Crossref], [PubMed], [CAS], Google Scholar295https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB3MjmtlegtA%253D%253D&md5=e182dea6144d38fdf8d9be7974ec6e26Targeting Microglial and Neuronal Toll-like Receptor 2 in SynucleinopathiesKwon Somin; Iba Michiyo; Masliah Eliezer; Kim ChangyounExperimental neurobiology (2019), 28 (5), 547-553 ISSN:1226-2560.Synucleinopathies are neurodegenerative disorders characterized by the progressive accumulation of α-synuclein (α-syn) in neurons and glia and include Parkinson's disease (PD) and dementia with Lewy bodies (DLB). In this review, we consolidate our key findings and recent studies concerning the role of Toll-like receptor 2 (TLR2), a pattern recognition innate immune receptor, in the pathogenesis of synucleinopathies. First, we address the pathological interaction of α-syn with microglial TLR2 and its neurotoxic inflammatory effects. Then, we show that neuronal TLR2 activation not only induces abnormal α-syn accumulation by impairing autophagy, but also modulates α-syn transmission. Finally, we demonstrate that administration of a TLR2 functional inhibitor improves the neuropathology and behavioral deficits of a synucleinopathy mouse model. Altogether, we present TLR2 modulation as a promising immunotherapy for synucleinopathies.
- 296Fiebich, B. L.; Batista, C. R. A.; Saliba, S. W.; Yousif, N. M.; de Oliveira, A. C. P. Role of Microglia TLRs in Neurodegeneration. Front. Cell. Neurosci. 2018, 12, 329, DOI: 10.3389/fncel.2018.00329[Crossref], [PubMed], [CAS], Google Scholar296https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhvFyjt7rO&md5=b52b7a17d8604b2181ac5152901e01d7Role of microglia TLR in neurodegenerationFiebich, Bernd L.; Batista, Carla Ribeiro Alvares; Saliba, Soraya Wilke; Yousif, Nizar M.; Pinheiro de Oliveira, Antonio CarlosFrontiers in Cellular Neuroscience (2018), 12 (), 329CODEN: FCNRAH; ISSN:1662-5102. (Frontiers Media S.A.)Toll-like receptors (TLRs) are a group of receptors widely distributed in the organism. In the central nervous system, they are expressed in neurons, astrocytes and microglia. Although their involvement in immunity is notorious, different articles have demonstrated their roles in physiol. and pathol. conditions, including neurodegeneration. There is increasing evidence of an involvement of TLRs, esp. TLR2, 4 and 9 in neurodegenerative diseases such as Alzheimer's disease (AD), Parkinson's disease (PD), and amyotrophic lateral sclerosis (ALS). In this sense, their expression in microglia might modulate the activity of these cells, which in turn, lead to protective or deleterious effects over neurons and other cells. Therefore, TLRs might mediate the link between inflammation and neurodegenerative diseases. However, further studies have to be performed to elucidate the role of the other TLRs in these diseases and to further prove and confirm the pathophysiol. role of all TLRs in neurodegeneration. In this article, we revise and summarize the current knowledge regarding the role of TLRs in neurodegeneration with the focus on the possible functions of these receptors in microglia.
- 297Mulfaul, K.; Ozaki, E.; Fernando, N.; Brennan, K.; Chirco, K. R.; Connolly, E.; Greene, C.; Maminishkis, A.; Salomon, R. G.; Linetsky, M.; Natoli, R.; Mullins, R. F.; Campbell, M.; Doyle, S. L. Toll-like Receptor 2 Facilitates Oxidative Damage-Induced Retinal Degeneration. Cell Rep. 2020, 30 (7), 2209– 2224.e5, DOI: 10.1016/j.celrep.2020.01.064[Crossref], [PubMed], [CAS], Google Scholar297https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXls1CrurY%253D&md5=5420f058925d597585db64b7dd80a1d8Toll-like Receptor 2 Facilitates Oxidative Damage-Induced Retinal DegenerationMulfaul, Kelly; Ozaki, Ema; Fernando, Nilisha; Brennan, Kiva; Chirco, Kathleen R.; Connolly, Emma; Greene, Chris; Maminishkis, Arvydas; Salomon, Robert G.; Linetsky, Mikhail; Natoli, Riccardo; Mullins, Robert F.; Campbell, Matthew; Doyle, Sarah L.Cell Reports (2020), 30 (7), 2209-2224.e5CODEN: CREED8; ISSN:2211-1247. (Cell Press)Retinal degeneration is a form of neurodegenerative disease and is the leading cause of vision loss globally. The Toll-like receptors (TLRs) are primary components of the innate immune system involved in signal transduction. Here we show that TLR2 induces complement factors C3 and CFB, the common and rate-limiting factors of the alternative pathway in both retinal pigment epithelial (RPE) cells and mononuclear phagocytes. Neutralization of TLR2 reduces opsonizing fragments of C3 in the outer retina and protects photoreceptor neurons from oxidative stress-induced degeneration. TLR2 deficiency also preserves tight junction expression and promotes RPE resistance to fragmentation. Finally, oxidative stress-induced formation of the terminal complement membrane attack complex and Iba1+ cell infiltration are strikingly inhibited in the TLR2-deficient retina. Our data directly implicate TLR2 as a mediator of retinal degeneration in response to oxidative stress and present TLR2 as a bridge between oxidative damage and complement-mediated retinal pathol.
- 298Kohno, H.; Chen, Y.; Kevany, B. M.; Pearlman, E.; Miyagi, M.; Maeda, T.; Palczewski, K.; Maeda, A. Photoreceptor Proteins Initiate Microglial Activation via Toll-like Receptor 4 in Retinal Degeneration Mediated by All-Trans-Retinal. J. Biol. Chem. 2013, 288 (21), 15326– 15341, DOI: 10.1074/jbc.M112.448712[Crossref], [PubMed], [CAS], Google Scholar298https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXot1Wit7o%253D&md5=a9dd51f7758d0d0acccdb1bc17629c23Photoreceptor proteins initiate microglial activation via toll-like receptor 4 in retinal degeneration mediated by all-trans-retinalKohno, Hideo; Chen, Yu; Kevany, Brian M.; Pearlman, Eric; Miyagi, Masaru; Maeda, Tadao; Palczewski, Krzysztof; Maeda, AkikoJournal of Biological Chemistry (2013), 288 (21), 15326-15341CODEN: JBCHA3; ISSN:0021-9258. (American Society for Biochemistry and Molecular Biology)Although several genetic and biochem. factors are assocd. with the pathogenesis of retinal degeneration, it has yet to be detd. how these different impairments can cause similar degenerative phenotypes. Here, we report microglial/macrophage activation in both a Stargardt disease and age-related macular degeneration mouse model caused by delayed clearance of all-trans-retinal from the retina, and in a retinitis pigmentosa mouse model with impaired retinal pigment epithelium (RPE) phagocytosis. Mouse microglia displayed RPE cytotoxicity and increased prodn. of inflammatory chemokines/cytokines, Ccl2, Il1b, and Tnf, after coincubation with ligands that activate innate immunity. Notably, phagocytosis of photoreceptor proteins increased the activation of microglia/macrophages and RPE cells isolated from model mice as well as wild-type mice. The mRNA levels of Tlr2 and Tlr4, which can recognize proteins as their ligands, were elevated in mice with retinal degeneration. Bone marrow-derived macrophages from Tlr4-deficient mice did not increase Ccl2 after coincubation with photoreceptor proteins. Tlr4-/-Abca4-/-Rdh8-/- mice displayed milder retinal degenerative phenotypes than Abca4-/-Rdh8-/- mice. Addnl., inactivation of microglia/macrophages by pharmacol. approaches attenuated mouse retinal degeneration. This study demonstrates an important contribution of TLR4-mediated microglial activation by endogenous photoreceptor proteins in retinal inflammation that aggravates retinal cell death. This pathway is likely to represent an underlying common pathol. in degenerative retinal disorders.
- 299Huang, Z.; Zhou, T.; Sun, X.; Zheng, Y.; Cheng, B.; Li, M.; Liu, X.; He, C. Necroptosis in Microglia Contributes to Neuroinflammation and Retinal Degeneration through TLR4 Activation. Cell Death Differ. 2018, 25 (1), 180– 189, DOI: 10.1038/cdd.2017.141[Crossref], [PubMed], [CAS], Google Scholar299https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXhsVKlsL%252FP&md5=71daa04c318f096174ada4a5470b57e0Necroptosis in microglia contributes to neuroinflammation and retinal degeneration through TLR4 activationHuang, Zijing; Zhou, Tian; Sun, Xiaowei; Zheng, Yingfeng; Cheng, Bing; Li, Mei; Liu, Xialin; He, ChangCell Death & Differentiation (2018), 25 (1), 180-189CODEN: CDDIEK; ISSN:1350-9047. (Nature Research)Inflammation has emerged to be a crit. mechanism responsible for neural damage and neurodegenerative diseases. Microglia, the resident innate immune cells in retina, are implicated as principal components of the immunol. insult to retinal neural cells. The involvement of microglia in retinal inflammation is complex and here we propose for the first time that necroptosis in microglia triggers neuroinflammation and exacerbates retinal neural damage and degeneration. We found microglia experienced receptor-interacting protein kinase 1 (RIP1)- and RIP3-dependent necroptosis not only in the retinal degenerative rd1 mice, but also in the acute retinal neural injury mice. The necroptotic microglia released various pro-inflammatory cytokines and chemokines, such as tumor necrosis factor-α and chemokine (C-C motif) ligand 2, which orchestrated the retinal inflammation. Importantly, necroptosis blockade using necrostatin-1 could suppress microglia-mediated inflammation, rescue retinal degeneration or prevent neural injury in vivo. Meanwhile, cultured microglia underwent RIP1/3-mediated necroptosis and the necroptotic microglia produced large amts. of pro-inflammatory cytokines in response to lipopolysaccharide or oxidative stress in vitro. Mech., TLR4 deficiency ameliorated microglia necroptosis with decreased expression levels of machinery mols. RIP1 and RIP3, and suppressed retinal inflammation, suggesting that TLR4 signaling was required in microglia necroptosis-mediated inflammation. Thus, we proposed that microglia experienced necroptosis through TLR4 activation, promoting an inflammatory response that serves to exacerbate considerable neural damage and degeneration. Necroptosis blockade therefore emerged as a novel therapeutic strategy for tempering microglia-mediated neuroinflammation and ameliorating neural injury and neurodegenerative diseases.
- 300Liao, W. Y.; Tsai, T. H.; Ho, T. Y.; Lin, Y. W.; Cheng, C. Y.; Hsieh, C. L. Neuroprotective Effect of Paeonol Mediates Anti-Inflammation via Suppressing Toll-like Receptor 2 and Toll-like Receptor 4 Signaling Pathways in Cerebral Ischemia-Reperfusion Injured Rats. Evidence-based Complement. Altern. Med. 2016, 2016, 3704647, DOI: 10.1155/2016/3704647[Crossref], [PubMed], [CAS], Google Scholar300https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC1c7ntFWjtQ%253D%253D&md5=7503d213963543ad680a9539bcf2473aNeuroprotective Effect of Paeonol Mediates Anti-Inflammation via Suppressing Toll-Like Receptor 2 and Toll-Like Receptor 4 Signaling Pathways in Cerebral Ischemia-Reperfusion Injured RatsLiao Wen-Yen; Ho Tin-Yun; Tsai Tung-Hu; Lin Yi-Wen; Cheng Chin-Yi; Hsieh Ching-LiangEvidence-based complementary and alternative medicine : eCAM (2016), 2016 (), 3704647 ISSN:1741-427X.Paeonol is a phenolic compound derived from Paeonia suffruticosa Andrews (MC) and P. lactiflora Pall (PL). Paeonol can reduce cerebral infarction volume and improve neurological deficits through antioxidative and anti-inflammatory effects. However, the anti-inflammatory pathway of paeonol remains unclear. This study investigated the relationship between anti-inflammatory responses of paeonol and signaling pathways of TLR2 and TLR4 in cerebral infarct. We established the cerebral ischemia-reperfusion model in Sprague Dawley rats by occluding right middle cerebral artery for 60 min, followed by reperfusion for 24 h. The neurological deficit score was examined, and the brains of the rats were removed for cerebral infarction volume and immunohistochemistry (IHC) analysis. The infarction volume and neurological deficits were lower in the paeonol group (pretreatment with paeonol; 20 mg/kg i.p.) than in the control group (without paeonol treatment). The IHC analysis revealed that the number of TLR2-, TLR4-, Iba1-, NF-κB- (P50-), and IL-1β-immunoreactive cells and TUNEL-positive cells was significantly lower in the paeonol group; however, the number of TNF-α-immunoreactive cells did not differ between the paeonol and control groups. The paeonol reveals some neuroprotective effects in the model of ischemia, which could be due to the reduction of many proinflammatory receptors/mediators, although the mechanisms are not clear.
- 301Zhao, R.; Zhang, J.; Wang, Y.; Jin, J.; Zhou, H.; Chen, J.; Su, S. B. Activation of Toll-like Receptor 3 Promotes Pathological Corneal Neovascularization by Enhancement of SDF-1-Mediated Endothelial Progenitor Cell Recruitment. Exp. Eye Res. 2019, 178, 177– 185, DOI: 10.1016/j.exer.2018.10.005[Crossref], [PubMed], [CAS], Google Scholar301https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhvFejtbbK&md5=f78b6dc2f05f7761b94d0a1711a89d45Activation of Toll-like receptor 3 promotes pathological corneal neovascularization by enhancement of SDF-1-mediated endothelial progenitor cell recruitmentZhao, Ruijuan; Zhang, Jing; Wang, Yan; Jin, Jiayi; Zhou, Hongyan; Chen, Jianping; Su, Shao BoExperimental Eye Research (2019), 178 (), 177-185CODEN: EXERA6; ISSN:0014-4835. (Elsevier Ltd.)Toll-like receptors (TLRs) play an important role in inflammatory and immunol. responses, which are intimately related to neovascularization. However, the precise mode of action of TLR3 in neovascularization still remains ambiguous. In this study, we sought to investigate the role of TLR3 in pathol. corneal neovascularization (CNV) using a mouse model of alkali-induced CNV. CNV was attenuated in TLR3-deficient mice, and the absence of TLR3 led to decreased prodn. of stromal cell-derived factor 1 (SDF-1), a well-characterized cytokine that regulates the recruitment of endothelial progenitor cells (EPCs) to the sites of neo-angiogenic niches in the injured tissues. Topical administration of polyinosinic-polycytidylic acid [poly (I:C)], a synthetic ligand for TLR3, to the injured cornea promoted CNV in wild type (WT) mice but not in TLR3-deficient mice. In addn., the effect of poly (I:C) on WT mice was abolished by addn. of SDF-1 receptor antagonist AMD 3100. Furthermore, poly (I:C) treatment in vitro enhanced the migration of EPCs, whereas the enhanced migration was abolished by AMD 3100. These results indicate an essential role of TLR3 signalling in CNV that involves upregulating SDF-1 prodn. and recruiting EPCs to the sites of injury for neovascularization. Thus, targeting the TLR3 signalling cascade may constitute a novel therapeutic approach for treating neovascularization-related diseases.
- 302Leitner, G. R.; Wenzel, T. J.; Marshall, N.; Gates, E. J.; Klegeris, A. Targeting Toll-like Receptor 4 to Modulate Neuroinflammation in Central Nervous System Disorders. Expert Opin. Ther. Targets 2019, 23 (10), 865– 882, DOI: 10.1080/14728222.2019.1676416[Crossref], [PubMed], [CAS], Google Scholar302https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB3Mnks1Cqug%253D%253D&md5=e9ee1cb7b3db6b0bc6d873543cd88705Targeting toll-like receptor 4 to modulate neuroinflammation in central nervous system disordersLeitner Gunnar R; Wenzel Tyler J; Marshall Nick; Gates Ellen J; Klegeris AndisExpert opinion on therapeutic targets (2019), 23 (10), 865-882 ISSN:.Introduction: Adverse immune activation contributes to many central nervous system (CNS) disorders. All main CNS cell types express toll-like receptor 4 (TLR 4). This receptor is critical for a myriad of immune functions such as cytokine secretion and phagocytic activity of microglia; however, imbalances in TLR 4 activation can contribute to the progression of neurodegenerative diseases. Areas covered: We considered available evidence implicating TLR 4 activation in the following CNS pathologies: Alzheimer's disease, Parkinson's disease, ischemic stroke, traumatic brain injury, multiple sclerosis, multiple systems atrophy, and Huntington's disease. We reviewed studies reporting effects of TLR 4-specific antagonists and agonists in models of peripheral and CNS diseases from the perspective of possible future use of TLR 4 ligands in CNS disorders. Expert opinion: TLR 4-specific antagonists could suppress neuroinflammation by reducing overproduction of inflammatory mediators; however, they may interfere with protein clearance mechanisms and myelination. Agonists that specifically activate myeloid differentiation primary-response protein 88 (MyD88)-independent pathway of TLR 4 signaling could facilitate beneficial glial phagocytic activity with limited activity as inducers of proinflammatory mediators. Deciphering the disease stage-specific involvement of TLR 4 in CNS pathologies is crucial for the future clinical development of TLR 4 agonists and antagonists.
- 303Chavali, V. D.; Agarwal, M.; Vyas, V. K.; Saxena, B. Neuroprotective Effects of Ethyl Pyruvate against Aluminum Chloride-Induced Alzheimer’s Disease in Rats via Inhibiting Toll-Like Receptor 4. J. Mol. Neurosci. 2020, 70, 836– 850, DOI: 10.1007/s12031-020-01489-9[Crossref], [PubMed], [CAS], Google Scholar303https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXislCnt7o%253D&md5=c17f83ce6b4d1546ca8c69509295a64eNeuroprotective Effects of Ethyl Pyruvate against Aluminum Chloride-Induced Alzheimer's Disease in Rats via Inhibiting Toll-Like Receptor 4Chavali, Vijaya Durga; Agarwal, Milee; Vyas, Vivek Kumar; Saxena, BhagawatiJournal of Molecular Neuroscience (2020), 70 (6), 836-850CODEN: JMNEES; ISSN:0895-8696. (Humana Press Inc.)The present study aimed to investigate the neuroprotective role of Et pyruvate against in vitro and in vivo model of aluminum chloride (AlCl3)-induced AD. In vivo model, AlCl3 (50 mg/kg) were given through i.p. route (i.p.) once daily for 4 wk in rats and after 2 wk, Et pyruvate (50, 100, 200 mg/kg/day) was co-administered with AlCl3 once daily via the oral route. The present study, in addn. to perform histopathol. of the brain, also estd. oxidant and antioxidant parameters as well as memory impairment using pole test, plus maze, and Morris water maze test. The binding mode of Et pyruvate in the hMD-2 was also studied. AlCl3 administration in rats resulted in memory loss, oxidative stress (increased lipid peroxide and nitric oxide), impairment of antioxidant mechanisms (superoxide dismutase, catalase, and reduced glutathione), and deposition of amyloid plaques in cerebral cortex region of the brain. AlCl3 also resulted in the overexpression of the TLR4 receptors in the brain tissues. Administration of Et pyruvate ameliorated the AlCl3-induced neurotoxicity in neuron-glial mixed cell culture as well as histopathol., neurochem., and behavioral consequences of chronic administration of AlCl3 in the rat. Et pyruvate showed a docking score of 4.048. Thus, Et pyruvate is effective against in vitro and in vivo models of AlCl3-induced AD.
- 304Kamigaki, M.; Hide, I.; Yanase, Y.; Shiraki, H.; Harada, K.; Tanaka, Y.; Seki, T.; Shirafuji, T.; Tanaka, S.; Hide, M.; Sakai, N. The Toll-like Receptor 4-Activated Neuroprotective Microglia Subpopulation Survives via Granulocyte Macrophage Colony-Stimulating Factor and JAK2/STAT5 Signaling. Neurochem. Int. 2016, 93, 82– 94, DOI: 10.1016/j.neuint.2016.01.003[Crossref], [PubMed], [CAS], Google Scholar304https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XhvFSqu7Y%253D&md5=dfd68a98d3d9c0843b28fb8ec48beb2bThe Toll-like receptor 4-activated neuroprotective microglia subpopulation survives via granulocyte macrophage colony-stimulating factor and JAK2/STAT5 signalingKamigaki, Mayumi; Hide, Izumi; Yanase, Yuhki; Shiraki, Hiroko; Harada, Kana; Tanaka, Yoshiki; Seki, Takahiro; Shirafuji, Toshihiko; Tanaka, Shigeru; Hide, Michihiro; Sakai, NorioNeurochemistry International (2016), 93 (), 82-94CODEN: NEUIDS; ISSN:0197-0186. (Elsevier Ltd.)Toll-like receptor (TLR) 4 mediates inflammation and is also known to trigger apoptosis in microglia. Our time-lapse observations showed that lipopolysaccharide (LPS) stimulation induced rapid death in primary cultures of rat microglia, while a portion of the microglia escaped from death and survived for much longer than 2 days, in which time, all of the control cells had died. However, it remains unclear how the LPS-stimulated microglia subpopulation could continue to survive in the absence of any supplied growth factors. In the present study, to clarify the mechanism underlying the LPS-stimulated survival, we investigated whether microglia could produce their own survival factors in response to LPS, focusing on macrophage colony-stimulating factor (M-CSF), granulocyte macrophage colony-stimulating factor (GM-CSF) and interleukin (IL)-34, which are mainly supplied by astrocytes or neurons. The LPS-stimulated microglia drastically induced the expression of the GM-CSF mRNA and protein, while M-CSF and IL-34 levels were unchanged. The surviving microglia also significantly upregulated the expression of GM-CSF receptor (GM-CSFR) mRNA without affecting M-CSFR. As for the GM-CSFR downstream signal, LPS resulted in the phosphorylation of STAT5 and its translocation to the nucleus in the surviving microglia. Moreover, a specific JAK2 inhibitor, NVP-BSK805, suppressed STAT5 phosphorylation and microglia survival in response to LPS, indicating a crit. role of the JAK2/STAT5 pathway in this survival mechanism. Together, these results suggest that a subpopulation of TLR4-activated microglia may survive by producing GM-CSF and up-regulating GM-CSFR. This autocrine GM-CSF pathway may activate the JAK2/STAT5 signaling pathway, which controls the transcription of survival-related genes. Finally, these surviving microglia may have neuroprotective functions because the neurons remained viable in co-cultures with these microglia.
- 305Feng, Y.; Gao, J.; Cui, Y.; Li, M.; Li, R.; Cui, C.; Cui, J. Neuroprotective Effects of Resatorvid Against Traumatic Brain Injury in Rat: Involvement of Neuronal Autophagy and TLR4 Signaling Pathway. Cell. Mol. Neurobiol. 2017, 37 (1), 155– 168, DOI: 10.1007/s10571-016-0356-1[Crossref], [PubMed], [CAS], Google Scholar305https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XksVyhu74%253D&md5=f937ed42018bfa32354adb68e47e178aNeuroprotective Effects of Resatorvid Against Traumatic Brain Injury in Rat: Involvement of Neuronal Autophagy and TLR4 Signaling PathwayFeng, Yan; Gao, Junling; Cui, Ying; Li, Minghang; Li, Ran; Cui, Changmeng; Cui, JianzhongCellular and Molecular Neurobiology (2017), 37 (1), 155-168CODEN: CMNEDI; ISSN:0272-4340. (Springer)Accumulating evidence indicates that autophagy and inflammatory responses contributes to secondary brain injury after traumatic brain injury (TBI), and toll-like receptor 4 (TLR4) is considered to involvement of this cascade and plays an important role. The present study was designed to det. the hypothesis that administration of resatorvid (TAK-242), a TLR4 antagonist, might provide a neuroprotective effect by inhibit TLR4-mediated pathway in a TBI rat model. Rat subjected to controlled cortical impact injury were injected with TAK-242 (0.5 mg/kg, i.v. injected) 10 min prior to injury. The results demonstrated that TAK-242 treatment significantly attenuated TBI-induced neurons loss, brain edema, and neurobehavioral impairment in rats. Immunoblotting anal. showed that TAK-242 treatment reduced TBI-induced TLR4, Beclin 1, and LC3-II levels, and maintained p62 levels at 24 h. Double immunolabeling demonstrated that LC3 dots co-localized with the hippocampus pyramidal neurons, and TLR4 was localized with the hippocampus neurons and astrocytes. In addn., the expression of TLR4 downstream signaling mols., including MyD88, TRIF, NF-κB, TNF-α, and IL-1β, was significantly downregulated in hippocampus tissue by Western blot anal. In conclusion, our findings indicate that pre-injury treatment with TAK-242 could inhibit neuronal autophagy and neuroinflammation responses in the hippocampus in a rat model of TBI. The neuroprotective effects of TAK-242 may be related to modulation of the TLR4-MyD88/TRIF-NF-κB signaling pathway. Furthermore, the study also suggests that TAK-242, an attractive potential drug, may be a promising drug candidate for TBI.
- 306Yang, L.; Zhou, R.; Tong, Y.; Chen, P.; Shen, Y.; Miao, S.; Liu, X. Neuroprotection by Dihydrotestosterone in LPS-Induced Neuroinflammation. Neurobiol. Dis. 2020, 140, 104814, DOI: 10.1016/j.nbd.2020.104814[Crossref], [PubMed], [CAS], Google Scholar306https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXms1yksLc%253D&md5=fff1da4f572a8c57a5bff744209c447aNeuroprotection by dihydrotestosterone in LPS-induced neuroinflammationYang, Lei; Zhou, Renyuan; Tong, Yu; Chen, Pengfei; Shen, Yu; Miao, Shuai; Liu, XiaoqiangNeurobiology of Disease (2020), 140 (), 104814CODEN: NUDIEM; ISSN:0969-9961. (Elsevier Inc.)Microglia-induced neuroinflammation plays a vital role in the etiol. and progression of neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease and multiple sclerosis. The neuroprotective role of androgens, including testosterone and its metabolite dihydrotestosterone (DHT), has been increasingly demonstrated in these diseases, but few studies investigated the effects of androgen on neuroinflammation. This study investigated the role of DHT in lipopolysaccharide (LPS)-induced neuroinflammation, neuronal damage and behavioral dysfunction, as well as underlying mechanisms. We showed that DHT inhibited LPS-induced release of proinflammatory factors, including TNF-α, IL-1β, IL-6; iNOS, COX-2, NO, and PGE2 in BV2 cells and primary microglia by suppressing the TLR4-mediated NF-κB and MAPK p38 signaling pathways, thus protecting SH-SY5Y neurons from inflammatory damage induced by activated microglia. In an LPS-induced neuroinflammation mouse model, endogenous DHT depletion by castration exacerbated inflammatory responses by upregulating the levels of TNF-α, IL-1β, IL-6, iNOS, and COX-2 in the serum and brain by increasing the LR4-mediated NF-κB and MAPK pathway activation, but these effects were restored by exogenous DHT supplementation. Moreover, DHT also regulated the mRNA levels of the anti-inflammatory cytokines IL-10 and IL-13 in the brain. In addn., DHT modulated the expression of Aβ, the apoptotic proteins caspase-3, Bcl-2, and Bax, and synaptophysin, as well as neuronal damage in LPS-treated mouse brains. Further behavioral tests revealed that DHT ameliorated LPS-induced spatial and learning impairment and motor incoordination, and partly improved the locomotor activity in LPS-injected mice. Therefore, this study suggests that DHT exerts anti-neuroinflammatory and neuroprotective effects; thus, androgen replacement therapy is a potential therapeutic strategy for improving cognitive and behavioral function in neuroinflammation-related diseases.
- 307De Paola, M.; Mariani, A.; Bigini, P.; Peviani, M.; Ferrara, G.; Molteni, M.; Gemma, S.; Veglianese, P.; Castellaneta, V.; Boldrin, V.; Rossetti, C.; Chiabrando, C.; Forloni, G.; Mennini, T.; Fanelli, R. Neuroprotective Effects of Toll-like Receptor 4 Antagonism in Spinal Cord Cultures and in a Mouse Model of Motor Neuron Degeneration. Mol. Med. 2012, 18 (6), 971– 981, DOI: 10.2119/molmed.2012.00020[Crossref], [PubMed], [CAS], Google Scholar307https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC38XhsVWgsrfI&md5=8b742990a09e929bc66f3a83b59a627fNeuroprotective effects of Toll-like receptor 4 antagonism in spinal cord cultures and in a mouse model of motor neuron degenerationDe Paola, Massimiliano; Mariani, Alessandro; Bigini, Paolo; Peviani, Marco; Ferrara, Giovanni; Molteni, Monica; Gemma, Sabrina; Veglianese, Pietro; Castellaneta, Valeria; Boldrin, Valentina; Rossetti, Carlo; Chiabrando, Chiara; Forloni, Gianluigi; Mennini, Tiziana; Fanelli, RobertoMolecular Medicine (Manhasset, NY, United States) (2012), 18 (6), 971-981CODEN: MOMEF3; ISSN:1076-1551. (Feinstein Institute for Medical Research)Sustained inflammatory reactions are common pathol. events assocd. with neuron loss in neurodegenerative diseases. Reported evidence suggests that Toll-like receptor 4 (TLR4) is a key player of neuroinflammation in several neurodegenerative diseases. However, the mechanisms by which TLR4 mediates neurotoxic signals remain poorly understood. We investigated the role of TLR4 in in vitro and in vivo settings of motor neuron degeneration. Using primary cultures from mouse spinal cords, we characterized both the proinflammatory and neurotoxic effects of TLR4 activation with lipopolysaccharide (activation of microglial cells, release of proinflammatory cytokines and motor neuron death) and the protective effects of a cyanobacteria-derived TLR4 antagonist (VB3323). With the use of TLR4-deficient cells, a crit. role of the microglial component with functionally active TLR4 emerged in this setting. The in vivo expts. were carried out in a mouse model of spontaneous motor neuron degeneration, the wobbler mouse, where we preliminarily confirmed a protective effect of TLR4 antagonism. Compared with vehicle- and riluzole-treated mice, those chronically treated with VB3323 showed a decrease in microglial activation and morphol. alterations of spinal cord neurons and a better performance in the paw abnormality and grip-strength tests. Taken together, our data add new understanding of the role of TLR4 in mediating neurotoxicity in the spinal cord and suggest that TLR4 antagonists could be considered in future studies as candidate protective agents for motor neurons in degenerative diseases.
- 308Ikram, M.; Muhammad, T.; Rehman, S. U.; Khan, A.; Jo, M. G.; Ali, T.; Kim, M. O. Hesperetin Confers Neuroprotection by Regulating Nrf2/TLR4/NF-KB Signaling in an Aβ Mouse Model. Mol. Neurobiol. 2019, 56 (9), 6293– 6309, DOI: 10.1007/s12035-019-1512-7[Crossref], [PubMed], [CAS], Google Scholar308https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXmt1ymsb8%253D&md5=08541b9d7da0921a52aa08476fa6433bHesperetin Confers Neuroprotection by Regulating Nrf2/TLR4/NF-KB Signaling in an amyloid beta Mouse ModelIkram, Muhammad; Muhammad, Tahir; Rehman, Shafiq Ur; Khan, Amjad; Jo, Min Gi; Ali, Tahir; Kim, Myeong OkMolecular Neurobiology (2019), 56 (9), 6293-6309CODEN: MONBEW; ISSN:0893-7648. (Humana Press Inc.)Here, we hypothesized that hesperetin may protect the mice brain against Abeta-induced neurodegeneration. Our results indicated that hesperetin significantly attenuated oxidative stress, as assessed by the expression of Nrf2/HO-1 and LPO and ROS assays, in the hippocampus, cortex, and in vitro HT22 cells. Similarly, activated glial cells were regulated by hesperetin, as assessed by the expression of GFAP and Iba-1. Moreover, the expression of TLR4, p-NF-KB, and downstream targets was analyzed; the results showed that hesperetin reinstated the expression of these markers. The effects of hesperetin were further confirmed by using specific TLR4 and p-NF-kB inhibitors in BV-2 cells. Next, we evaluated Abeta pathol. in the cortex, hippocampus, and HT22 cells, showing that hesperetin significantly reduced the A beta pathol. Furthermore, the antiapoptotic effects of hesperetin were assessed, which showed strong antiapoptotic effects. Overall, the neuroprotective effect of hesperetin was found to be a multipotent effect, involving the inhibition of oxidative stress, neuroinflammation, apoptotic cell death, and cognitive consolidation. Given antioxidant, anti-inflammatory, and antiapoptotic potentials against A beta-induced neurodegeneration and memory impairment, hesperetin may be a promising therapeutic agent for Alzheimer's disease-like neurol. disorders.
- 309Jiwrajka, M.; Phillips, A.; Butler, M.; Rossi, M.; Pocock, J. M. The Plant-Derived Chalcone 2,2′,5′-Trihydroxychalcone Provides Neuroprotection against Toll-Like Receptor 4 Triggered Inflammation in Microglia. Oxid. Med. Cell. Longevity 2016, 2016, 6301712, DOI: 10.1155/2016/6301712[Crossref], [PubMed], [CAS], Google Scholar309https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC28njsFSgsw%253D%253D&md5=61c8f66a4406902c91ea4bf9148a1c1cThe Plant-Derived Chalcone 2,2',5'-Trihydroxychalcone Provides Neuroprotection against Toll-Like Receptor 4 Triggered Inflammation in MicrogliaJiwrajka Manasi; Phillips Alexandra; Butler Matt; Pocock Jennifer M; Rossi MiriamOxidative medicine and cellular longevity (2016), 2016 (), 6301712 ISSN:.Chalcones are plant metabolites with potential for therapeutic exploitation as antioxidant, anti-inflammatory, and antiproliferative agents. Here we explored the neuroprotective effects of 2,2',5'-trihydroxychalcone (225THC), a potent antioxidant with radical-scavenging properties. 225THC was found to be a potent inhibitor of apoptosis in stimulated primary rat neuronal cultures. This was likely mediated by an anti-inflammatory effect on microglial cells since 225THC inhibited LPS-stimulated TNF-α and IL-6 secretion from primary rat microglia and modulated the cytokine/chemokine profile of BV2 microglial cells. Additionally, 225THC inhibited LPS-evoked inducible nitric oxide synthase expression but did not influence endogenous superoxide generation. Microglial flow cytometric analyses indicated the 225THC treatment induced a shift from an M1-like phenotype to a more downregulated microglial profile. Taken together these data suggest that the chalcone 2,2',5'-trihydroxychalcone can modulate neuroinflammatory activation in brain-derived microglia and holds promise as a therapeutic in neuroinflammatory conditions.
- 310Zhu, X.; Liu, J.; Chen, O.; Xue, J.; Huang, S.; Zhu, W.; Wang, Y. Neuroprotective and Anti-Inflammatory Effects of Isoliquiritigenin in Kainic Acid-Induced Epileptic Rats via the TLR4/MYD88 Signaling Pathway. Inflammopharmacology 2019, 27 (6), 1143– 1153, DOI: 10.1007/s10787-019-00592-7[Crossref], [PubMed], [CAS], Google Scholar310https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhtFWmsbfM&md5=98a2b02d2eb34b12d5b06c70559e8bceNeuroprotective and anti-inflammatory effects of isoliquiritigenin in kainic acid-induced epileptic rats via the TLR4/MYD88 signaling pathwayZhu, Xiaobo; Liu, Jiankun; Chen, Ou; Xue, Jiang; Huang, Shanying; Zhu, Weiwei; Wang, YibiaoInflammopharmacology (2019), 27 (6), 1143-1153CODEN: IAOAES; ISSN:0925-4692. (Birkhaeuser Basel)Epileptogenesis is a complex pathol. process that occurs after an initial brain injury and involves a series of mol. events. Isoliquiritigenin (ISL), a flavonoid in licorice, is reported to have anti-inflammatory and antioxidant effects in various exptl. models, but its specific roles and mol. mechanisms in the epileptogenic process following kainic acid (KA) treatment remain unclear. The purpose of this study was to explore the effects of ISL pretreatment in KA-induced epileptic rats and the underlying mechanisms. Our findings show that ISL pretreatment significantly attenuated the KA-induced expression of ionized calcium-binding adapter mol. 1 (IBα1)-labeled microglia (F(3,20) = 97.29, p < 0.01, η p2 = 0.94) and glial fibrillary acidic protein (GFAP)-pos. astrocytes (F(3,20) = 72.48, p < 0.01, η p2 = 0.92), and the release of inflammatory mediators, such as TNF-α (F(3,20) = 133.14, p < 0.01, η p2 = 0.95), IL-1β, and C-C motif chemokine ligand 3 (CCL3). ISL pretreatment given before KA also significantly prevented apoptotic neuronal injury by upregulating the activities of superoxide dismutase and glutathione peroxidase. It also significantly suppressed the protein levels of Toll-like receptor 4 (TLR4) (F(3,20) = 63.23, p <0.01, η p2 = 0.91) and its downstream mols., myeloid differentiation primary response 88 (MYD88), phosphorylated (p-)IκBα, and p-NF-κB. Blocking TLR4/MYD88 signaling also attenuated KA-induced neuroinflammation and neuronal damage in the hippocampus. Overall, our study demonstrates that ISL pretreatment plays neuroprotective and anti-inflammatory roles in KA-induced epileptogenesis, which may be mediated by the TLR4/MYD88 signaling pathway.
- 311Maatouk, L.; Compagnion, A. C.; Sauvage, M. A. C. De; Bemelmans, A. P.; Leclere-Turbant, S.; Cirotteau, V.; Tohme, M.; Beke, A.; Trichet, M.; Bazin, V.; Trawick, B. N.; Ransohoff, R. M.; Tronche, F.; Manoury, B.; Vyas, S. TLR9 Activation via Microglial Glucocorticoid Receptors Contributes to Degeneration of Midbrain Dopamine Neurons. Nat. Commun. 2018, 9, 2450, DOI: 10.1038/s41467-018-04569-y[Crossref], [PubMed], [CAS], Google Scholar311https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB3c%252FhtVWrsg%253D%253D&md5=09ca9463cacd458309b641e23902c29aTLR9 activation via microglial glucocorticoid receptors contributes to degeneration of midbrain dopamine neuronsMaatouk Layal; Compagnion Anne-Claire; Cirotteau Vincent; Beke Allen; Tronche Francois; Vyas Sheela; Sauvage Maria-Angeles Carrillo-de; Bemelmans Alexis-Pierre; Leclere-Turbant Sabrina; Tohme Mira; Manoury Benedicte; Trichet Michael; Bazin Virginie; Trawick Bobby N; Ransohoff Richard MNature communications (2018), 9 (1), 2450 ISSN:.Inflammation is a characteristic feature of Parkinson's disease (PD). We examined the role of TLR9 and its regulation by glucocorticoid receptors (GRs) in degeneration of substantia nigra dopamine neurons (DNs). TLR9 agonist, CpG-ODN, induced DN degeneration in mice lacking GR in microglia but not in controls. TLR9 deletion reduced DN loss in neurotoxin, 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) mouse model of PD. GR regulates TLR9 activation during MPTP neurotoxicity as TLR9 antagonist suppressed increased DN loss in microglia/macrophage GR mutant mice. GR absence in microglia enhanced TLR9 translocation to endolysosomes and facilitated its cleavage leading to pro-inflammatory gene expression. GR-dependent TLR9 activation also triggered DN loss following intranigral injection of mitochondrial DNA. Finally, microglial GR sensitivity to A53T-alpha-synuclein induced DN degeneration as well as decreased microglial GR expression observed in SN of PD brain samples, all suggest that reduced microglial GR activity in SN can stimulate TLR9 activation and DN loss in PD pathology.
- 312Portou, M. J.; Baker, D.; Abraham, D.; Tsui, J. The Innate Immune System, Toll-like Receptors and Dermal Wound Healing: A Review. Vasc. Pharmacol. 2015, 71, 31– 36, DOI: 10.1016/j.vph.2015.02.007[Crossref], [PubMed], [CAS], Google Scholar312https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXmslCqurk%253D&md5=d65a3eca98e907f777a7fe4498a05872The innate immune system, toll-like receptors and dermal wound healing: A reviewPortou, M. J.; Baker, D.; Abraham, D.; Tsui, J.Vascular Pharmacology (2015), 71 (), 31-36CODEN: VPAHAJ; ISSN:1537-1891. (Elsevier B.V.)Wound healing is a complex physiol. process comprised of discrete but inter-related and overlapping stages, requiring exact timing and regulation to successfully progress, yet occurs spontaneously in response to injury. It is characterised by four phases, coagulation, inflammation, proliferation and remodelling. Each phase is predominated by particular cell types, cytokines and chemokines. The innate immune system represents the first line of defense against invading microorganisms. It is entirely encoded with the genome, and comprised of a cellular response with specificity provided by pattern recognition receptors (PRRs) such as toll-like receptors (TLRs). TLRs are activated by exogenous microbial pathogen assocd. mol. patterns (PAMPs), initiating an immune response through the prodn. of pro-inflammatory cytokines and further specialist immune cell recruitment. TLRs are also activated by endogenous mol. patterns termed damage assocd. mol. patterns (DAMPs). These ligands, usually shielded from the immune system, act as alarm signals alerting the immune system to damage and facilitate the normal wound healing process. TLRs are expressed by cells essential to wound healing such as keratinocytes and fibroblasts, however the specific role of TLRs in this process remains controversial. This article reviews the current knowledge on the potential role of TLRs in dermal wound healing where inflammation arising from pathogenic activation of these receptors appears to play a role in chronic ulceration assocd. with diabetes, scar hypertrophy and skin fibrosis.
- 313Yang, H.; Brackett, C. M.; Morales-Tirado, V. M.; Li, Z.; Zhang, Q.; Wilson, M. W.; Benjamin, C.; Harris, W.; Waller, E. K.; Gudkov, A. V.; Burdelya, L. G.; Grossniklaus, H. E. The Toll-like Receptor 5 Agonist Entolimod Suppresses Hepatic Metastases in a Murine Model of Ocular Melanoma via an NK Cell-Dependent Mechanism. Oncotarget 2016, 7 (3), 2936– 2950, DOI: 10.18632/oncotarget.6500[Crossref], [PubMed], [CAS], Google Scholar313https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC28vpt1Ggsg%253D%253D&md5=be07d6f6757c4ab6d91af04b9b731aefThe Toll-like receptor 5 agonist entolimod suppresses hepatic metastases in a murine model of ocular melanoma via an NK cell-dependent mechanismYang Hua; Li Zezhong; Zhang Qing; Grossniklaus Hans E; Brackett Craig M; Benjamin Camille; Gudkov Andrei V; Burdelya Lyudmila G; Morales-Tirado Vanessa Marie; Wilson Matthew W; Harris Wayne; Waller Edmund K; Gudkov Andrei VOncotarget (2016), 7 (3), 2936-50 ISSN:.Uveal melanoma (UM) is the most common primary cancer of the eye in adults and progresses to metastatic disease predominantly of the liver in ~50% of patients. In these cases, life expectancy averages just 9 months due to the lack of effective treatment options. The Toll-like receptor 5 (TLR5) agonist entolimod (former name CBLB502) rapidly activates TLR5-NF-κB signaling in hepatocytes and suppresses growth of both TLR5-expressing and non-expressing tumors in the liver through mobilization and activation of innate and adaptive immune mechanisms. The goal of this study was to explore the potential of entolimod as an immunotherapeutic agent against hepatic metastasis of UM using the TLR5-positive B16LS9 mouse model of ocular melanoma. Mice were given seven subcutaneous injections of vehicle or entolimod given 72 h apart started one day before, on the same day or three days after intraocular injection of B16LS9 cells. All tested regimens of entolimod treatment resulted in significantly reduced B16LS9 metastasis to the liver. Entolimod induced mobilization of natural killer (NK) cells to the liver and stimulated their maturation, differentiation and activation. Antibody-mediated depletion of NK cells from mice abrogated entolimod's antimetastatic activity in the liver and eliminated the entolimod-elicited in vitro cytotoxic activity of hepatic lymphocytes against B16LS9 cells. These results provide pre-clinical evidence of entolimod's efficacy against hepatometastasis of UM and support its further development as an anticancer immunotherapeutic drug.
- 314Bi, J.; Wang, W.; Du, J.; Chen, K.; Cheng, K. Structure-Activity Relationship Study and Biological Evaluation of SAC-Garlic Acid Conjugates as Novel Anti-Inflammatory Agents. Eur. J. Med. Chem. 2019, 179, 233– 245, DOI: 10.1016/j.ejmech.2019.06.059[Crossref], [PubMed], [CAS], Google Scholar314https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhtlaqsL3P&md5=569c3b7fae86c93d9606be9f628fd8f1Structure-activity relationship study and biological evaluation of SAC-Garlic acid conjugates as novel anti-inflammatory agentsBi, Jingjie; Wang, Wenqing; Du, Junxi; Chen, Kun; Cheng, KuiEuropean Journal of Medicinal Chemistry (2019), 179 (), 233-245CODEN: EJMCA5; ISSN:0223-5234. (Elsevier Masson SAS)A series of S-allyl-L-cysteine (SAC) with garlic acid conjugates as anti-inflammatory agents were designed and synthesized. Among the 40 tested compds., SMU-8c exhibited the most potent inhibitory activity to Pam3CSK4-induced nitric oxide (NO) in RAW264.7 macrophages with IC50 of 22.54 ± 2.60 μM. The structure-activity relationship (SAR) study suggested that the esterified carboxyl group, carbon chain extension and methoxylation phenol hydroxy could improve the anti-inflammatory efficacy. Preliminary anti-inflammatory mechanism studies showed that SMU-8c significantly down-regulated the levels of Pam3CSK4 triggered TNF-α cytokine in human THP-1 cells, mouse RAW 264.7 macrophages, as well as in ex-vivo human peripheral blood mononuclear cells (PBMC) with no influence on cell viability. SMU-8c specifically blocked the Pam3CSK4 ignited secreted embryonic alk. phosphatase (SEAP) signaling with no influence to Poly I:C or LPS triggered TLR3 or TLR4 signaling. Moreover, SMU-8c suppressed TLR2 in HEK-Blue hTLR2 cells and inhibited the formation of TLR1-TLR2, and TLR2-TLR6 complex in human PBMC. In summary, SMU-8c inhibited the TLR2 signaling pathway to down-regulate the inflammation cytokines, such as NO, SEAP and TNF-α, to realize its anti-inflammatory activity.
- 315Zhang, Y.; Zhang, Y. Pterostilbene, a Novel Natural Plant Conduct, Inhibits High Fat-Induced Atherosclerosis Inflammation via NF-KB Signaling Pathway in Toll-like Receptor 5 (TLR5) Deficient Mice. Biomed. Pharmacother. 2016, 81, 345– 355, DOI: 10.1016/j.biopha.2016.04.031[Crossref], [PubMed], [CAS], Google Scholar315https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XmslOit7o%253D&md5=ae504a87b52b5531d79a83071bf3bfc8Pterostilbene, a novel natural plant conduct, inhibits high fat-induced atherosclerosis inflammation via NF-κB signaling pathway in Toll-like receptor 5 (TLR5) deficient miceZhang, Yuan; Zhang, YiBiomedicine & Pharmacotherapy (2016), 81 (), 345-355CODEN: BIPHEX; ISSN:0753-3322. (Elsevier Masson SAS)Atherosclerosis is a specific form of an artery wall thickens, a syndrome affecting arterial blood vessels due to a chronic inflammatory response in the walls of arteries, which is promoted by fat accumulation. Toll-like receptors (TLRs) play prominent roles in inflammatory responses. And TLR5 is overexpressed in several diseases. Here in our study, we investigated the effect of TLR5 in high fat-induced atherosclerosis via NF-κB signaling pathway modulating pro-inflammatory cytokines releasing. Our results found that high fat induced atherosclerosis in wild type mice with fat accumulation and inflammatory response through NF-κB activation. Contrastly, TLR5 knockout mice displayed lower fat accumulation and ameliorated inflammation after high fat feeding with NF-κB inactivation. In addn., pterostilbene, as a natural di-Me ether deriv. of resveratrol mainly from blueberries, has diverse pharmacol. activities, esp. anti-inflammation. Our study also found that pterostilbene displayed inhibited role in suppressing inflammatory response through inactivating NF-κB signaling pathway regulated by TLR5 down-regulation in high fat-induced mice. Moreover, in vitro expts. of vascular smooth muscle cells (VSMCs) challenged with LPS or TNF-α, further indicated that NF-κB was involved in atherosclerosis progression, leading to high secretion of pro-inflammatory cytokines. However, VSMCs from TLR5 deficient mice inhibited phosphorylated levels of NF-κB signaling pathway, finally resulting in down-regulation of inflammatory cytokines. Notably, pterostilbene also displayed suppressed role in inflammatory response via NF-κB inactivity in LPS or TNF-α-induced VSMCs by decreasing TLR5 expression. The results above indicated a novel therapeutic strategy of pterostilbene to protect against atherosclerosis via TLR5 regulation for clinic treatment in the future.
- 316Anwar, M. A.; Shah, M.; Kim, J.; Choi, S. Recent Clinical Trends in Toll-like Receptor Targeting Therapeutics. Med. Res. Rev. 2019, 39 (3), 1053– 1090, DOI: 10.1002/med.21553[Crossref], [PubMed], [CAS], Google Scholar316https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXntlGksbs%253D&md5=525a0020ddcf3bfd585e51a4f93e0265Recent clinical trends in Toll-like receptor targeting therapeuticsAnwar, Muhammad Ayaz; Shah, Masaud; Kim, Jason; Choi, SangdunMedicinal Research Reviews (2019), 39 (3), 1053-1090CODEN: MRREDD; ISSN:0198-6325. (John Wiley & Sons, Inc.)A review. Toll-like receptors (TLRs) are germline-encoded receptors that are central to innate and adaptive immune responses. Owing to their vital role in inflammation, TLRs are rational targets in clinics; thus, many ligands and biologics have been reported to overcome the progression of various inflammatory and malignant conditions and support the immune system. For each TLR, at least one, and often many, drug formulations are being evaluated. Ligands reported as stand-alone drugs may also be reported based on their use in combinatorial therapeutics as adjuvants. Despite their profound efficacy in TLR-modulation in preclin. studies, multiple drugs have been terminated at different stages of clin. trials. Here, TLR modulating drugs that have been evaluated in clin. trials are discussed, along with their mode of action, suggestive failure reasons, and ways to improve the clin. outcomes. This review presents recent advances in TLR-targeting drugs and provides directions for more successful immune system manipulation.
- 317Lima, C. X.; Souza, D. G.; Amaral, F. A.; Fagundes, C. T.; Rodrigues, I. P. S.; Alves-Filho, J. C.; Kosco-Vilbois, M.; Ferlin, W.; Shang, L.; Elson, G.; Teixeira, M. M. Therapeutic Effects of Treatment with Anti-TLR2 and Anti-TLR4Monoclonal Antibodies in Polymicrobial Sepsis. PLoS One 2015, 10 (7), e0132336, DOI: 10.1371/journal.pone.0132336[Crossref], [PubMed], [CAS], Google Scholar317https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXhtlGqtrfE&md5=0ea0c48e2df8fa2bd2061e0b908b0f01Therapeutic effects of treatment with anti- TLR2 and anti-TLR4 monoclonal antibodies in polymicrobial sepsisLima, Cristiano Xavier; Souza, Danielle Gloria; Amaral, Flavio Almeida; Fagundes, CaioTavares; Rodrigues, Irla Paula Stopa; Alves-Filho, Jose Carlos; Kosco-Vilbois, Marie; Ferlin, Walter; Shang, Limin; Elson, Greg; Teixeira, Mauro MartinsPLoS One (2015), 10 (7), e0132336/1-e0132336/14CODEN: POLNCL; ISSN:1932-6203. (Public Library of Science)Introduction Toll-like receptors (TLRs) play an important role in the recognition of microbial products and in host defense against infection. However, the massive release of inflammatory mediators into the bloodstream following TLR activation following sepsis is thought to contribute to disease pathogenesis. Methods Here, we evaluated the effects of preventive or therapeutic administration of monoclonal antibodies (mAbs) targeting either TLR2 or TLR4 in a model of severe polymicrobial sepsis induced by cecal ligation and puncture in mice. Results Pre-treatment with anti-TLR2 or anti-TLR4 mAb alone showed significant protection from sepsis-assocd. death. Protective effects were obsd. even when the administration of either anti-TLR2 or anti-TLR4 alone was delayed (i.e., 3 h after sepsis induction). Delayed administration of either mAb in combination with antibiotics resulted in additive protection. Conclusion Although attempts to translate preclin. findings to clin. sepsis have failed so far, our preclin. expts. strongly suggest that there is a sufficient therapeutic window within which patients with ongoing sepsis could benefit from combined antibiotic plus anti-TLR2 or anti-TLR4 mAb treatment.
- 318Toshchakov, V. Y.; Szmacinski, H.; Couture, L. A.; Lakowicz, J. R.; Vogel, S. N. Targeting TLR4 Signaling by TLR4 Toll/IL-1 Receptor Domain-Derived Decoy Peptides: Identification of the TLR4 Toll/IL-1 Receptor Domain Dimerization Interface. J. Immunol. 2011, 186 (8), 4819– 4827, DOI: 10.4049/jimmunol.1002424[Crossref], [PubMed], [CAS], Google Scholar318https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3MXkt1Gqtrs%253D&md5=cc42419d0d055310309a1899c1a5bccfTargeting TLR4 Signaling by TLR4 Toll/IL-1 Receptor Domain-Derived Decoy Peptides: Identification of the TLR4 Toll/IL-1 Receptor Domain Dimerization InterfaceToshchakov, Vladimir Y.; Szmacinski, Henryk; Couture, Leah A.; Lakowicz, Joseph R.; Vogel, Stefanie N.Journal of Immunology (2011), 186 (8), 4819-4827CODEN: JOIMA3; ISSN:0022-1767. (American Association of Immunologists)Agonist-induced dimerization of TLR4 Toll/IL-1R (TIR) domains initiates intracellular signaling. Therefore, identification of the TLR4-TIR dimerization interface is one key to the rational design of therapeutics that block TLR4 signaling. A library of cell-permeating decoy peptides, each of which represents a nonfragmented patch of the TLR4 TIR surface, was designed such that the peptides entirely encompass the TLR4 TIR surface. Each peptide was synthesized in tandem with a cell-permeating Antennapedia homeodomain sequence and tested for the ability to inhibit early cytokine mRNA expression and MAPK activation in LPS-stimulated primary murine macrophages. Five peptides-4R1, 4R3, 4BB, 4R9, and 4αE-potently inhibited all manifestations of TLR4, but not TLR2 signaling. When tested for their ability to bind directly to TLR4 TIR by Foerster resonance energy transfer using time-resolved fluorescence spectroscopy, Bodipy-TMR-X-labeled 4R1, 4BB, and 4αE quenched fluorescence of TLR4-Cerulean expressed in HeLa or HEK293T cells, whereas 4R3 was partially active, and 4R9 was least active. These findings suggest that the area between the BB loop of TLR4 and its fifth helical region mediates TLR4 TIR dimerization. Moreover, the authors' data provide direct evidence for the utility of the decoy peptide approach, in which peptides representing various surface-exposed segments of a protein are initially probed for the ability to inhibit protein function, and then their specific targets are identified by Foerster resonance energy transfer to define recognition sites in signaling proteins that may be targeted therapeutically to disrupt functional transient protein interactions.
- 319Sallenave, J.-M.; Guillot, L. Innate Immune Signaling and Proteolytic Pathways in the Resolution or Exacerbation of SARS-CoV-2 in Covid-19: Key Therapeutic Targets?. Front. Immunol. 2020, 11, 1229, DOI: 10.3389/fimmu.2020.01229[Crossref], [PubMed], [CAS], Google Scholar319https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXitVWnsL7L&md5=27d8bca7aa6d569c2e42f79d9af2124aInnate immune signaling and proteolytic pathways in the resolution or exacerbation of SARS-CoV-2 in Covid-19: key therapeutic targets?Sallenave, Jean-Michel; Guillot, LoicFrontiers in Immunology (2020), 11 (), 1229CODEN: FIRMCW; ISSN:1664-3224. (Frontiers Media S.A.)A review. COVID-19 is caused by the Severe Acute Respiratory Syndrome (SARS) coronavirus (Cov)-2, an enveloped virus with a pos.-polarity, single-stranded RNA genome. The initial outbreak of the pandemic began in Dec. 2019, and it is affecting the human health of the global community. In common with previous pandemics (Influenza H1N1 and SARS-CoV) and the epidemics of Middle east respiratory syndrome (MERS)-CoV, CoVs target bronchial and alveolar epithelial cells. Virus protein ligands (e.g., haemagglutinin or trimeric spike glycoprotein for Influenza and CoV, resp.) interact with cellular receptors, such as (depending on the virus) either sialic acids, Dipeptidyl peptidase 4 (DPP4), or angiotensin-converting enzyme 2 (ACE2). Host proteases, e.g., cathepsins, furin, or members of the type II transmembrane serine proteases (TTSP) family, such as Transmembrane protease serine 2 (TMPRSS2), are involved in virus entry by proteolytically activating virus ligands. Also involved are Toll Like Receptor (TLR) family members, which upregulate anti-viral and pro-inflammatory mediators [interleukin (IL)-6 and IL-8 and type I and type III Interferons among others], through the activation of Nuclear Factor (NF)-kB. When these events (virus cellular entry and innate immune responses) are uncontrolled, a deleterious systemic response is sometimes encountered in infected patients, leading to the well-described "cytokine storm" and an ensuing multiple organ failure promoted by a downregulation of dendritic cell, macrophage, and T-cell function. We aim to describe how the lung and systemic host innate immune responses affect survival either pos., through downregulating initial viral load, or neg., by triggering uncontrolled inflammation. An emphasis will be put on host cellular signaling pathways and proteases involved with a view on tackling these therapeutically.
- 320Chakraborty, C.; Sharma, A. R.; Bhattacharya, M.; Sharma, G.; Lee, S.-S.; Agoramoorthy, G. Consider TLR5 for New Therapeutic Development against COVID-19. J. Med. Virol. 2020, DOI: 10.1002/jmv.25997
- 321Wali, S.; Flores, J. R.; Jaramillo, A. M.; Goldblatt, D. L.; Pantaleón García, J.; Tuvim, M. J.; Dickey, B. F.; Evans, S. E. Immune Modulation to Improve Survival of Respiratory Virus Infections in Mice. bioRxiv 2020, DOI: 10.1101/2020.04.16.045054 .
- 322Conti, P.; Ronconi, G.; Caraffa, A.; Gallenga, C.; Ross, R.; Frydas, I.; Kritas, S. Induction of Pro-Inflammatory Cytokines (IL-1 and IL-6) and Lung Inflammation by Coronavirus-19 (COVI-19 or SARS-CoV-2): Anti-Inflammatory Strategies. J. Biol. Regul. Homeost. Agents 2020, 34 (2), 11– 15, DOI: 10.23812/conti-e
Cited By
This article is cited by 18 publications.
- Biswajit Kundu, Deblina Raychaudhuri, Ayan Mukherjee, Bishnu Prasad Sinha, Dipika Sarkar, Purbita Bandopadhyay, Sourav Pal, Nirmal Das, Debdeep Dey, Kantubhukta Ramarao, Kasireddy Nagireddy, Dipyaman Ganguly, Arindam Talukdar. Systematic Optimization of Potent and Orally Bioavailable Purine Scaffold as a Dual Inhibitor of Toll-Like Receptors 7 and 9. Journal of Medicinal Chemistry 2021, 64
(13)
, 9279-9301. https://doi.org/10.1021/acs.jmedchem.1c00532
- Arindam Talukdar, Dipyaman Ganguly, Swarnali Roy, Nirmal Das, Dipika Sarkar. Structural Evolution and Translational Potential for Agonists and Antagonists of Endosomal Toll-like Receptors. Journal of Medicinal Chemistry 2021, 64
(12)
, 8010-8041. https://doi.org/10.1021/acs.jmedchem.1c00300
- Arshpreet Kaur, Deepender Kaushik, Sakshi Piplani, Surinder K. Mehta, Nikolai Petrovsky, Deepak B. Salunke. TLR2 Agonistic Small Molecules: Detailed Structure–Activity Relationship, Applications, and Future Prospects. Journal of Medicinal Chemistry 2021, 64
(1)
, 233-278. https://doi.org/10.1021/acs.jmedchem.0c01627
- Junjie Yang, Fanjie Hu, Chengjun Guo, Yuqing Liang, Haiying Song, Kui Cheng. Discovery of isoliquiritigenin analogues that reverse acute hepatitis by inhibiting macrophage polarization. Bioorganic Chemistry 2021, 114 , 105043. https://doi.org/10.1016/j.bioorg.2021.105043
- Deepender Kaushik, Arshpreet Kaur, Nikolai Petrovsky, Deepak B. Salunke. Structural evolution of toll-like receptor 7/8 agonists from imidazoquinolines to imidazoles. RSC Medicinal Chemistry 2021, 12
(7)
, 1065-1120. https://doi.org/10.1039/D1MD00031D
- Anindya Sarkar, Anushka C. Galasiti Kankanamalage, Qian Zhang, Heng Cheng, Prasanna Sivaprakasam, Joseph Naglich, Chunshan Xie, Sanjeev Gangwar, Dale L. Boger. Synthesis, structure-activity relationship studies and evaluation of a TLR 3/8/9 agonist and its analogues. Medicinal Chemistry Research 2021, 30
(7)
, 1377-1385. https://doi.org/10.1007/s00044-021-02736-3
- Xiaoqing Wang, Yafei Liu, Xingchun Han, Ge Zou, Wei Zhu, Hong Shen, Haixia Liu. Small molecule approaches to treat autoimmune and inflammatory diseases (Part II): Nucleic acid sensing antagonists and inhibitors. Bioorganic & Medicinal Chemistry Letters 2021, 44 , 128101. https://doi.org/10.1016/j.bmcl.2021.128101
- Asmita Banstola, Kishwor Poudel, Jong Oh. Kim, Jee-Heon Jeong, Simmyung Yook. Recent progress in stimuli-responsive nanosystems for inducing immunogenic cell death. Journal of Controlled Release 2021, 19 https://doi.org/10.1016/j.jconrel.2021.07.038
- Silke Miller, Maria-Jesus Blanco. Small molecule therapeutics for neuroinflammation-mediated neurodegenerative disorders. RSC Medicinal Chemistry 2021, 12
(6)
, 871-886. https://doi.org/10.1039/D1MD00036E
- Ali Namvar, Azam Bolhassani, Gholamreza Javadi, Zahra Noormohammadi. Combination of human papillomaviruses L1 and L2 multiepitope constructs protects mice against tumor cells. Fundamental & Clinical Pharmacology 2021, 8 https://doi.org/10.1111/fcp.12690
- Bahareh Kashani, Zahra Zandi, Atieh Pourbagheri‐Sigaroodi, Davood Bashash, Seyed H. Ghaffari. The role of toll‐like receptor 4 (TLR4) in cancer progression: A possible therapeutic target?. Journal of Cellular Physiology 2021, 236
(6)
, 4121-4137. https://doi.org/10.1002/jcp.30166
- Huili Lyu, Cody M. Elkins, Jessica L. Pierce, C. Henrique Serezani, Daniel S. Perrien. MyD88 Is Not Required for Muscle Injury-Induced Endochondral Heterotopic Ossification in a Mouse Model of Fibrodysplasia Ossificans Progressiva. Biomedicines 2021, 9
(6)
, 630. https://doi.org/10.3390/biomedicines9060630
- Taiki Mori, Hideo Kataoka, Takeshi Into. Effect of Myd88 deficiency on gene expression profiling in salivary glands of female non-obese diabetic (NOD) mice. Journal of Oral Biosciences 2021, 63
(2)
, 192-198. https://doi.org/10.1016/j.job.2021.04.003
- Saghar Pahlavanneshan, Ali Sayadmanesh, Hamidreza Ebrahimiyan, Mohsen Basiri, . Toll-Like Receptor-Based Strategies for Cancer Immunotherapy. Journal of Immunology Research 2021, 2021 , 1-14. https://doi.org/10.1155/2021/9912188
- Hassan A. Alhazmi, Asim Najmi, Sadique A. Javed, Shahnaz Sultana, Mohammed Al Bratty, Hafiz A. Makeen, Abdulkarim M. Meraya, Waquar Ahsan, Syam Mohan, Manal M. E. Taha, Asaad Khalid. Medicinal Plants and Isolated Molecules Demonstrating Immunomodulation Activity as Potential Alternative Therapies for Viral Diseases Including COVID-19. Frontiers in Immunology 2021, 12 https://doi.org/10.3389/fimmu.2021.637553
- Deepender Kaushik, Juliana T Granato, Gilson C Macedo, Paula R B Dib, Sakshi Piplani, Johnson Fung, Adilson D da Silva, Elaine S Coimbra, Nikolai Petrovsky, Deepak B Salunke. Toll-like receptor-7/8 agonist kill
Leishmania amazonensis
by acting as pro-oxidant and pro-inflammatory agent. Journal of Pharmacy and Pharmacology 2021, 11 https://doi.org/10.1093/jpp/rgab063
- Muhammad Waqqas Hasan, Muhammad Haseeb, Muhammad Ehsan, Javaid Ali Gadahi, Qiangqiang Wang, Muhammad Ali Memon, Muhammad Tahir Aleem, Shakeel Ahmed Lakho, Ruo Feng Yan, Li Xin Xu, Xiao Kai Song, Xiangrui Li. The immunogenic maturation of goat monocyte-derived dendritic cells and upregulation of toll-like receptors by five antigens of Haemonchus contortus in-vitro. Research in Veterinary Science 2021, 136 , 247-258. https://doi.org/10.1016/j.rvsc.2021.03.007
- Hongyan Sui, Qian Chen, Tomozumi Imamichi. Cytoplasmic‐translocated Ku70 senses intracellular DNA and mediates interferon‐lambda1 induction. Immunology 2021, 27 https://doi.org/10.1111/imm.13318
Abstract
Figure 1
Figure 1. General structure of a dimeric toll-like receptor (TLR).
Figure 2
Figure 2. Schematic representation of TLR signaling pathways.
Figure 3
Figure 3. Multiple members of TLR family are responsible for micro-organism and viral PAMPs recognition.
Figure 4
Figure 4. Chemical structures of the TLR2/1 and 2/6 modulators 1–6 for the treatment of viral infection.
Figure 5
Figure 5. Chemical structures of TLR3 and 4 modulators 7–14 for the treatment of viral infection.
Figure 6
Figure 6. Chemical structures of the TLR7, TLR8, and TLR9 modulators 15–27 endowed with an antiviral activity.
Figure 7
Figure 7. Chemical structures of TLR2, TLR4, and TLR5 modulators 28–33 discovered for the treatment of bacterial infections.
Figure 8
Figure 8. Chemical structures of the TLR modulators 34–41 involved in sepsis and parasitic diseases.
Figure 9
Figure 9. Chemical structures of TLR2/1, TLR2/6 and TLR3 modulators 42–46 involved in inflammatory diseases.
Figure 10
Figure 10. Chemical structures of TLR4 modulators 47–59 studied against inflammation.
Figure 11
Figure 11. Chemical structures of TLR7 and TLR8 modulators 60–64 studied against inflammation.
Figure 12
Figure 12. Chemical structures of some of the most-relevant TLR modulators 65–68 investigated in clinical trials against cancer.
Figure 13
Figure 13. Chemical structures of Pam3CysSK4-MUC-1 conjugated 69–71 and UPam derivatives 72a–72e.
Figure 14
Figure 14. Chemical structures of the homologated Pam2CysSK4–NY-ESO-1 73a–73d and of the Pam2Cys derivative 74a and 74b.
Figure 15
Figure 15. Chemical structures of TLR1/2 modulators 75–79 as anticancer agents.
Figure 16
Figure 16. Chemical structures of TLR4 modulators 80–85 investigated as anticancer agents.
Figure 17
Figure 17. Chemical structures of TLR modulators 86–88b endowed with anticancer activity.
Figure 18
Figure 18. Chemical structures of TLR modulators 89–93 investigated against MS.
Figure 19
Figure 19. Chemical structures of TLR modulators 94–98 investigated against RA and SLE treatment.
Figure 20
Figure 20. Chemical structures of TLR modulators 99–103 investigated against CVDs.
Figure 21
Figure 21. Chemical structures of TLR modulators 104–110 investigated against diabetes.
Figure 22
Figure 22. Chemical structures of TLR modulators 111–117 useful in neurodegenerative diseases.
References
ARTICLE SECTIONSThis article references 322 other publications.
- 1Khajeh Alizadeh Attar, M.; Anwar, M. A.; Eskian, M.; Keshavarz-Fathi, M.; Choi, S.; Rezaei, N. Basic Understanding and Therapeutic Approaches to Target Toll-like Receptors in Cancerous Microenvironment and Metastasis. Med. Res. Rev. 2018, 38 (5), 1469– 1484, DOI: 10.1002/med.21480[Crossref], [PubMed], [CAS], Google Scholar1https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC1Mzls1yhtg%253D%253D&md5=259501dd81d0c7f758c94da001bacda7Basic understanding and therapeutic approaches to target toll-like receptors in cancerous microenvironment and metastasisKhajeh Alizadeh Attar Mojtaba; Eskian Mahsa; Keshavarz-Fathi Mahsa; Khajeh Alizadeh Attar Mojtaba; Keshavarz-Fathi Mahsa; Anwar Muhammad Ayaz; Choi Sangdun; Eskian Mahsa; Keshavarz-Fathi Mahsa; Rezaei Nima; Eskian Mahsa; Rezaei Nima; Rezaei Nima; Rezaei NimaMedicinal research reviews (2018), 38 (5), 1469-1484 ISSN:.Toll-like receptors (TLRs) are transmembrane components that sense danger signals, like damage- and pathogen-associated molecular pattern molecules, as receptors, and maintain homeostasis in tissues. They are mainly involved in immune system activation through a variety of mediators, which either carry out (1) elimination of pathogenic threats and redressing homeostatic imbalances or (2) contribution to the initiation and worsening of pathological conditions, including cancers. Under physiological conditions, TLRs coordinate the innate and adaptive immunity, and inhibit autoimmune disorders. In pathological conditions, such as cancer, they can present both tumor and receptor-specific roles. Although the roles of individual TLRs in various cancers have been described, the effects of targeting TLRs to treat cancer and prevent metastasis are still controversial. A growing body of literature has suggested contribution of both activators and inhibitors of TLR signaling pathway for cancer treatment, dependent on several context-specific factors. In short, TLRs can play dual roles with contradictory outcomes in neoplastic conditions. This hampers the development of TLR-based therapeutic interventions. A better understanding of the interwoven TLR pathways in cancerous microenvironment is necessary to design TLR-based therapies. In this review, we consider the molecular mechanisms of TLRs signaling and their involvement in tumor progression. Therapeutic modalities targeting TLRs for cancer treatment are discussed as well.
- 2Patinote, C.; Karroum, N. B.; Moarbess, G.; Cirnat, N.; Kassab, I.; Bonnet, P. A.; Deleuze-Masquéfa, C. Agonist and Antagonist Ligands of Toll-like Receptors 7 and 8: Ingenious Tools for Therapeutic Purposes. Eur. J. Med. Chem. 2020, 193, 112238, DOI: 10.1016/j.ejmech.2020.112238[Crossref], [PubMed], [CAS], Google Scholar2https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXlsVWjt74%253D&md5=d11400c9ed60056bd0d33861aaeb5dbaAgonist and antagonist ligands of toll-like receptors 7 and 8: Ingenious tools for therapeutic purposesPatinote, Cindy; Karroum, Nour Bou; Moarbess, Georges; Cirnat, Natalina; Kassab, Issam; Bonnet, Pierre-Antoine; Deleuze-Masquefa, CarineEuropean Journal of Medicinal Chemistry (2020), 193 (), 112238CODEN: EJMCA5; ISSN:0223-5234. (Elsevier Masson SAS)A review. The discovery of the TLRs family and more precisely its functions opened a variety of gates to modulate immunol. host responses. TLRs 7/8 are located in the endosomal compartment and activate a specific signaling pathway in a MyD88-dependant manner. According to their involvement into various autoimmune, inflammatory and malignant diseases, researchers have designed diverse TLRs 7/8 ligands able to boost or block the inherent signal transduction. These modulators are often small synthetic compds. and most act as agonists and to a much lesser extent as antagonists. Some of them have reached preclin. and clin. trials, and only one has been approved by the FDA and EMA, imiquimod. The key to the success of these modulators probably lies in their combination with other therapies as recently demonstrated. We gather in this review more than 360 scientific publications, reviews and patents, relating the extensive work carried out by researchers on the design of TLRs 7/8 modulators, which are classified firstly by their biol. activities (agonist or antagonist) and then by their chem. structures, which total syntheses are not discussed here. This review also reports about 90 clin. cases, thereby showing the biol. interest of these modulators in multiple pathologies.
- 3Anwar, M. A.; Shah, M.; Kim, J.; Choi, S. Recent Clinical Trends in Toll-like Receptor Targeting Therapeutics. Med. Res. Rev. 2019, 39 (3), 1053– 1090, DOI: 10.1002/med.21553[Crossref], [PubMed], [CAS], Google Scholar3https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXntlGksbs%253D&md5=525a0020ddcf3bfd585e51a4f93e0265Recent clinical trends in Toll-like receptor targeting therapeuticsAnwar, Muhammad Ayaz; Shah, Masaud; Kim, Jason; Choi, SangdunMedicinal Research Reviews (2019), 39 (3), 1053-1090CODEN: MRREDD; ISSN:0198-6325. (John Wiley & Sons, Inc.)A review. Toll-like receptors (TLRs) are germline-encoded receptors that are central to innate and adaptive immune responses. Owing to their vital role in inflammation, TLRs are rational targets in clinics; thus, many ligands and biologics have been reported to overcome the progression of various inflammatory and malignant conditions and support the immune system. For each TLR, at least one, and often many, drug formulations are being evaluated. Ligands reported as stand-alone drugs may also be reported based on their use in combinatorial therapeutics as adjuvants. Despite their profound efficacy in TLR-modulation in preclin. studies, multiple drugs have been terminated at different stages of clin. trials. Here, TLR modulating drugs that have been evaluated in clin. trials are discussed, along with their mode of action, suggestive failure reasons, and ways to improve the clin. outcomes. This review presents recent advances in TLR-targeting drugs and provides directions for more successful immune system manipulation.
- 4Wang, Y.; Zhang, S.; Li, H.; Wang, H.; Zhang, T.; Hutchinson, M. R.; Yin, H.; Wang, X. Small-Molecule Modulators of Toll-like Receptors. Acc. Chem. Res. 2020, 53, 1046, DOI: 10.1021/acs.accounts.9b00631[ACS Full Text], [CAS], Google Scholar4https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXlvFKqsrk%253D&md5=ff47634564c8a4229ca8431a9c4b283fSmall-Molecule Modulators of Toll-like ReceptorsWang, Yibo; Zhang, Shuting; Li, Hongyuan; Wang, Hongshuang; Zhang, Tianshu; Hutchinson, Mark R.; Yin, Hang; Wang, XiaohuiAccounts of Chemical Research (2020), 53 (5), 1046-1055CODEN: ACHRE4; ISSN:0001-4842. (American Chemical Society)A review. Conspectus: Toll-like receptors (TLRs) are the "gatekeepers" of the immune system in humans and other animals to protect the host from invading bacteria, viruses, and other microorganisms. Since TLR4 was discovered as the receptor for endotoxin in the late 1990s, significant progress has been made in exploiting an understanding of the function of TLRs. The TLR-signaling pathway is crucial for the induction and progression of various diseases. Dysregulation of TLR signaling contributes to numerous pathol. conditions, including chronic inflammation, sepsis, cancers, asthma, neuropathic pain, drug addiction, and autoimmune diseases. Therefore, manipulation of TLR signaling is promising to halt their activity in inflammatory diseases, to enhance their signaling to fight cancers, to modulate their role in autoimmune diseases, and to suppress them to treat drug addiction. TLR agonists have demonstrated great potential as antimicrobial agents and vaccine adjuvants, whereas TLR antagonists are being developed as reagents and drugs to dampen immune responses. Because of their pivotal potential therapeutic applications, fruitful small-mol. compds. and peptide fragments have been discovered, and many of them have advanced to various stages of clin. trials (though only two have been approved by the Food and Drug Administration (FDA): MPLA as a TLR4 agonist and imiquimod as a TLR7 agonist). In this Account, we focus on the progress in developing TLR signaling pathway modulators (mainly focused on the Yin and Wang labs.) over the past decade and highlight the accomplishments and currently existing challenges in the development of TLR modulators. First, we briefly describe the members of the human TLR family along with their natural modulators. Second, we illustrate our endeavors to discover TLR-targeted agents using comprehensive approaches. Specifically, a discussion of identification and characterization of new chem. entities, detn. of modes of action, and further applications is presented. For instance, the TLR3 antagonist was first discovered through in silico screening, and the inhibitory activity was confirmed in murine cells. Considering the glycosylation on TLR3, a new direction for TLR3 modulator design was pointed out to target asparagine glycosylation. We have particularly focused on the discovery of TLR4 antagonists and have assessed their great potential in the clin. treatment of drug addiction and alc. use disorders. In addn., we discuss multiple other popular and robust techniques for modulator discovery. Not only small org. modulators but also stapled peptides and peptidomimetics will attract more and more attention in the future. Finally, current challenges, opportunities, and future perspectives for TLR-targeted agents are also discussed.
- 5Xu, Y.; Tao, X.; Shen, B.; Horng, T.; Medzhitov, R.; Manley, J. L.; Tong, L. Structural Basis for Signal Transduction by the Toll/Interleukin-1 Receptor Domains. Nature 2000, 408 (6808), 111– 115, DOI: 10.1038/35040600[Crossref], [PubMed], [CAS], Google Scholar5https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD3cXotVaksLc%253D&md5=3d546f7c6dd43407b5ed063a47bdde93Structural basis for signal transduction by the Toll/interleukin-1 receptor domainsXu, Yingwu; Tao, Xiao; Shen, Baohe; Horng, Tiffany; Medzhitov, Ruslan; Manley, James L.; Tong, LiangNature (London) (2000), 408 (6808), 111-115CODEN: NATUAS; ISSN:0028-0836. (Nature Publishing Group)Toll-like receptors (TLRs) and the interleukin-1 receptor super-family (IL-1Rs) are integral to both innate and adaptive immunity for host defense. These receptors share a conserved cytoplasmic domain, known as the TIR domain. A single-point mutation in the TIR domain of murine TLR4 (Pro712His, the Lpsd mutation) abolishes the host immune response to lipopolysaccharide (LPS), and mutation of the equiv. residue in TLR2, Pro681His, disrupts signal transduction in response to stimulation by yeast and Gram-pos. bacteria. Here the authors report the crystal structures of the TIR domains of human TLR1 and TLR2 and of the Pro681His mutant of TLR2. The structures have a large conserved surface patch that also contains the site of the Lpsd mutation. Mutagenesis and functional studies confirm that residues in this surface patch are crucial for receptor signaling. The Lpsd mutation does not disturb the structure of the TIR domain itself. Instead, structural and functional studies indicate that the conserved surface patch may mediate interactions with the down-stream MyD88 adapter mol., and that the Lpsd mutation may abolish receptor signaling by disrupting this recruitment.
- 6Marciani, D. J. Vaccine Adjuvants: Role and Mechanisms of Action in Vaccine Immunogenicity. Drug Discovery Today 2003, 8 (20), 934– 943, DOI: 10.1016/S1359-6446(03)02864-2[Crossref], [PubMed], [CAS], Google Scholar6https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD3sXnvFSiu7o%253D&md5=6be25370fd9755fc3fb78be4d6de31b8Vaccine adjuvants: role and mechanisms of action in vaccine immunogenicityMarciani, Dante J.Drug Discovery Today (2003), 8 (20), 934-943CODEN: DDTOFS; ISSN:1359-6446. (Elsevier Science Ltd.)A review. Inactivated vaccines require adjuvants to stimulate an immune response. The choice of adjuvant or immune enhancer dets. whether the immune response is effective, ineffective or damaging. Accordingly, there is a need for new adjuvants that stimulate the appropriate immunity, for example, T cell immunity for intracellular pathogens and cancer vaccines. In several adjuvants, the identification of chem. groups that interact with specific cell toll-like receptors (innate immunity) or receptors for co-stimulatory ligands (adaptive immunity), has enabled the establishment of structure-function relationships that are useful in the design of new adjuvants. Because of the crucial immunomodulating role of adjuvants, sub-unit vaccine development will remain dependent on new adjuvants. Adjuvants are crucial for an effective vaccine immunoresponse. Elucidation of functional groups that are responsible for immunomodulation enables the rational design of novel adjuvants that are useful in preventive and therapeutic vaccines.
- 7Halperin, S. A.; Dobson, S.; McNeil, S.; Langley, J. M.; Smith, B.; McCall-Sani, R.; Levitt, D.; Van Nest, G.; Gennevois, D.; Eiden, J. J. Comparison of the Safety and Immunogenicity of Hepatitis B Virus Surface Antigen Co-Administered with an Immunostimulatory Phosphorothioate Oligonucleotide and a Licensed Hepatitis B Vaccine in Healthy Young Adults. Vaccine 2006, 24 (1), 20– 26, DOI: 10.1016/j.vaccine.2005.08.095[Crossref], [PubMed], [CAS], Google Scholar7https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2MXht1Oksr7F&md5=77f1b28b74aaf8de735dcef6a9c9aae9Comparison of the safety and immunogenicity of hepatitis B virus surface antigen co-administered with an immunostimulatory phosphorothioate oligonucleotide and a licensed hepatitis B vaccine in healthy young adultsHalperin, Scott A.; Dobson, Simon; McNeil, Shelly; Langley, Joanne M.; Smith, Bruce; McCall-Sani, Robyn; Levitt, Dan; Van Nest, Gary; Gennevois, Daniel; Eiden, Joseph J.Vaccine (2006), 24 (1), 20-26CODEN: VACCDE; ISSN:0264-410X. (Elsevier B.V.)Background: Many individuals do not respond to a three-dose series of hepatitis B vaccine (HBV) and most do not achieve a protective antibody response until after dose 2 or 3. Methods: Healthy, seroneg. 18-28 yr old adults were randomly assigned in equal nos. to receive two doses of the exptl. vaccine (HBV-ISS without alum) (0, 8 wk) and placebo (24 wk) or Engerix-B (0, 8, 24 wk). Adverse events were collected during the first week and at 4 wk after each injection. Antibodies were measured 4 wk after dose 1; before, 1 and 4 wk after dose 2, and before, 1 and 4 wk after dose 3 and at 1 yr. Results: Ninety-nine participants were enrolled (65% female; mean age 22.6 years). 79% of HBV-ISS and 12% of Engerix-B recipients had a protective antibody response 4 wk post dose 1 (geometric mean concn. [GMC] 23.0 and 1.87 mIU/mL, resp.). By 1 wk post dose 2, 100% of HBV-ISS and 18% Engerix-B recipients had protective levels (GMC 1603 vs. 2.40 mIU/mL). Rates of adverse events were low and similar in both groups; headache and fatigue were the most common systemic adverse events in up to 1/3 of both groups. Mild injection-site tenderness was more common after HBV-ISS than Engerix-B after both doses (74-77% compared to 34-58%; p ≤ 0.029). Conclusions: Protective levels are achieved more quickly and after fewer doses of HBV-ISS than Engerix-B. HBV-ISS is well tolerated but assocd. with more mild injection-site tenderness than Engerix-B.
- 8Kanzler, H.; Barrat, F. J.; Hessel, E. M.; Coffman, R. L. Therapeutic Targeting of Innate Immunity with Toll-like Receptor Agonists and Antagonists. Nat. Med. 2007, 13 (5), 552– 559, DOI: 10.1038/nm1589[Crossref], [PubMed], [CAS], Google Scholar8https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2sXkvVOgsrs%253D&md5=5fcd32926d9b24f84ff9fd611dec2175Therapeutic targeting of innate immunity with Toll-like receptor agonists and antagonistsKanzler, Holger; Barrat, Franck J.; Hessel, Edith M.; Coffman, Robert L.Nature Medicine (New York, NY, United States) (2007), 13 (5), 552-559CODEN: NAMEFI; ISSN:1078-8956. (Nature Publishing Group)A review. The identification of the antigen recognition receptors for innate immunity, most notably the Toll-like receptors, has sparked great interest in therapeutic manipulation of the innate immune system. Toll-like receptor agonists are being developed for the treatment of cancer, allergies and viral infections, and as adjuvants for potent new vaccines to prevent or treat cancer and infectious diseases. As recognition grows of the role of inappropriate Toll-like receptor stimulation in inflammation and autoimmunity, significant efforts have begun to develop antagonists to Toll-like receptors as well.
- 9Kurt-Jones, E. A.; Popova, L.; Kwinn, L.; Haynes, L. M.; Jones, L. P.; Tripp, R. A.; Walsh, E. E.; Freeman, M. W.; Golenbock, D. T.; Anderson, L. J.; Finberg, R. W. Pattern Recognition Receptors TLR4 and CD14 Mediate Response to Respiratory Syncytial Virus. Nat. Immunol. 2000, 1 (5), 398– 401, DOI: 10.1038/80833[Crossref], [PubMed], [CAS], Google Scholar9https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD3cXnvVGht78%253D&md5=ce89033135ff579b641602cd70d65926Pattern recognition receptors TLR4 and CD14 mediate response to respiratory syncytial virusKurt-Jones, Evelyn A.; Popova, Lana; Kwinn, Laura; Haynes, Lia M.; Jones, Les P.; Tripp, Ralph A.; Walsh, Edward E.; Freeman, Mason W.; Golenbock, Douglas T.; Anderson, Larry J.; Finberg, Robert W.Nature Immunology (2000), 1 (5), 398-401CODEN: NIAMCZ; ISSN:1529-2908. (Nature America Inc.)The innate immune system contributes to the earliest phase of the host defense against foreign organisms and has both sol. and cellular pattern recognition receptors for microbial products. Two important members of this receptor group, CD14 and the Toll-like receptor (TLR) pattern recognition receptors, are essential for the innate immune response to components of Gram-neg. and Gram-pos. bacteria, mycobacteria, spirochetes and yeast. The authors now find that these receptors function in an antiviral response as well. The innate immune response to the fusion protein of an important respiratory pathogen of humans, respiratory syncytial virus (RSV), was mediated by TLR4 and CD14. RSV persisted longer in the lungs of infected TLR4-deficient mice compared to normal mice. Thus, a common receptor activation pathway can initiate innate immune responses to both bacterial and viral pathogens.
- 10Lester, S. N.; Li, K. Toll-like Receptors in Antiviral Innate Immunity. J. Mol. Biol. 2014, 426 (6), 1246– 1264, DOI: 10.1016/j.jmb.2013.11.024[Crossref], [PubMed], [CAS], Google Scholar10https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXhvFOgsrzF&md5=c58c0d532646cc9fa42ee0f2e291f257Toll-Like Receptors in Antiviral Innate ImmunityLester, Sandra N.; Li, KuiJournal of Molecular Biology (2014), 426 (6), 1246-1264CODEN: JMOBAK; ISSN:0022-2836. (Elsevier Ltd.)A review. Toll-like receptors (TLRs) are fundamental sensor mols. of the host innate immune system, which detect conserved mol. signatures of a wide range of microbial pathogens and initiate innate immune responses via distinct signaling pathways. Various TLRs are implicated in the early interplay of host cells with invading viruses, which regulates viral replication and/or host responses, ultimately impacting on viral pathogenesis. To survive the host innate defense mechanisms, many viruses have developed strategies to evade or counteract signaling through the TLR pathways, creating an advantageous environment for their propagation. Here we review the current knowledge of the roles TLRs play in antiviral innate immune responses, discuss examples of TLR-mediated viral recognition, and describe strategies used by viruses to antagonize the host antiviral innate immune responses.
- 11Carriere, J.; Rao, Y.; Liu, Q.; Lin, X.; Zhao, J.; Feng, P. Post-Translational Control of Innate Immune Signaling Pathways by Herpesviruses. Front. Microbiol. 2019, 10, 2647, DOI: 10.3389/fmicb.2019.02647[Crossref], [PubMed], [CAS], Google Scholar11https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB3Mfmt1yksw%253D%253D&md5=69c3c15b88490bc7aa17c2e439d6708fPost-translational Control of Innate Immune Signaling Pathways by HerpesvirusesCarriere Jessica; Rao Youliang; Liu Qizhi; Lin Xiaoxi; Zhao Jun; Feng PinghuiFrontiers in microbiology (2019), 10 (), 2647 ISSN:1664-302X.Herpesviruses constitute a large family of disease-causing DNA viruses. Each herpesvirus strain is capable of infecting particular organisms with a specific cell tropism. Upon infection, pattern recognition receptors (PRRs) recognize conserved viral features to trigger signaling cascades that culminate in the production of interferons and pro-inflammatory cytokines. To invoke a proper immune response while avoiding collateral tissue damage, signaling proteins involved in these cascades are tightly regulated by post-translational modifications (PTMs). Herpesviruses have developed strategies to subvert innate immune signaling pathways in order to ensure efficient viral replication and achieve persistent infection. The ability of these viruses to control the proteins involved in these signaling cascades post-translationally, either directly via virus-encoded enzymes or indirectly through the deregulation of cellular enzymes, has been widely reported. This ability provides herpesviruses with a powerful tool to shut off or restrict host antiviral and inflammatory responses. In this review, we highlight recent findings on the herpesvirus-mediated post-translational control along PRR-mediated signaling pathways.
- 12Patel, M. C.; Shirey, K. A.; Pletneva, L. M.; Boukhvalova, M. S.; Garzino-Demo, A.; Vogel, S. N.; Blanco, J. C. G. Novel Drugs Targeting Toll-like Receptors for Antiviral Therapy. Future Virol. 2014, 9 (9), 811– 829, DOI: 10.2217/fvl.14.70[Crossref], [PubMed], [CAS], Google Scholar12https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXhvVSrt73O&md5=285a60f9350d2a25526e03f821050a0eNovel drugs targeting Toll-like receptors for antiviral therapyPatel, Mira C.; Shirey, Kari Ann; Pletneva, Lioubov M.; Boukhvalova, Marina S.; Garzino-Demo, Alfredo; Vogel, Stefanie N.; Blanco, Jorge C. G.Future Virology (2014), 9 (9), 811-829CODEN: FVUIAM; ISSN:1746-0794. (Future Medicine Ltd.)A review. Toll-like receptors (TLRs) are sentinel receptors of the host innate immune system that recognize conserved 'pathogen-assocd. mol. patterns' of invading microbes, including viruses. The activation of TLRs establishes antiviral innate immune responses and coordinates the development of long-lasting adaptive immunity in order to control viral pathogenesis. However, microbe-induced damage to host tissues may release 'danger-assocd. mol. patterns' that also activate TLRs, leading to an overexuberant inflammatory response and, ultimately, to tissue damage. Thus, TLRs have proven to be promising targets as therapeutics for the treatment of viral infections that result in inflammatory damage or as adjuvants in order to enhance the efficacy of vaccines. Here, we explore recent advances in TLR biol. with a focus on novel drugs that target TLRs (agonists and antagonists) for antiviral therapy.
- 13Devhare, P. B.; Chatterjee, S. N.; Arankalle, V. A.; Lole, K. S. Analysis of Antiviral Response in Human Epithelial Cells Infected with Hepatitis E Virus. PLoS One 2013, 8 (5), e63793, DOI: 10.1371/journal.pone.0063793[Crossref], [PubMed], [CAS], Google Scholar13https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXnvFaisLo%253D&md5=4fd867f1f74f978e8d90adafa60ae176Analysis of antiviral response in human epithelial cells infected with hepatitis E virusDevhare, Pradip B.; Chatterjee, Subhashis N.; Arankalle, Vidya A.; Lole, Kavita S.PLoS One (2013), 8 (5), e63793CODEN: POLNCL; ISSN:1932-6203. (Public Library of Science)Hepatitis E virus (HEV) is a major cause of enterically transmitted acute hepatitis in developing nations and occurs in sporadic and epidemic forms. The disease may become severe with high mortality (20%) among pregnant women. Due to lack of efficient cell culture system and small animal model, early mol. events of HEV infection are not yet known. In the present study, human lung epithelial cells, A549, were infected with HEV to monitor expression levels of genes/proteins in antiviral pathways. Both live and UV inactivated virus elicited robust induction of inflammatory cytokines/chemokines such as IL-6, IL-8, TNF-α, and RANTES within 12 h of infection. Cells exposed to sol. capsid protein showed no induction suggesting the capsid structure and not the protein being detected as the pathogen pattern by cells. A delayed up-regulation of type I interferon genes only by the live virus at 48 h post HEV infection indicated the need of virus replication. However, absence of secreted interferons till 96 h suggested possible involvement of post-transcriptional regulation of type I IFN expression. HEV infected cells showed activation of both NF-κB and IRF3 transcription factors when seen at protein levels; however, reporter gene assays showed predominant expression via NF-κB promoter as compared to IRF3 promoter. Knockdown expts. done using siRNAs showed involvement of MyD88 and TRIF adaptors in generating antiviral response thus indicating role of TLR2, TLR4 and TLR3 in sensing viral mols. MAVS knockdown surprisingly enhanced only proinflammatory cytokines and not type I IFNs. This suggested that HEV not only down-regulates RIG-I helicase like receptor mediated IFN induction but also employs MAVS in curtailing host inflammatory response. Our findings uncover an early cellular response in HEV infection and assocd. mol. mechanisms suggesting the potential role of inflammatory response triggered by HEV infection in host immune response and pathogenesis.
- 14Martínez-Aguado, P.; Serna-Gallego, A.; Marrugal-Lorenzo, J. A.; Gómez-Marín, I.; Sánchez-Céspedes, J. Antiadenovirus Drug Discovery: Potential Targets and Evaluation Methodologies. Drug Discovery Today 2015, 20 (10), 1235– 1242, DOI: 10.1016/j.drudis.2015.07.007[Crossref], [PubMed], [CAS], Google Scholar14https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXht1Gru73O&md5=ecec72b654f0348637b1cb9bd465d10fAntiadenovirus drug discovery: potential targets and evaluation methodologiesMartinez-Aguado, Pablo; Serna-Gallego, Ana; Marrugal-Lorenzo, Jose A.; Gomez-Marin, Isabel; Sanchez-Cespedes, JavierDrug Discovery Today (2015), 20 (10), 1235-1242CODEN: DDTOFS; ISSN:1359-6446. (Elsevier Ltd.)Human adenoviruses (HAdV) are the cause of many acute infections, mostly in the respiratory and gastrointestinal (GI) tracts, as well as conjunctivitis. HAdV diseases in immunocompetent individuals are mostly self-limiting; however, in immunocompromised individuals, esp. in pediatric units, HAdV infections are the cause of high morbidity and mortality. Despite the significant clin. impact, there are currently no approved antiviral therapies for HAdV infections. Here, we provide an overview of the different targets that could be considered for the design of specific drugs against HAdV, as well as the available in vitro and in vivo tools for the screening and evaluation of candidate mols.
- 15Ma, Z.; Cao, Q.; Xiong, Y.; Zhang, E.; Lu, M. Interaction between Hepatitis B Virus and Toll-like Receptors: Current Status and Potential Therapeutic Use for Chronic Hepatitis B. Vaccines 2018, 6 (1), 6, DOI: 10.3390/vaccines6010006[Crossref], [CAS], Google Scholar15https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXnt1Kntbw%253D&md5=d01c582b647621d9b602fadcbfbf1cafInteraction between hepatitis B virus and toll-like receptors: current status and potential therapeutic use for chronic hepatitis BMa, Zhiyong; Cao, Qian; Xiong, Yong; Zhang, Ejuan; Lu, MengjiVaccines (Basel, Switzerland) (2018), 6 (1), 6/1-6/14CODEN: VBSABP; ISSN:2076-393X. (MDPI AG)Immune defense against infection with the hepatitis B virus (HBV) is complex and involves both host innate and adaptive immune systems. It is well accepted that the development of sufficient HBV-specific T cell and B cell responses are required for controlling an HBV infection. However, the contribution of innate immunity to removing HBV has been explored in recent years. Toll-like receptors (TLRs) are recognized as the first line of antiviral immunity because they initiate intracellular signaling pathways to induce antiviral mediators such as interferons (IFNs) and other cytokines. Recent studies show that the activation of TLR-mediated signaling pathways results in a suppression of HBV replication in vitro and in vivo. However, HBV has also evolved strategies to counter TLR responses including the suppression of TLR expression and the blockage of downstream signaling pathways. Antiviral treatment in chronic HBV-infected patients leads to an upregulation of TLR expression and the restoration of its innate antiviral functions. Thus, TLR activation may serve as an addnl. immunotherapeutic option for treating chronic HBV infection in combination with antiviral treatment.
- 16Du, K.; Liu, J.; Broering, R.; Zhang, X.; Yang, D.; Dittmer, U.; Lu, M. Recent Advances in the Discovery and Development of TLR Ligands as Novel Therapeutics for Chronic HBV and HIV Infections. Expert Opin. Drug Discovery 2018, 13 (7), 661– 670, DOI: 10.1080/17460441.2018.1473372[Crossref], [PubMed], [CAS], Google Scholar16https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXpslSksbw%253D&md5=b815b561b60f6f912260a37102e209bdRecent advances in the discovery and development of TLR ligands as novel therapeutics for chronic HBV and HIV infectionsDu, Keye; Liu, Jia; Broering, Ruth; Zhang, Xiaoyong; Yang, Dongliang; Dittmer, Ulf; Lu, MengjiExpert Opinion on Drug Discovery (2018), 13 (7), 661-670CODEN: EODDBX; ISSN:1746-0441. (Taylor & Francis Ltd.)A review. Toll-like receptor (TLR) ligands remain as promising antiviral drug candidates for the treatment of chronic viral infections. Basic research on the mechanisms of antiviral activity of TLR ligands in preclin. animal models and clin. testing of drug candidates have been carried out in recent years.: This review provides an overview of the preclin. and clin. testing of TLR ligands in two major viral infections: hepatitis B virus (HBV) and human immunodeficiency virus (HIV). Recent results have further demonstrated the potent antiviral activity of various TLR ligands . A TLR7 agonist is in clin. trials for the treatment of chronic HBV infection while a HBV vaccine using a TLR9 ligand as an adjuvant has proven to be superior to conventional HBV vaccines and has been approved for clin. use. Generally, TLR activation may achieve viral control mainly by promoting adaptive immunity to viral proteins.: Recent research in this field indicates that TLR ligands could be developed as clin. effective drugs if the obstacles concerning toxicity and application routes are overcome. TLR-mediated promotion of adaptive immunity is a major issue for future studies and will det. the future development of TLR ligands as drugs for immunomodulation.
- 17Jung, H. E.; Kim, T. H.; Lee, H. K. Contribution of Dendritic Cells in Protective Immunity against Respiratory Syncytial Virus Infection. Viruses 2020, 12 (1), 102, DOI: 10.3390/v12010102[Crossref], [CAS], Google Scholar17https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXmsVCqt7o%253D&md5=78d9b808f9f4ddd2c08c778fde329d7eContribution of dendritic cells in protective immunity against respiratory syncytial virus infectionJung, Hi Eun; Kim, Tae Hoon; Lee, Heung KyuViruses (2020), 12 (1), 102CODEN: VIRUBR; ISSN:1999-4915. (MDPI AG)A review. Respiratory syncytial virus (RSV) is a major cause of severe respiratory disease in infants and the elderly. The socioeconomic burden of RSV infection is substantial because it leads to serious respiratory problems, subsequent hospitalization, and mortality. Despite its clin. significance, a safe and effective vaccine is not yet available to prevent RSV infection. Upon RSV infection, lung dendritic cells (DCs) detecting pathogens migrate to the lymph nodes and activate the adaptive immune response. Therefore, RSV has evolved various immunomodulatory strategies to inhibit DC function. Due to the capacity of RSV to modulate defense mechanisms in hosts, RSV infection results in inappropriate activation of immune responses resulting in immunopathol. and frequent reinfection throughout life. This review discusses how DCs recognize invading RSV and induce adaptive immune responses, as well as the regulatory mechanisms mediated by RSV to disrupt DC functions and ultimately avoid host defenses.
- 18Jin, M. S.; Kim, S. E.; Heo, J. Y.; Lee, M. E.; Kim, H. M.; Paik, S. G.; Lee, H.; Lee, J. O. Crystal Structure of the TLR1-TLR2 Heterodimer Induced by Binding of a Tri-Acylated Lipopeptide. Cell 2007, 130 (6), 1071– 1082, DOI: 10.1016/j.cell.2007.09.008[Crossref], [PubMed], [CAS], Google Scholar18https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2sXhtFKnurvE&md5=3a610b4af1a57592a05a78dd53109105Crystal structure of the TLR1-TLR2 heterodimer induced by binding of a tri-acylated lipopeptideJin, Mi Sun; Kim, Sung Eun; Heo, Jin Young; Lee, Mi Eun; Kim, Ho Min; Paik, Sang-Gi; Lee, Hayyoung; Lee, Jie-OhCell (Cambridge, MA, United States) (2007), 130 (6), 1071-1082CODEN: CELLB5; ISSN:0092-8674. (Cell Press)TLR2 in assocn. with TLR1 or TLR6 plays an important role in the innate immune response by recognizing microbial lipoproteins and lipopeptides. Here the authors present the crystal structures of the human TLR1-TLR2-lipopeptide complex and of the mouse TLR2-lipopeptide complex. Binding of the tri-acylated lipopeptide, Pam3CSK4, induced the formation of an "m" shaped heterodimer of the TLR1 and TLR2 ectodomains whereas binding of the diacylated lipopeptide, Pam2CSK4, did not. The three lipid chains of Pam3CSK4 mediate the heterodimerization of the receptor; the two ester-bound lipid chains are inserted into a pocket in TLR2, while the amide-bound lipid chain is inserted into a hydrophobic channel in TLR1. An extensive hydrogen-bonding network, as well as hydrophobic interactions, between TLR1 and TLR2 further stabilize the heterodimer. The authors propose that formation of the TLR1-TLR2 heterodimer brings the intracellular TIR domains close to each other to promote dimerization and initiate signaling.
- 19Shukla, N. M.; Chan, M.; Hayashi, T.; Carson, D. A.; Cottam, H. B. Recent Advances and Perspectives in Small-Molecule TLR Ligands and Their Modulators. ACS Med. Chem. Lett. 2018, 9 (12), 1156– 1159, DOI: 10.1021/acsmedchemlett.8b00566[ACS Full Text], [CAS], Google Scholar19https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXitlKjurzL&md5=8575e9a1760c0360248ad088b38a24d4Recent Advances and Perspectives in Small-molecule TLR Ligands and Their ModulatorsShukla, Nikunj M.; Chan, Michael; Hayashi, Tomoko; Carson, Dennis A.; Cottam, Howard B.ACS Medicinal Chemistry Letters (2018), 9 (12), 1156-1159CODEN: AMCLCT; ISSN:1948-5875. (American Chemical Society)A review. Activation of Toll-like receptors (TLRs) located on immune cells leads to induction of immune responses that can be useful in vaccines for infectious diseases, cancer immunotherapy, and autoimmune diseases. Novel TLR signaling pathway modulators can further enhance the efficacy of TLR ligands.
- 20Shah, M.; Anwar, M. A.; Kim, J. H.; Choi, S. Advances in Antiviral Therapies Targeting Toll-like Receptors. Expert Opin. Invest. Drugs 2016, 25 (4), 437– 453, DOI: 10.1517/13543784.2016.1154040[Crossref], [PubMed], [CAS], Google Scholar20https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XjtlCiuro%253D&md5=81e771f844dcbd775f51e24ad04b2a5cAdvances in Antiviral Therapies Targeting Toll-like ReceptorsShah, Masaud; Anwar, Muhammad Ayaz; Kim, Jae-Ho; Choi, SangdunExpert Opinion on Investigational Drugs (2016), 25 (4), 437-453CODEN: EOIDER; ISSN:1354-3784. (Taylor & Francis Ltd.)Organisms have evolved a rapid and non-specific way to defend themselves via Toll-like receptors (TLRs), which recognize specific signatures present on invading microbes and viruses. Once detected, these receptors flood the cell with cytokines and IFNs that not only help to eradicate the invading viruses but also activate the adaptive immune response. Owing to difficulties in viral detection, a whole class of TLRs is dedicated to sensing viral nucleic acids, while other TLRs detect viral coat proteins and aid in establishing antiviral immunity. To protect humans better, TLRs and their downstream mediators can be used as potential drug targets, which can be either activated or inhibited, to counter viral infections. The current review focuses on TLR-targeting investigational drugs developed to treat viral diseases and virus-induced complications. TLRs are a good choice for eradicating viral infections because they can fine-tune the immune response. However, TLRs should be exploited carefully, as there have been instances where their activation has led to unwanted responses in terms of both immune and viral activation. Therefore, more focus should be placed on novel drugs that can induce significant and long-term immunity, while concomitantly alleviating side effects.
- 21Zhu, G.; Xu, Y.; Cen, X.; Nandakumar, K. S.; Liu, S.; Cheng, K. Targeting Pattern-Recognition Receptors to Discover New Small Molecule Immune Modulators. Eur. J. Med. Chem. 2018, 144, 82– 92, DOI: 10.1016/j.ejmech.2017.12.026[Crossref], [PubMed], [CAS], Google Scholar21https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXhvF2ntr7L&md5=dd71c03c5334ac994cbd0d987df28a9fTargeting pattern-recognition receptors to discover new small molecule immune modulatorsZhu, Gengzheng; Xu, Yao; Cen, Xiaohong; Nandakumar, Kutty Selva; Liu, Shuwen; Cheng, KuiEuropean Journal of Medicinal Chemistry (2018), 144 (), 82-92CODEN: EJMCA5; ISSN:0223-5234. (Elsevier Masson SAS)A review. Pattern recognition receptors (PRRs) are key immune receptors of the innate immune system, which recognize the conserved pathogen-assocd. mol. patterns (PAMPs) of the invading pathogens. Compared to the adaptive immune receptors, PRRs have three distinguishing features, viz., universal expression, fast response and recognizing many kinds of microbes. Toll-like receptors (TLRs), RIG-I-like receptors (RLRs), C-type lectin receptors (CLRs) and NOD-like receptors (NLRs) recognize viral nucleic acid/bacterial fragments and trigger anti-microbial innate immune responses. Upon recognition of their ligand species, PRRs recruit specific intracellular adaptor proteins to initiate signaling pathways culminating in the activation of nuclear factor-κB (NF-κB), mitogen-activated protein (MAP) kinases and interferon regulatory factors (IRFs) that control the transcription of genes encoding pro-inflammatory factors including type I interferon and other inflammatory cytokines, which are crit. for eliminating the potential threat to the host. Here, we summarize the effects of small mol. regulators acting on signaling pathways initiated by TLR, RLR and NLR as well as their influence on innate and adaptive immune responses leading to therapy.
- 22Lucifora, J.; Bonnin, M.; Aillot, L.; Fusil, F.; Maadadi, S.; Dimier, L.; Michelet, M.; Floriot, O.; Ollivier, A.; Rivoire, M.; Ait-Goughoulte, M.; Daffis, S.; Fletcher, S. P.; Salvetti, A.; Cosset, F. L.; Zoulim, F.; Durantel, D. Direct Antiviral Properties of TLR Ligands against HBV Replication in Immune-Competent Hepatocytes. Sci. Rep. 2018, 8 (1), 1– 11, DOI: 10.1038/s41598-018-23525-w[Crossref], [PubMed], [CAS], Google Scholar22https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhs1KrtrnK&md5=19d8422d0938b31218753f3bd5a648b8Direct antiviral properties of TLR ligands against HBV replication in immune-competent hepatocytesLucifora, Julie; Bonnin, Marc; Aillot, Ludovic; Fusil, Floriane; Maadadi, Sarah; Dimier, Laura; Michelet, Maud; Floriot, Oceane; Ollivier, Anais; Rivoire, Michel; Ait-Goughoulte, Malika; Daffis, Stephane; Fletcher, Simon P.; Salvetti, Anna; Cosset, Francois-Loic; Zoulim, Fabien; Durantel, DavidScientific Reports (2018), 8 (1), 1-11CODEN: SRCEC3; ISSN:2045-2322. (Nature Research)Current therapies for chronic hepatitis B virus (HBV) infections are effective at decreasing the viral load in serum, but do not lead to viral eradication. Recent studies highlighted the therapeutic or "adjuvant" potential of immune-modulators. Our aim was to explore the direct anti-HBV effect of Toll-Like-Receptors (TLR) agonists in hepatocytes. HBV-infected primary human hepatocytes (PHH) or differentiated HepaRG cells (dHepaRG) were treated with various TLR agonists. Amongst all TLR ligands tested, Pam3CSK4 (TLR1/2-ligand) and poly(I:C)-(HMW) (TLR3/MDA5-ligand) were the best at reducing all HBV parameters. No or little viral rebound was obsd. after treatment arrest, implying a long-lasting effect on cccDNA. We also tested Riboxxol that features improved TLR3 specificity compared to poly(I:C)-(HMW). This agonist demonstrated a potent antiviral effect in HBV-infected PHH. Whereas, poly(I:C)-(HMW) and Pam3CSK4 mainly induced the expression of classical genes from the interferon or NF-κB pathway resp., Riboxxol had a mixed phenotype. Moreover, TLR2 and TLR3 ligands can activate hepatocytes and immune cells, as demonstrated by antiviral cytokines produced by stimulated hepatocytes and peripheral blood mononuclear cells. In conclusion, our data highlight the potential of innate immunity activation in the direct control of HBV replication in hepatocytes, and support the development of TLR-based antiviral strategies.
- 23Kim, W. J.; Choi, J. W.; Jang, W. J.; Kang, Y. S.; Lee, C. W.; Synytsya, A.; Park, Y. Il. Low-Molecular Weight Mannogalactofucans Prevent Herpes Simplex Virus Type 1 Infection via Activation of Toll-like Receptor 2. Int. J. Biol. Macromol. 2017, 103, 286– 293, DOI: 10.1016/j.ijbiomac.2017.05.060[Crossref], [PubMed], [CAS], Google Scholar23https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXotF2ms74%253D&md5=7597f7f3178373521bc88fc2ca4af9baLow-molecular weight mannogalactofucans prevent herpes simplex virus type 1 infection via activation of Toll-like receptor 2Kim, Woo Jung; Choi, Ji Won; Jang, Won Jong; Kang, Young-Sun; Lee, Chang Won; Synytsya, Andriy; Park, Yong IlInternational Journal of Biological Macromolecules (2017), 103 (), 286-293CODEN: IJBMDR; ISSN:0141-8130. (Elsevier B.V.)Low-mol.-wt. mannogalactofucans (LMMGFs, <4000 g/mol) were prepd. by the enzymic degrdn. of Undaria pinnatifida sporophyll galactofucan (MF) and evaluated or their antiviral activities and underlying action mechanisms against herpes simplex virus type 1 (HSV-1). The 50% inhibitory concns. (IC50) of LMMGFs and MF were 2.64 and 2.42 μg/mL, resp. LMMGFs inhibited the viral entry on the host cell surface and also exhibited inhibitory activity directly against viral particles, as obsd. in a virucidal assay. LMMGFs dose-dependently enhanced the mRNA expression of Toll-like receptor 2 (TLR2) and stimulated the phosphorylation of Akt and JNK in Vero cells. These results clearly demonstrated that LMMGFs use TLR2 as their receptor, preventing HSV-1 infection on the host cell surface and antagonizing viral adsorption via TLR2 pathway activation in Vero cells.
- 24Santone, M.; Aprea, S.; Wu, T. Y. H.; Cooke, M. P.; Mbow, M. L.; Valiante, N. M.; Rush, J. S.; Dougan, S.; Avalos, A.; Ploegh, H.; De Gregorio, E.; Buonsanti, C.; D’Oro, U. A New TLR2 Agonist Promotes Cross-Presentation by Mouse and Human Antigen Presenting Cells. Hum. Vaccines Immunother. 2015, 11 (8), 2038– 2050, DOI: 10.1080/21645515.2015.1027467
- 25Arora, S.; Ahmad, S.; Irshad, R.; Goyal, Y.; Rafat, S.; Siddiqui, N.; Dev, K.; Husain, M.; Ali, S.; Mohan, A.; Syed, M. A. TLRs in Pulmonary Diseases. Life Sci. 2019, 233, 116671, DOI: 10.1016/j.lfs.2019.116671[Crossref], [PubMed], [CAS], Google Scholar25https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhsFGjsLnK&md5=be2ba61debcb16c8c2cb23451e5f3341TLRs in pulmonary diseasesArora, Shweta; Ahmad, Shaniya; Irshad, Rasha; Goyal, Yamini; Rafat, Sahar; Siddiqui, Neha; Dev, Kapil; Husain, Mohammad; Ali, Shakir; Mohan, Anant; Syed, Mansoor AliLife Sciences (2019), 233 (), 116671CODEN: LIFSAK; ISSN:0024-3205. (Elsevier B.V.)A review. Toll-like receptors (TLRs) comprise a clan of proteins involved in identification and triggering a suitable response against pathogenic attacks. As lung is steadily exposed to multiple infectious agents, antigens and host-derived danger signals, the inhabiting stromal and myeloid cells of the lung express an aggregate of TLRs which perceive the endogenously derived damage-assocd. mol. patterns (DAMPs) along with pathogen assocd. mol. patterns (PAMPs) and trigger the TLR-assocd. signalling events involved in host defense. Thus, they form an imperative component of host defense activation in case of microbial infections as well as non-infectious pulmonary disorders such as interstitial lung disease, acute lung injury and airways disease, such as COPD and asthma. They also play an equally important role in lung cancer. Targeting the TLR signalling network would pave ways to the design of more reliable and effective vaccines against infectious agents and control deadly infections, desensitize allergens and reduce inflammation. Moreover, TLR agonists may act as adjuvants by increasing the efficiency of cancer vaccines, thereby contributing their role in treatment of lung cancer too. Overall, TLRs present a compelling and expeditiously bolstered area of research and addressing their signalling events would be of significant use in pulmonary diseases.
- 26West, J. A.; Gregory, S. M.; Damania, B. Toll-like Receptor Sensing of Human Herpesvirus Infection. Front. Cell. Infect. Microbiol. 2012, 2, 122, DOI: 10.3389/fcimb.2012.00122[Crossref], [PubMed], [CAS], Google Scholar26https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC3s%252Fks12nsA%253D%253D&md5=c956436179c276675547ffa7854bc7f9Toll-like receptor sensing of human herpesvirus infectionWest John A; Gregory Sean M; Damania BlossomFrontiers in cellular and infection microbiology (2012), 2 (), 122 ISSN:.Toll-like receptors (TLRs) are evolutionarily conserved pathogen sensors that constitute the first line of defense in the human immune system. Herpesviruses are prevalent throughout the world and cause significant disease in the human population. Sensing of herpesviruses via TLRs has only been documented in the last 10 years and our understanding of the relationship between these sentinels of the immune system and herpesvirus infection has already provided great insight into how the host cell responds to viral infection. This report will summarize the activation and modulation of TLR signaling in the context of human herpesvirus infections.
- 27Li, Y.; Qu, C.; Yu, P.; Ou, X.; Pan, Q.; Wang, W. The Interplay between Host Innate Immunity and Hepatitis E Virus. Viruses 2019, 11 (6), 541, DOI: 10.3390/v11060541[Crossref], [CAS], Google Scholar27https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXksFSh&md5=37ad6195d06b233341f536f12264a5e6The interplay between host innate immunity and hepatitis E virusLi, Yang; Qu, Changbo; Yu, Peifa; Ou, Xumin; Pan, Qiuwei; Wang, WenshiViruses (2019), 11 (6), 541CODEN: VIRUBR; ISSN:1999-4915. (MDPI AG)A review. Hepatitis E virus (HEV) infection represents an emerging global health issue, whereas the clin. outcomes vary dramatically among different populations. The host innate immune system provides a first-line defense against the infection, but dysregulation may partially contribute to severe pathogenesis. A growing body of evidence has indicated the active response of the host innate immunity to HEV infection both in exptl. models and in patients. In turn, HEV has developed sophisticated strategies to counteract the host immune system. In this review, we aim to comprehensively decipher the processes of pathogen recognition, interferon, and inflammatory responses, and the involvement of innate immune cells in HEV infection. We further discuss their implications in understanding the pathogenic mechanisms and developing antiviral therapies.
- 28Said, E. A.; Tremblay, N.; Al-Balushi, M. S.; Al-Jabri, A. A.; Lamarre, D. Viruses Seen by Our Cells: The Role of Viral RNA Sensors. J. Immunol. Res. 2018, 2018, 9480497, DOI: 10.1155/2018/9480497[Crossref], [PubMed], [CAS], Google Scholar28https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC1MbisFOgug%253D%253D&md5=399019aaac05c5f283890c19ba2faec6Viruses Seen by Our Cells: The Role of Viral RNA SensorsSaid Elias A; Al-Balushi Mohammed S; Al-Jabri Ali A; Tremblay Nicolas; Lamarre DanielJournal of immunology research (2018), 2018 (), 9480497 ISSN:.The role of the innate immune response in detecting RNA viruses is crucial for the establishment of proper inflammatory and antiviral responses. Different receptors, known as pattern recognition receptors (PRRs), are present in the cytoplasm, endosomes, and on the cellular surface. These receptors have the capacity to sense the presence of viral nucleic acids as pathogen-associated molecular patterns (PAMPs). This recognition leads to the induction of type 1 interferons (IFNs) as well as inflammatory cytokines and chemokines. In this review, we provide an overview of the significant involvement of cellular RNA helicases and Toll-like receptors (TLRs) 3, 7, and 8 in antiviral immune defenses.
- 29Verma, R.; Bharti, K. Toll like Receptor 3 and Viral Infections of Nervous System. J. Neurol. Sci. 2017, 372, 40– 48, DOI: 10.1016/j.jns.2016.11.034[Crossref], [PubMed], [CAS], Google Scholar29https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XhvFCjtb%252FM&md5=a60241a8d0871c997fa0adf05e658ee1Toll like receptor 3 and viral infections of nervous systemVerma, Rajesh; Bharti, KavitaJournal of the Neurological Sciences (2017), 372 (), 40-48CODEN: JNSCAG; ISSN:0022-510X. (Elsevier B.V.)Members of the toll-like receptor (TLR) family are pathogen recognition receptors that recognize pathogen-assocd. mol. patterns. TLRs mediate the modulation of innate immune responses and influence the development of adaptive immunity. TLR3 is the first identified antiviral TLR that recognizes dsRNA. TLR3 plays a central role in the activation of host immune responses to viral infections and shows detrimental or protective effects against various viral infections. Several viruses are neurotropic and can infect the central nervous system, leading to neuropathologies such as encephalitis, encephalopathy, meningitis, and neuritis. Single nucleotide polymorphism (SNP) in the TLR3 gene is assocd. with the susceptibility to a spectrum of nervous system viral infections. In this review, we discussed the existing knowledge of TLR3 immune responses on the basis of the exptl. evidence and coherent picture of the SNP in TLR3 that is assocd. with various neurotropic virus infections.
- 30Lee, I.; Bos, S.; Li, G.; Wang, S.; Gadea, G.; Desprès, P.; Zhao, R. Y. Probing Molecular Insights into Zika Virus–Host Interactions. Viruses 2018, 10 (5), 233, DOI: 10.3390/v10050233[Crossref], [CAS], Google Scholar30https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXisVans77N&md5=87a8c8ad656a86eaf52e299902476631Probing molecular insights into zika virus-host interactionsLee, Ina; Bos, Sandra; Li, Ge; Wang, Shusheng; Gadea, Gilles; Despres, Philippe; Zhao, Richard Y.Viruses (2018), 10 (5), 233/1-233/26CODEN: VIRUBR; ISSN:1999-4915. (MDPI AG)The recent Zika virus (ZIKV) outbreak in the Americas surprised all of us because of its rapid spread and assocn. with neurol. disorders including fetal microcephaly, brain and ocular anomalies, and Guillain-Barr´e syndrome. In response to this global health crisis, unprecedented and world-wide efforts are taking place to study the ZIKV-related human diseases. Much has been learned about this virus in the areas of epidemiol., genetic diversity, protein structures, and clin. manifestations, such as consequences of ZIKV infection on fetal brain development. However, progress on understanding the mol. mechanism underlying ZIKV-assocd. neurol. disorders remains elusive. To date, we still lack a good understanding of; (1) what virol. factors are involved in the ZIKV-assocd. human diseases; (2) which ZIKV protein(s) contributes to the enhanced viral pathogenicity; and (3) how do the newly adapted and pandemic ZIKV strains alter their interactions with the host cells leading to neurol. defects. The goal of this review is to explore the mol. insights into the ZIKV-host interactions with an emphasis on host cell receptor usage for viral entry, cell innate immunity to ZIKV, and the ability of ZIKV to subvert antiviral responses and to cause cytopathic effects. We hope this literature review will inspire addnl. mol. studies focusing on ZIKV-host Interactions.
- 31Mukherjee, S.; Huda, S.; Sinha Babu, S. P. Toll-like Receptor Polymorphism in Host Immune Response to Infectious Diseases: A Review. Scand. J. Immunol. 2019, 90 (1), e12771, DOI: 10.1111/sji.12771
- 32Gambuzza, M. E.; Soraci, L.; Sofo, V. A New Era for Immunotherapeutic Approaches in Multiple Sclerosis Treatment. J. Clin. Trials 2016, 6 (1), 10– 12, DOI: 10.4172/2167-0870.1000253
- 33Piret, J.; Boivin, G. Innate Immune Response during Herpes Simplex Virus Encephalitis and Development of Immunomodulatory Strategies. Rev. Med. Virol. 2015, 25 (5), 300– 319, DOI: 10.1002/rmv.1848[Crossref], [PubMed], [CAS], Google Scholar33https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC28%252FlvFSrsQ%253D%253D&md5=11a809d40c0f11ab9d9bda51ab6e74fdInnate immune response during herpes simplex virus encephalitis and development of immunomodulatory strategiesPiret Jocelyne; Boivin GuyReviews in medical virology (2015), 25 (5), 300-19 ISSN:.Herpes simplex viruses are large double-stranded DNA viruses. These viruses have the ability to establish a lifelong latency in sensory ganglia and to invade and replicate in the CNS. Apart from relatively benign mucosal infections, HSV is responsible for severe illnesses including HSV encephalitis (HSE). HSE is the most common cause of sporadic, potentially fatal viral encephalitis in Western countries. If left untreated, the mortality rate associated with HSE is approximately 70%. Despite antiviral therapy, the mortality is still higher than 30%, and almost 60% of surviving individuals develop neurological sequelae. It is suggested that direct virus-related and indirect immune-mediated mechanisms contribute to the damages occurring in the CNS during HSE. In this manuscript, we describe the innate immune response to HSV, the development of HSE in mice knock-out for proteins of the innate immune system as well as inherited deficiencies in key components of the signaling pathways involved in the production of type I interferon that could predispose individuals to develop HSE. Finally, we review several immunomodulatory strategies aimed at modulating the innate immune response at a critical time after infection that were evaluated in mouse models and could be combined with antiviral therapy to improve the prognosis of HSE. In conclusion, the cerebral innate immune response that develops during HSE is a "double-edged sword" as it is critical to control viral replication in the brain early after infection, but, if left uncontrolled, may also result in an exaggerated inflammatory response that could be detrimental to the host.
- 34Mousavi, T.; Sattari Saravi, S.; Valadan, R.; Haghshenas, M. R.; Rafiei, A.; Jafarpour, H.; Shamshirian, A. Different Types of Adjuvants in Prophylactic and Therapeutic Human Papillomavirus Vaccines in Laboratory Animals: A Systematic Review. Arch. Virol. 2020, 165 (2), 263– 284, DOI: 10.1007/s00705-019-04479-4[Crossref], [PubMed], [CAS], Google Scholar34https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXitlSqurfF&md5=0b175fa571ae07fb84249d0f58d1e7aeDifferent types of adjuvants in prophylactic and therapeutic human papillomavirus vaccines in laboratory animals: a systematic reviewMousavi, Tahoora; Sattari Saravi, Sogol; Valadan, Reza; Haghshenas, Mohammad Reza; Rafiei, Alireza; Jafarpour, Hamed; Shamshirian, AmirArchives of Virology (2020), 165 (2), 263-284CODEN: ARVIDF; ISSN:0304-8608. (Springer-Verlag GmbH)A review. Human papillomavirus (HPV) causes cervical carcinoma, which and is the third most common cancer, accounting for 275,000 deaths annually worldwide. Adjuvants have a key role in promotion of vaccine efficacy; therefore, using prophylactic and therapeutic vaccines combined with adjuvant could be of great benefit in prevention and treatment of cervical cancer. There are different types of adjuvants, including MF59TM adjuvants, RNA-based, JY (interleukin2/chitosan), cholera toxin (CT), heat-labile enterotoxin (LT), Freund's adjuvant, alum, SA-4-1BBL, λ-carrageenan (λ-CGN), heat shock proteins (HSPs), juzen-taiho-to (JTT) and hochu-ekki-to (HET), ISCOM and ISCOMATRIX, very small size proteoliposomes (VSSPs), granulocyte macrophage colony-stimulating factor (GM-CSF), and Toll-like receptors (TLRs). Adjuvants have various functions, esp. in therapeutic vaccines, and they lead to an increase in cytotoxic T lymphocytes (CTLs), so they are important in the design of vaccines. Here, we review the currently used adjuvants and their combinations with HPV protein vaccines in order to introduce an appropriate adjuvant for HPV vaccines.
- 35Bardel, E.; Doucet-Ladeveze, R.; Mathieu, C.; Harandi, A. M.; Dubois, B.; Kaiserlian, D. Intradermal Immunisation Using the TLR3-Ligand Poly (I:C) as Adjuvant Induces Mucosal Antibody Responses and Protects against Genital HSV-2 Infection. npj Vaccines 2016, 1, 16010, DOI: 10.1038/npjvaccines.2016.10[Crossref], [PubMed], [CAS], Google Scholar35https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC1MzjslGmsw%253D%253D&md5=9331c7ac99ae98f55135fe9498565123Intradermal immunisation using the TLR3-ligand Poly (I:C) as adjuvant induces mucosal antibody responses and protects against genital HSV-2 infectionBardel Emilie; Doucet-Ladeveze Remi; Dubois Bertrand; Kaiserlian Dominique; Mathieu Cyrille; Harandi Ali MNPJ vaccines (2016), 1 (), 16010 ISSN:2059-0105.Development of vaccines able to induce mucosal immunity in the genital and gastrointestinal tracts is a major challenge to counter sexually transmitted pathogens such as HIV-1 and HSV-2. Herein, we showed that intradermal (ID) immunisation with sub-unit vaccine antigens (i.e., HIV-1 gp140 and HSV-2 gD) delivered with Poly(I:C) or CpG1668 as adjuvant induces long-lasting virus-specific immunoglobulin (Ig)-G and IgA antibodies in the vagina and feces. Poly(I:C)-supplemented sub-unit viral vaccines caused minimal skin reactogenicity at variance to those containing CpG1668, promoted a delayed-type hypersensitivity (DTH) to the vaccine and protected mice from genital and neurological symptoms after a lethal vaginal HSV-2 challenge. Interestingly, Poly(I:C12U) (Ampligen), a Poly(I:C) structural analogue that binds to TLR3 but not MDA-5, promoted robust mucosal and systemic IgG antibodies, a weak skin DTH to the vaccine but not IgA responses and failed to confer protection against HSV-2 infection. Moreover, Poly(I:C) was far superior to Poly(I:C12U) at inducing prompt and robust upregulation of IFNss transcripts in lymph nodes draining the injection site. These data illustrate that ID vaccination with glycoproteins and Poly(I:C) as adjuvant promotes long-lasting mucosal immunity and protection from genital HSV-2 infection, with an acceptable skin reactogenicity profile. The ID route thus appears to be an unexpected inductive site for mucosal immunity and anti-viral protection suitable for sub-unit vaccines. This works further highlights that TLR3/MDA5 agonists such as Poly(I:C) may be valuable adjuvants for ID vaccination against sexually transmitted diseases.
- 36Saxena, M.; Sabado, R. L.; La Mar, M.; Mohri, H.; Salazar, A. M.; Dong, H.; Correa Da Rosa, J.; Markowitz, M.; Bhardwaj, N.; Miller, E. Poly-ICLC, a TLR3 Agonist, Induces Transient Innate Immune Responses in Patients with Treated HIV-Infection: A Randomized Double-Blinded Placebo Controlled Trial. Front. Immunol. 2019, 10, 725, DOI: 10.3389/fimmu.2019.00725[Crossref], [PubMed], [CAS], Google Scholar36https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhsVSgtLrM&md5=4ac5028745bf43314f50a5c58c205ed0Poly-ICLC, a TLR3 agonist, induces transient innate immune responses in patients with treated HIV-infection: a randomized double-blinded placebo controlled trialSaxena, Mansi; Sabado, Rachel L.; Mar, Melissa La; Mohri, Hiroshi; Salazar, Andres M.; Dong, Hanqing; Da Rosa, Joel Correa; Markowitz, Martin; Bhardwaj, Nina; Miller, ElizabethFrontiers in Immunology (2019), 10 (), 725CODEN: FIRMCW; ISSN:1664-3224. (Frontiers Media S.A.)Objective: Toll-like receptor-3 agonist Poly-ICLC has been known to activate immune cells and induce HIV replication in pre-clin. expts. In this study we investigated if Poly-ICLC could be used for disrupting HIV latency while simultaneously enhancing innate immune responses. Design: This was a randomized, placebo-controlled, double-blinded trial in aviremic, cART-treated HIV-infected subjects. Participants (n = 15) were randomized 3:1 to receive two consecutive daily doses of Poly-ICLC (1.4 mg s.c.) vs. placebo. Subjects were obsd. for adverse events, immune activation, and viral replication. Methods: Besides primary outcomes of safety and tolerability, several longitudinal immune parameters were evaluated including immune cell phenotype and function via flowcytometry, ELISA, and transcriptional profiling. PCR assays for plasma HIV-1 RNA, CD4+ T cell-assocd. HIV-1 RNA, and proviral DNA were performed to measure HIV reservoirs and latency. Results: Poly-ICLC was overall safe and well-tolerated. Poly-ICLC-related adverse events were Grade 1/2, with the exception of one Grade 3 neutropenia which was short-lived. Mild Injection site reactions were obsd. in nearly all participants in the Poly-ICLC arm. Transcriptional analyses revealed upregulation of innate immune pathways in PBMCs following Poly-ICLC treatment, including strong interferon signaling accompanied by transient increases in circulating IP-10 (CXCL10) levels. These responses generally peaked by 24-48 h after the first injection and returned to baseline by day 8. CD4+ T cell no. and phenotype were unchanged, plasma viral control was maintained and no significant effect on HIV reservoirs was obsd. Conclusions: These finding suggest that Poly-ICLC could be safely used for inducing transient innate immune responses in treated HIV+ subjects indicating promise as an adjuvant for HIV therapeutic vaccines.
- 37Zhang, Y.; Zhang, S.; Li, W.; Hu, Y.; Zhao, J.; Liu, F.; Lin, H.; Liu, Y.; Wang, L.; Xu, S.; Hu, R.; Shao, H.; Li, L. A Novel Rabies Vaccine Based-on Toll-like Receptor 3 (TLR3) Agonist PIKA Adjuvant Exhibiting Excellent Safety and Efficacy in Animal Studies. Virology 2016, 489, 165– 172, DOI: 10.1016/j.virol.2015.10.029[Crossref], [PubMed], [CAS], Google Scholar37https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXhvVSks7rM&md5=1b041a27c1b45ee7803885be36025877A novel rabies vaccine based-on toll-like receptor 3 (TLR3) agonist PIKA adjuvant exhibiting excellent safety and efficacy in animal studiesZhang, Yi; Zhang, Shoufeng; Li, Wei; Hu, Yuchi; Zhao, Jinyan; Liu, Fang; Lin, Haixiang; Liu, Yuan; Wang, Liliang; Xu, Shu; Hu, Rongliang; Shao, Hui; Li, LietaoVirology (2016), 489 (), 165-172CODEN: VIRLAX; ISSN:0042-6822. (Elsevier B.V.)Vaccination alone is not sufficiently effective to protect human from post-exposure rabies virus infection due to delayed generation of rabies virus neutralizing antibodies and weak cellular immunity. Therefore, it is vital to develop safer and more efficacious vaccine against rabies. PIKA, a stabilized chem. analog of double-stranded RNA that interacts with TLR3, was employed as adjuvant of rabies vaccine. The efficacy and safety of PIKA rabies vaccine were evaluated. The results showed that PIKA rabies vaccine enhanced both humoral and cellular immunity. After viral challenge, PIKA rabies vaccine protected 70-80% of animals, while the survival rate of non-adjuvant vaccine group (control) was 20-30%. According to the results of toxicity tests, PIKA and PIKA rabies vaccine are shown to be well tolerated in mice. Thus, this study indicates that PIKA rabies vaccine is an effective and safe vaccine which has the potential to develop next-generation rabies vaccine and encourage the start of clin. studies.
- 38Guo, F.; Mead, J.; Aliya, N.; Wang, L.; Cuconati, A.; Wei, L.; Li, K.; Block, T. M.; Guo, J. T.; Chang, J. RO 90–7501 Enhances TLR3 and RLR Agonist Induced Antiviral Response. PLoS One 2012, 7 (10), e42583, DOI: 10.1371/journal.pone.0042583[Crossref], [PubMed], [CAS], Google Scholar38https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC38XhsFWgsb%252FL&md5=eb7441f3bcd814c1f243ba36655c1649RO 90-7501 enhances TLR3 and RLR agonist induced antiviral responseGuo, Fang; Mead, Jennifer; Aliya, Nishat; Wang, Lijuan; Cuconati, Andrea; Wei, Lai; Li, Kui; Block, Timothy M.; Guo, Ju-Tao; Chang, JinhongPLoS One (2012), 7 (10), e42583CODEN: POLNCL; ISSN:1932-6203. (Public Library of Science)Recognition of virus infection by innate pattern recognition receptors (PRRs), including membrane-assocd. toll-like receptors (TLR) and cytoplasmic RIG-I-like receptors (RLR), activates cascades of signal transduction pathways leading to prodn. of type I interferons (IFN) and proinflammatory cytokines that orchestrate the elimination of the viruses. Although it has been demonstrated that PRR-mediated innate immunity plays an essential role in defending virus from infection, it also occasionally results in overwhelming prodn. of proinflammatory cytokines that cause severe inflammation, blood vessel leakage and tissue damage. In our efforts to identify small mols. that selectively enhance PRR-mediated antiviral, but not the detrimental inflammatory response, we discovered a compd., RO 90-7501 ('2'-(4-Aminophenyl)-[2,5'-bi-1H-benzimidazol]-5-amine),that significantly promoted both TLR3 and RLR ligand-induced IFN-β gene expression and antiviral response, most likely via selective activation of p38 mitogen-activated protein kinase (MAPK) pathway. Our results thus imply that pharmacol. modulation of PRR signal transduction pathways in favor of the induction of a beneficial antiviral response can be a novel therapeutic strategy.
- 39Peri, F.; Calabrese, V. Toll-like Receptor 4 (TLR4) Modulation by Synthetic and Natural Compounds: An Update. J. Med. Chem. 2014, 57 (9), 3612– 3622, DOI: 10.1021/jm401006s[ACS Full Text], [CAS], Google Scholar39https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXhslaksLnN&md5=dce69e6a3b1a44e148c14212ef82327bToll-like Receptor 4 (TLR4) Modulation by Synthetic and Natural Compounds: An UpdatePeri, Francesco; Calabrese, ValentinaJournal of Medicinal Chemistry (2014), 57 (9), 3612-3622CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)A review. Toll-like receptor 4 (TLR4), together with MD-2, binds bacterial endotoxins (E) with high affinity, triggering formation of the activated homodimer (E.MD-2.TLR4)2. Activated TLR4 induces intracellular signaling leading to activation of transcription factors that result in cytokine and chemokine prodn. and initiation of inflammatory and immune responses. TLR4 also responds to endogenous ligands called danger assocd. mol. patterns (DAMPs). Increased sensitivity to infection and a variety of immune pathologies have been assocd. with either too little or too much TLR4 activation. We review here the mol. mechanisms of TLR4 activation (agonism) or inhibition (antagonism) by small org. mols. of both natural and synthetic origin. The role of co-receptors MD-2 and CD14 in the TLR4 modulation process is also discussed. Recent achievements in the field of chem. TLR4 modulation are reviewed, with special focus on nonclassical TLR4 ligands with a chem. structure different from that of lipid A.
- 40Olejnik, J.; Hume, A. J.; Mühlberger, E. Toll-like Receptor 4 in Acute Viral Infection: Too Much of a Good Thing. PLoS Pathog. 2018, 14 (12), e1007390, DOI: 10.1371/journal.ppat.1007390[Crossref], [PubMed], [CAS], Google Scholar40https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXot1Kltrc%253D&md5=0d74a955c03336d9049a2182d695c216Toll-like receptor 4 in acute viral infection: Too much of a good thingOlejnik, Judith; Hume, Adam J.; Muehlberger, ElkePLoS Pathogens (2018), 14 (12), e1007390/1-e1007390/7CODEN: PPLACN; ISSN:1553-7374. (Public Library of Science)Although a well-regulated inflammatory response is a vital defense mechanism against viral infection, too much inflammation can be detrimental. Excessive inflammatory responses, which are characterized by elevated levels of a broad array of pro-inflammatory cytokines and chemokines, have been obsd. in a wide variety of viral diseases assocd. with serious morbidity and mortality. Examples of this include acute lung injury caused by infections with respiratory syncytial virus (RSV), influenza A virus (IAV), or severe acute respiratory syndrome coronavirus (SARS-CoV). Excessive inflammatory responses induced by viral infections are not restricted to the lung but can be systemic, as reported for Ebola virus (EBOV) disease and severe dengue. The reasons leading to an unbalanced inflammatory response in certain viral infections are not well understood and are most likely multifactorial. Here, we explore the role of toll-like receptor 4 (TLR4) in the induction of damaging inflammatory responses during acute viral infections.
- 41Abouelasrar Salama, S.; Lavie, M.; De Buck, M.; Van Damme, J.; Struyf, S. Cytokines and Serum Amyloid A in the Pathogenesis of Hepatitis C Virus Infection. Cytokine Growth Factor Rev. 2019, 50, 29– 42, DOI: 10.1016/j.cytogfr.2019.10.006[Crossref], [PubMed], [CAS], Google Scholar41https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXitFGju7fL&md5=911a040e23c4e7760818661030fc77b9Cytokines and serum amyloid A in the pathogenesis of hepatitis C virus infectionAbouelasrar Salama, Sara; Lavie, Muriel; De Buck, Mieke; Van Damme, Jo; Struyf, SofieCytokine & Growth Factor Reviews (2019), 50 (), 29-42CODEN: CGFRFB; ISSN:1359-6101. (Elsevier Ltd.)A review. Expression of the acute phase protein serum amyloid A (SAA) is dependent on the release of the pro-inflammatory cytokines IL-1, IL-6 and TNF-α during infection and inflammation. Hepatitis C virus (HCV) upregulates SAA-inducing cytokines. In line with this, a segment of chronically infected individuals display increased circulating levels of SAA. SAA has even been proposed to be a potential biomarker to evaluate treatment efficiency and the course of disease. SAA possesses antiviral activity against HCV via direct interaction with the viral particle, but might also divert infectivity through its function as an apolipoprotein. On the other hand, SAA shares inflammatory and angiogenic activity with chemotactic cytokines by activating the G protein-coupled receptor, formyl peptide receptor 2. These latter properties might promote chronic inflammation and hepatic injury. Indeed, up to 80 % of infected individuals develop chronic disease because they cannot completely clear the infection, due to diversion of the immune response. In this review, we summarize the interconnection between SAA and cytokines in the context of HCV infection and highlight the dual role SAA could play in this disease. Nevertheless, more research is needed to establish whether the balance between those opposing activities can be tilted in favor of the host defense.
- 42Hendrickx, R.; Stichling, N.; Koelen, J.; Kuryk, L.; Lipiec, A.; Greber, U. F. Innate Immunity to Adenovirus. Hum. Gene Ther. 2014, 25 (4), 265– 284, DOI: 10.1089/hum.2014.001[Crossref], [PubMed], [CAS], Google Scholar42https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXmsFWlsbc%253D&md5=0e6742432ac612b0c347ecd7a5bff19bInnate Immunity to AdenovirusHendrickx, Rodinde; Stichling, Nicole; Koelen, Jorien; Kuryk, Lukasz; Lipiec, Agnieszka; Greber, Urs F.Human Gene Therapy (2014), 25 (4), 265-284CODEN: HGTHE3; ISSN:1043-0342. (Mary Ann Liebert, Inc.)A review. Human adenoviruses are the most widely used vectors in gene medicine, with applications ranging from oncolytic therapies to vaccinations, but adenovirus vectors are not without side effects. In addn., natural adenoviruses pose severe risks for immunocompromised people, yet infections are usually mild and self-limiting in immunocompetent individuals. Here we describe how adenoviruses are recognized by the host innate defense system during entry and replication in immune and nonimmune cells. Innate defense protects the host and represents a major barrier to using adenoviruses as therapeutic interventions in humans. Innate response against adenoviruses involves intrinsic factors present at const. levels, and innate factors mounted by the host cell upon viral challenge. These factors exert antiviral effects by directly binding to viruses or viral components, or shield the virus, for example, sol. factors, such as blood clotting components, the complement system, preexisting Igs, or defensins. In addn., Toll-like receptors and lectins in the plasma membrane and endosomes are intrinsic factors against adenoviruses. Important innate factors restricting adenovirus in the cytosol are tripartite motif-contg. proteins, nucleotide-binding oligomerization domain-like inflammatory receptors, and DNA sensors triggering interferon, such as DEAD (Asp-Glu-Ala-Asp) box polypeptide 41 and cyclic guanosine monophosphate-adenosine monophosphate synthase. Adenovirus tunes the function of antiviral autophagy, and counters innate defense by virtue of its early proteins E1A, E1B, E3, and E4 and two virus-assocd. noncoding RNAs VA-I and VA-II. We conclude by discussing strategies to engineer adenovirus vectors with attenuated innate responses and enhanced delivery features.
- 43Chen, K. R.; Ling, P. Interplays between Enterovirus A71 and the Innate Immune System. J. Biomed. Sci. 2019, 26 (1), 95, DOI: 10.1186/s12929-019-0596-8[Crossref], [PubMed], [CAS], Google Scholar43https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXisVykt7vI&md5=ac7abae9b0b4579ce63bc17b72b429e9Interplays between Enterovirus A71 and the innate immune systemChen, Kuan-Ru; Ling, PinJournal of Biomedical Science (London, United Kingdom) (2019), 26 (1), 95CODEN: JBCIEA; ISSN:1423-0127. (BioMed Central Ltd.)A review. Enterovirus A71 (EV-A71) is a growing threat to public health, particularly in the Asia-Pacific region. EV-A71 infection is most prevalent in infants and children and causes a wide spectrum of clin. complications, including hand-foot-and-mouth disease (HFMD), pulmonary and neurol. disorders. The pathogenesis of EV-A71 infection is poorly understood at present. It is likely that viral factors and host immunity, and their interplay, affect the pathogenesis and outcome of EV-A71 infection. The mammalian innate immune system forms the first layer of defense against viral infections and triggers activation of adaptive immunity leading to full protection. In this review, we discuss recent advances in our understanding of the interaction between EV-A71 and the innate immune system. We discuss the role of pattern-recognition receptors (PRRs), including Toll-like receptors (TLRs), RIG-I-like receptors (RLRs), and inflammasomes, in the detection of EV-A71 infection and induction of antiviral immunity. As a counteraction, EV-A71 viral proteins target multiple innate immune pathways to facilitate viral replication in host cells. These novel insights at the virus-host interphase may support the future development of vaccines and therapeutics against EV-A71 infection.
- 44Bahramabadi, R.; Dabiri, S.; Iranpour, M.; Kazemi Arababadi, M. TLR4: An Important Molecule Participating in Either Anti-Human Papillomavirus Immune Responses or Development of Its Related Cancers. Viral Immunol. 2019, 32 (10), 417– 423, DOI: 10.1089/vim.2019.0061[Crossref], [PubMed], [CAS], Google Scholar44https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXitlGitrzJ&md5=78dd525ce44091f80d2d3cf74031f8cdTLR4: An Important Molecule Participating in Either Anti-Human Papillomavirus Immune Responses or Development of Its Related CancersBahramabadi, Reza; Dabiri, Shahriar; Iranpour, Maryam; Arabadadi, Mohammed KazemiViral Immunology (2019), 32 (10), 417-423CODEN: VIIMET; ISSN:0882-8245. (Mary Ann Liebert, Inc.)A review. It has been reported that human papillomavirus (HPV) is a main cause of cervical cancer. Immune system plays key roles in the HPV infection clearance. Addnl., the roles played by immune responses in development of cancers have been documented previously. Toll-like receptors (TLRs) are the main surface or intravesicular receptors driving innate immunity, which either participate in the fight against infectious agents or participate in the progression of cancers. Thus, it has been hypothesized that the mols. may be part of the HPV/cancers puzzle. TLR4 is a unique member of TLRs family that uses both well-known TLRs related intracellular signaling pathways. Furthermore, the roles played by TLR4 against several viruses and also their related complications, such as tumors, have been demonstrated. Thus, it has been hypothesized that TLR4 may play a key role in HPV infection and its related complications. This review article collected the information regarding the mentioned plausible roles by TLR4.
- 45Tantawy, E. A.; El-Beyali, A. A.; Gohar, M. K.; Ibrahim, Z. S.; Nasr, M.; Marei, A. Association of TLR2 and TLR4 Gene Polymorphism with Susceptibility to Wart Infections and Their Response to Candida Antigen Immunotherapy. J. Dermatol. Treat. 2020, DOI: 10.1080/09546634.2020.1732285
- 46Vasou, A.; Sultanoglu, N.; Goodbourn, S.; Randall, R. E.; Kostrikis, L. G. Targeting Pattern Recognition Receptors (PRR) for Vaccine Adjuvantation: From Synthetic PRR Agonists to the Potential of Defective Interfering Particles of Viruses. Viruses 2017, 9 (7), 186, DOI: 10.3390/v9070186[Crossref], [CAS], Google Scholar46https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXitVGgtbnK&md5=7a0f9fd39055af691cbac5a7bf126ba2Targeting pattern recognition receptors (PRR) for vaccine adjuvantation: from synthetic PRR agonists to the potential of defective interfering particles of virusesVasou, Andri; Sultanoglu, Nazife; Goodbourn, Stephen; Randall, Richard E.; Kostrikis, Leondios G.Viruses (2017), 9 (7), 186/1-186/17CODEN: VIRUBR; ISSN:1999-4915. (MDPI AG)Modern vaccinol. has increasingly focused on non-living vaccines, which are more stable than live-attenuated vaccines but often show limited immunogenicity. Immunostimulatory substances, known as adjuvants, are traditionally used to increase the magnitude of protective adaptive immunity in response to a pathogen-assocd. antigen. Recently developed adjuvants often include substances that stimulate pattern recognition receptors (PRRs), essential components of innate immunity required for the activation of antigen-presenting cells (APCs), which serve as a bridge between innate and adaptive immunity. Nearly all PRRs are potential targets for adjuvants. Given the recent success of toll-like receptor (TLR) agonists in vaccine development, mols. with similar, but addnl., immunostimulatory activity, such as defective interfering particles (DIPs) of viruses, represent attractive candidates for vaccine adjuvants. This review outlines some of the recent advances in vaccine development related to the use of TLR agonists, summarizes the current knowledge regarding DIP immunogenicity, and discusses the potential applications of DIPs in vaccine adjuvantation.
- 47Chan, M.; Hayashi, T.; Mathewson, R. D.; Nour, A.; Hayashi, Y.; Yao, S.; Tawatao, R. I.; Crain, B.; Tsigelny, I. F.; Kouznetsova, V. L.; Messer, K.; Pu, M.; Corr, M.; Carson, D. A.; Cottam, H. B. Identification of Substituted Pyrimido[5,4-b]Indoles as Selective Toll-like Receptor 4 Ligands. J. Med. Chem. 2013, 56 (11), 4206– 4223, DOI: 10.1021/jm301694x[ACS Full Text], [CAS], Google Scholar47https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXnsVWisrc%253D&md5=2364a43919b69819783b22c8fe9ab247Identification of Substituted Pyrimido[5,4-b]indoles as Selective Toll-Like Receptor 4 LigandsChan, Michael; Hayashi, Tomoko; Mathewson, Richard D.; Nour, Afshin; Hayashi, Yuki; Yao, Shiyin; Tawatao, Rommel I.; Crain, Brian; Tsigelny, Igor F.; Kouznetsova, Valentina L.; Messer, Karen; Pu, Minya; Corr, Maripat; Carson, Dennis A.; Cottam, Howard B.Journal of Medicinal Chemistry (2013), 56 (11), 4206-4223CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)A cell-based high-throughput screen to identify small mol. wt. stimulators of the innate immune system revealed substituted pyrimido[5,4-b]indoles as potent NFκB activators. The most potent hit compd. selectively stimulated Toll-like receptor 4 (TLR4) in human and mouse cells. Synthetic modifications of the pyrimido[5,4-b]indole scaffold at the carboxamide, N-3, and N-5 positions revealed differential TLR4 dependent prodn. of NFκB and type I interferon assocd. cytokines, IL-6 and interferon γ-induced protein 10 (IP-10) resp. Specifically, a subset of compds. bearing Ph and substituted Ph carboxamides induced lower IL-6 release while maintaining higher IP-10 prodn., skewing toward the type I interferon pathway. Substitution at N-5 with short alkyl substituents reduced the cytotoxicity of the leading hit compd. Computational studies supported that active compds. appeared to bind primarily to MD-2 in the TLR4/MD-2 complex. These small mols., which stimulate innate immune cells with minimal toxicity, could potentially be used as adjuvants or immune modulators.
- 48Hayashi, T.; Crain, B.; Yao, S.; Caneda, C. D.; Cottam, H. B.; Chan, M.; Corr, M.; Carson, D. A. Novel Synthetic Toll-Like Receptor 4/MD2 Ligands Attenuate Sterile Inflammation. J. Pharmacol. Exp. Ther. 2014, 350 (2), 330– 340, DOI: 10.1124/jpet.114.214312[Crossref], [PubMed], [CAS], Google Scholar48https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXhs1WqsbzM&md5=160c06cb612fdd67c18e1f15ec8ea315Novel synthetic toll-like receptor 4/MD2 ligands attenuate sterile inflammationHayashi, Tomoko; Crain, Brian; Yao, Shiyin; Caneda, Christa D.; Cottam, Howard B.; Chan, Michael; Corr, Maripat; Carson, Dennis A.Journal of Pharmacology and Experimental Therapeutics (2014), 350 (2), 330-340, 11 pp.CODEN: JPETAB; ISSN:1521-0103. (American Society for Pharmacology and Experimental Therapeutics)Toll-like receptor (TLR) stimulation has been implicated as a major contributor to chronic inflammation. Among these receptors, TLR4 has been described as a key regulator of endogenous inflammation and has been proposed as a therapeutic target. Previously, we discovered by high-throughput screening a group of substituted pyrimido[5,4-b]indoles that activated a nuclear factor-κB reporter in THP-1 human monocytic cells. A biol. active hit compd. was resynthesized, and derivs. were prepd. to assess structure-activity relationships. The derived compds. activated cells in a TLR4/myeloid differentiation protein 2 (MD2)-dependent and CD14-independent manner, using the myeloid differentiation primary response 88 and Toll/IL-1 receptor domain-contg. adapter-inducing interferon-β pathways. Two lead compds., 1Z105 and 1Z88, were selected for further anal. based on favorable biol. properties and lack of toxicity. In vivo pharmacokinetics indicated that 1Z105 was orally bioavailable, whereas 1Z88 was not. Oral or parenteral doses of 1Z105 and 1Z88 induced undetectable or negligible levels of circulating cytokines and did not induce hepatotoxicity when administered to galactosamine-conditioned mice, indicating good safety profiles. Both compds. were very effective in preventing lethal liver damage in lipopolysaccharide treated galatosamine-conditioned mice. Orally administered 1Z105 and parenteral 1Z88 prevented arthritis in an autoantibody-driven murine model. Hence, these low mol. wt. mols. that target TLR4/MD2 were well tolerated and effective in reducing target organ damage in two different mouse models of sterile inflammation.
- 49Goff, P. H.; Hayashi, T.; Martínez-Gil, L.; Corr, M.; Crain, B.; Yao, S.; Cottam, H. B.; Chan, M.; Ramos, I.; Eggink, D.; Heshmati, M.; Krammer, F.; Messer, K.; Pu, M.; Fernandez-Sesma, A.; Palese, P.; Carson, D. A. Synthetic Toll-Like Receptor 4 (TLR4) and TLR7 Ligands as Influenza Virus Vaccine Adjuvants Induce Rapid, Sustained, and Broadly Protective Responses. J. Virol. 2015, 89 (6), 3221– 3235, DOI: 10.1128/JVI.03337-14[Crossref], [PubMed], [CAS], Google Scholar49https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXktF2ntbk%253D&md5=f10034ebe5385e0dd4a27e5384cd68dfSynthetic Toll-like receptor 4 (TLR4) and TLR7 ligands as influenza virus vaccine adjuvants induce rapid, tained, and broadly protective responsesGoff, Peter H.; Hayashi, Tomoko; Martinez-Gil, Luis; Corr, Maripat; Crain, Brian; Yao, Shiyin; Cottam, Howard B.; Chan, Michael; Ramos, Irene; Eggink, Dirk; Heshmati, Mitra; Krammer, Florian; Messer, Karen; Pu, Minya; Fernandez-Sesma, Ana; Palese, Peter; Carson, Dennis A.Journal of Virology (2015), 89 (6), 3221-3235CODEN: JOVIAM; ISSN:1098-5514. (American Society for Microbiology)Current vaccines against influenza virus infection rely on the induction of neutralizing antibodies targeting the globular head of the viral hemagglutinin (HA). Protection against seasonal antigenic drift or sporadic pandemic outbreaks requires further vaccine development to induce cross-protective humoral responses, potentially to the more conserved HA stalk region. Here, we present a novel viral vaccine adjuvant comprised of two synthetic ligands for Toll-like receptor 4 (TLR4) and TLR7. 1Z105 is a substituted pyrimido[5,4-b]indole specific for the TLR4-MD2 complex, and 1V270 is a phospholipid-conjugated TLR7 agonist. Sep., 1Z105 induces rapid Th2-assocd. IgG1 responses, and 1V270 potently generates Th1 cellular immunity. 1Z105 and 1V270 in combination with recombinant HA from the A/Puerto Rico/8/1934 strain (rPR/8 HA) effectively induces rapid and sustained humoral immunity that is protective against lethal challenge with a homologous virus. More importantly, immunization with the combined adjuvant and rPR/8 HA, a com. available split vaccine, or chimeric rHA antigens significantly improves protection against both heterologous and heterosubtypic challenge viruses. Heterosubtypic protection is assocd. with broadly reactive antibodies to HA stalk epitopes. Histol. examn. and cytokine profiling reveal that i.m. (i.m.) administration of 1Z105 and 1V270 is less reactogenic than a squalene-based adjuvant, AddaVax. In summary, the combination of 1Z105 and 1V270 with a recombinant HA induces rapid, long-lasting, and balanced Th1- and Th2-type immunity; demonstrates efficacy in a variety of murine influenza virus vaccine models assaying homologous, heterologous, and heterosubtypic challenge viruses; and has an excellent safety profile.
- 50Rodríguez-Valentín, M.; López, S.; Rivera, M.; Ríos-Olivares, E.; Cubano, L.; Boukli, N. M. Naturally Derived Anti-HIV Polysaccharide Peptide (PSP) Triggers a Toll-like Receptor 4-Dependent Antiviral Immune Response. J. Immunol. Res. 2018, 2018, 8741698, DOI: 10.1155/2018/8741698[Crossref], [PubMed], [CAS], Google Scholar50https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB3c7ptVSiug%253D%253D&md5=f76b0cbf8fd61b6e7abf80f3319d24eeNaturally Derived Anti-HIV Polysaccharide Peptide (PSP) Triggers a Toll-Like Receptor 4-Dependent Antiviral Immune ResponseRodriguez-Valentin Madeline; Lopez Sheila; Rivera Mariela; Rios-Olivares Eddy; Cubano Luis; Boukli Nawal MJournal of immunology research (2018), 2018 (), 8741698 ISSN:.Aim: Intense interest remains in the identification of compounds to reduce human immunodeficiency virus type 1 (HIV-1) replication. Coriolus versicolor's polysaccharide peptide (PSP) has been demonstrated to possess immunomodulatory properties with the ability to activate an innate immune response through Toll-like receptor 4 (TLR4) showing insignificant toxicity. This study sought to determine the potential use of PSP as an anti-HIV agent and whether its antiviral immune response was TLR4 dependent. Materials and Methods: HIV-1 p24 and anti-HIV chemokine release was assessed in HIV-positive (HIV+) THP1 cells and validated in HIV+ peripheral blood mononuclear cells (PBMCs), to determine PSP antiviral activity. The involvement of TLR4 activation in PSP anti-HIV activity was evaluated by inhibition. Results: PSP showed a promising potential as an anti-HIV agent, by downregulating viral replication and promoting the upregulation of specific antiviral chemokines (RANTES, MIP-1α/β, and SDF-1α) known to block HIV-1 coreceptors in THP1 cells and human PBMCs. PSP produced a 61% viral inhibition after PSP treatment in HIV-1-infected THP1 cells. Additionally, PSP upregulated the expression of TLR4 and TLR4 inhibition led to countereffects in chemokine expression and HIV-1 replication. Conclusion: Taken together, these findings put forward the first evidence that PSP exerts an anti-HIV activity mediated by TLR4 and key antiviral chemokines. Elucidating these new molecular mediators may reveal additional drug targets and open novel therapeutic avenues for HIV-1 infection.
- 51Li, M.; Jiang, Y.; Gong, T.; Zhang, Z.; Sun, X. Intranasal Vaccination against HIV-1 with Adenoviral Vector-Based Nanocomplex Using Synthetic TLR-4 Agonist Peptide as Adjuvant. Mol. Pharmaceutics 2016, 13 (3), 885– 894, DOI: 10.1021/acs.molpharmaceut.5b00802[ACS Full Text], [CAS], Google Scholar51https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28Xhs1Whurg%253D&md5=79e0b45edab946a33568e073313b5611Intranasal Vaccination against HIV-1 with Adenoviral Vector-Based Nanocomplex Using Synthetic TLR-4 Agonist Peptide as AdjuvantLi, Man; Jiang, Yuhong; Gong, Tao; Zhang, Zhirong; Sun, XunMolecular Pharmaceutics (2016), 13 (3), 885-894CODEN: MPOHBP; ISSN:1543-8384. (American Chemical Society)Recombinant type 5 adenovirus (rAd5) vaccines hold the promise to prevent HIV-1 infections. Intranasal vaccination not only stimulates systemic immunity but also elicits mucosal immunity that provides first defense for mucosally transmitted diseases like HIV-1. Adjuvants such as TLR agonists are usually codelivered with antigens to enhance the immunogenicity of vaccines. Here, we present a rAd5 vaccine delivery system using DEG-PEI as the carrier. Adenovirus encoding HIV gag was used as antigen, and was complexed with DEG-PEI polymer via electrostatic interaction. A novel synthetic TLR-4 agonist, RS09, was either chem. linked with DEG-PEI (DP-RS09) or phys. mixed with it(DP/RS09) to enhance the immunogenticity of rAd5 vaccine. After intranasal immunization, the systemic antigen-specific immune responses and cytotoxicity T lymphocytes responses induced by DP-RS09-rAd5 and DP/RS09-rAd5 were analyzed. The mucosal secretory IgA level was detected in both nasal and vaginal washes to det. the mucosal immunity. Furthermore, cytokine productions on RAW264.7 cells were tested after preincubation with TLR-4 pathway inhibitors. The results indicated that DEG-PEI could facilitate the intranasal delivery of rAd5 vaccine. Both chem. linked (DP-RS09) and phys. mixed RS09 (DP/RS09) could further enhance the mucosal immunity of rAd5 vaccine via TLR-4 pathway. This RS09 adjuvanted DEG-PEI polymer represents a potential intranasal vaccine delivery system and may have a wider application for other viral vectors.
- 52Abdul-Careem, M. F.; Firoz Mian, M.; Gillgrass, A. E.; Chenoweth, M. J.; Barra, N. G.; Chan, T.; Al-Garawi, A. A.; Chew, M. V.; Yue, G.; van Roojen, N.; Xing, Z.; Ashkar, A. A. FimH, a TLR4 Ligand, Induces Innate Antiviral Responses in the Lung Leading to Protection against Lethal Influenza Infection in Mice. Antiviral Res. 2011, 92 (2), 346– 355, DOI: 10.1016/j.antiviral.2011.09.004[Crossref], [PubMed], [CAS], Google Scholar52https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3MXhtlKku7vI&md5=707285d97e31862f6eed1078e6cfa65bFimH, a TLR4 ligand, induces innate antiviral responses in the lung leading to protection against lethal influenza infection in miceAbdul-Careem, Mohamed F.; Mian, M. Firoz; Gillgrass, Amy E.; Chenoweth, Meghan J.; Barra, Nicole G.; Chan, Tiffany; Al-Garawi, Amal A.; Chew, Marianne V.; Yue, Geoffry; van Roojen, Nico; Xing, Zhou; Ashkar, Ali A.Antiviral Research (2011), 92 (2), 346-355CODEN: ARSRDR; ISSN:0166-3542. (Elsevier B.V.)Fimbriae H protein (FimH) is a novel TLR4 ligand that has been shown to stimulate the innate immune system and elicits protective responses against bacterial and viral infections. Here, we evaluated the protective role of local delivery of FimH against influenza A infection in a mouse model. We show that intranasal delivery of FimH prior to lethal challenge with influenza A virus, resulted in decreased morbidity and mortality in wild-type, but not TLR4-/-, mice. Importantly, FimH was able to reduce the early viral burden in the lung leading to minimal cell infiltration into the airway lumen and reduced pulmonary pathol. following infection in wild type mice compared to TLR4-/- mice. Local delivery of FimH to C57BL/6, not TLR4-/-, mice in a prophylactic manner increased the IL-12 and RANTES responses as well as neutrophil recruitment into the airway lumen. These effects correlate to the course of influenza infection. The FimH-mediated antiviral response against influenza virus appears to be partially dependent on alveolar macrophages. The antiviral effects are likely mediated by the innate mediators (TNF-α, IL-12 or RANTES) and/or by activation of a feedback inhibition loop to curtail the pulmonary inflammation possibly be the potential mechanisms involved in FimH-mediated protection. FimH thus holds promise to be a possible prophylactic mean of control against influenza viral infection.
- 53Fan, X.; Yue, Y.; Xiong, S. Incorporation of a Bi-Functional Protein FimH Enhances the Immunoprotection of Chitosan-PVP1 Vaccine against Coxsackievirus B3-Induced Myocarditis. Antiviral Res. 2017, 140, 121– 132, DOI: 10.1016/j.antiviral.2017.01.020[Crossref], [PubMed], [CAS], Google Scholar53https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXit1Chtbs%253D&md5=96e7ed787ed1af2b50029e06f338ae69Incorporation of a bi-functional protein FimH enhances the immunoprotection of chitosan-pVP1 vaccine against coxsackievirus B3-induced myocarditisFan, Xiangmei; Yue, Yan; Xiong, SidongAntiviral Research (2017), 140 (), 121-132CODEN: ARSRDR; ISSN:0166-3542. (Elsevier B.V.)Viral myocarditis is a common clin. cardiovascular disease mainly induced by coxsackievirus B3 (CVB3) with no effective therapeutic measures. Induction of efficient mucosal immune responses is very crit. against CVB3-induced myocarditis. FimH is an Escherichia coli (E. coli)-derived protein, which possesses an M cell-targeting property and functions as a TLR4 agonist. In this study, we introduced the recombinant FimH protein, into our previously developed CVB3 mucosal vaccine chitosan (CS)-pVP1, aiming to provoke more efficient mucosal immune responses and immunoprotection against CVB3-induced myocarditis. Compared with the CS-pVP1 vaccine, immunization with FimH-CS-pVP1 remarkably increased the levels and neutralizing titers of CVB3-specific protective secretory IgA (sIgA), enhanced the frequency of CVB3-specific IgA-producing B cells and amplified mucosal T-cell immune responses in mesenteric lymph nodes (MLNs), although failing to significantly amplify CVB3-specific systemic immune responses. Consistently, FimH-CS-pVP1 group showed the enhanced immunoprotection against CVB3-induced myocarditis, evidenced by the indexes of limited myocardial injury, reduced viral loads and enhanced survival rate. Further study showed that this enhanced immunoprotection was not only ascribed to its M cell-targeting property, which led to the enhanced mucosal antigen VP1 expression, but also assocd. with the mucosal adjuvant effect of FimH, which facilitated the formation of germinal centers (GCs), prodn. of IgA-inducing factors and maturation of antigen-presenting cells (APCs). Taken together, here we developed a bi-functional mucosal vaccine FimH-CS-pVP1, which simultaneously possessed the M cell-targeting property and mucosal adjuvant ability, and we showed that FimH-CS-pVP1 could efficiently induce the higher levels of CVB3-specific protective mucosal immune responses and provide better prophylactic effects against CVB3-induced myocarditis than CS-pVP1.
- 54Salyer, A. C. D.; Caruso, G.; Khetani, K. K.; Fox, L. M.; Malladi, S. S.; David, S. A. Identification of Adjuvantic Activity of Amphotericin B in a Novel, Multiplexed, Poly-TLR/NLR High-Throughput Screen. PLoS One 2016, 11 (2), e0149848, DOI: 10.1371/journal.pone.0149848[Crossref], [PubMed], [CAS], Google Scholar54https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XhsV2nsbrP&md5=a1601245369c4a21ede172c55dd61e9dIdentification of adjuvantic activity of amphotericin B in a novel, multiplexed, poly-TLR/NLR high-throughput screenSalyer, Alex C. D.; Caruso, Giuseppe; Khetani, Karishma K.; Fox, Lauren M.; Malladi, Subbalakshmi S.; David, Sunil A.PLoS One (2016), 11 (2), e0149848/1-e0149848/17CODEN: POLNCL; ISSN:1932-6203. (Public Library of Science)Small-mol. agonists have been identified for TLR7, TLR8, TLR4 and TLR2 thus far, and chemotypes other than those of canonical ligands are yet to be explored for a no. of innate immune receptors. The discovery of novel immunostimulatory mols. would enhance the repertoire of tools available for interrogating innate immune effector mechanisms, and provide addnl. venues for vaccine adjuvant development. A multiplexed, reporter gene-based high-throughput assay capable of detecting agonists of TLR2, TLR3, TLR4, TLR5, TLR7, TLR8, TLR9, NOD1 and NOD2 was utilized in screening 123,943 compds., in which amphotericin B (AmpB) and nystatin were identified as prominent hits. The polyene antifungal agents act as TLR2- and TLR4-agonists. The TLR4-stimulatory activity of AmpB was similar to that of monophosphoryl lipid A, suggestive of TRIF-biased signaling. The adjuvantic activity of AmpB, at a dose of 100 μg, was comparable to several other candidate adjuvants in rabbit models of immunization. These results point to its potential applicability as a safe and effective adjuvant for human vaccines.
- 55Shirey, K. A.; Lai, W.; Scott, A. J.; Lipsky, M.; Mistry, P.; Pletneva, L. M.; Karp, C. L.; McAlees, J.; Gioannini, T. L.; Weiss, J.; Chen, W. H.; Ernst, R. K.; Rossignol, D. P.; Gusovsky, F.; Blanco, J. C. G.; Vogel, S. N. The TLR4 Antagonist Eritoran Protects Mice from Lethal Influenza Infection. Nature 2013, 497 (7450), 498– 502, DOI: 10.1038/nature12118[Crossref], [PubMed], [CAS], Google Scholar55https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXmvFyhsLg%253D&md5=4dc373c1f51cfb3469c020a6448bff16The TLR4 antagonist Eritoran protects mice from lethal influenza infectionShirey, Kari Ann; Lai, Wendy; Scott, Alison J.; Lipsky, Michael; Mistry, Pragnesh; Pletneva, Lioubov M.; Karp, Christopher L.; McAlees, Jaclyn; Gioannini, Theresa L.; Weiss, Jerrold; Chen, Wilbur H.; Ernst, Robert K.; Rossignol, Daniel P.; Gusovsky, Fabian; Blanco, Jorge C. G.; Vogel, Stefanie N.Nature (London, United Kingdom) (2013), 497 (7450), 498-502CODEN: NATUAS; ISSN:0028-0836. (Nature Publishing Group)There is a pressing need to develop alternatives to annual influenza vaccines and antiviral agents licensed for mitigating influenza infection. Previous studies reported that acute lung injury caused by chem. or microbial insults is secondary to the generation of host-derived, oxidized phospholipid that potently stimulates Toll-like receptor 4 (TLR4)-dependent inflammation. Subsequently, we reported that Tlr4-/- mice are highly refractory to influenza-induced lethality, and proposed that therapeutic antagonism of TLR4 signaling would protect against influenza-induced acute lung injury. Here we report that therapeutic administration of Eritoran (also known as E5564)-a potent, well-tolerated, synthetic TLR4 antagonist-blocks influenza-induced lethality in mice, as well as lung pathol., clin. symptoms, cytokine and oxidized phospholipid expression, and decreases viral titers. CD14 and TLR2 are also required for Eritoran-mediated protection, and CD14 directly binds Eritoran and inhibits ligand binding to MD2. Thus, Eritoran blockade of TLR signaling represents a novel therapeutic approach for inflammation assocd. with influenza, and possibly other infections.
- 56Prantner, D.; Shirey, K. A.; Lai, W.; Lu, W.; Cole, A. M.; Vogel, S. N.; Garzino-Demo, A. The θ-Defensin Retrocyclin 101 Inhibits TLR4- and TLR2-Dependent Signaling and Protects Mice against Influenza Infection. J. Leukocyte Biol. 2017, 102 (4), 1103– 1113, DOI: 10.1189/jlb.2A1215-567RR[Crossref], [PubMed], [CAS], Google Scholar56https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXot1Gruw%253D%253D&md5=03911774d1745b51f3bbaab864d0d2a8The θ-defensin retrocyclin 101 inhibits TLR4-and TLR2-dependent signaling and protects mice against influenza infectionPrantner, Daniel; Shirey, Kari Ann; Lai, Wendy; Lu, Wuyuan; Cole, Alexander M.; Vogel, Stefanie N.; Garzino-Demo, AlfredoJournal of Leukocyte Biology (2017), 102 (4), 1103-1113CODEN: JLBIE7; ISSN:0741-5400. (Society for Leukocyte Biology)Despite widespread use of annual influenza vaccines, seasonal influenza-assocd. deaths no. in the thousands each year, in part because of exacerbating bacterial superinfections. Therefore, discovering addnl. therapeutic options would be a valuable aid to public health. Recently, TLR4 inhibition has emerged as a possible mechanism for protection against influenzaassocd. lethality and acute lung injury. Based on recent data showing that rhesus macaque θ-defensins could inhibit TLR4-dependent gene expression, we tested the hypothesis that a novel θ-defensin, retrocyclin (RC)-101, could disrupt TLR4-dependent signaling and protect against viral infection. In this study, RC-101, a variant of the humanized θ-defensin RC-1, blocked TLR4- mediated gene expression in mouse and human macrophages in response to LPS, targeting both MyD88- and TRIF-dependent pathways. In a cell-free assay, RC-101 neutralized the biol. activity of LPS at doses ranging from 0.5 to 50 EU/mL, consistent with data showing that RC-101 binds biotinylated LPS. The action of RC-101 was not limited to the TLR4 pathway because RC-101 treatment of macrophages also inhibited gene expression in response to a TLR2 agonist, Pam3CSK4, but failed to bind that biotinylated agonist. Cumulatively, our data demonstrate that RC-101 exhibits therapeutic potential for the mitigation of influenza-related morbidity and mortality, potentially acting through TLR-dependent and TLR-independent mechanisms.
- 57Hossain, M. S.; Ramachandiran, S.; Gewirtz, A. T.; Waller, E. K. Recombinant TLR5 Agonist CBLB502 Promotes NK Cell-Mediated Anti-CMV Immunity in Mice. PLoS One 2014, 9 (5), e96165, DOI: 10.1371/journal.pone.0096165[Crossref], [PubMed], [CAS], Google Scholar57https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXhsVKgs7rE&md5=a83381fc9c48a63aa3003412add0af6cRecombinant TLR5 agonist CBLB502 promotes NK cell-mediated anti-CMV immunity in miceHossain, Mohammad S.; Ramachandiran, Sampath; Gewirtz, Andrew T.; Waller, Edmund K.PLoS One (2014), 9 (5), e96165/1-e96165/12, 12 pp.CODEN: POLNCL; ISSN:1932-6203. (Public Library of Science)Prior work using allogeneic bone marrow transplantation (allo-BMT) models showed that peritransplant administration of flagellin, a toll-like receptor 5 (TLR5) agonist protected murine allo-BMT recipients from CMV infection while limiting graft-vs-host disease (GvHD). However, the mechanism by which flagellin-TLR5 interaction promotes anti-CMV immunity was not defined. Here, we investigated the anti-CMV immunity of NK cells in C57BL/6 (B6) mice treated with a highly purified cGMP grade recombinant flagellin variant CBLB502 (rflagellin) followed by murine CMV (mCMV) infection. A single dose of rflagellin administered to mice between 48 to 72 h prior to MCMV infection resulted in optimal protection from mCMV lethality. Anti-mCMV immunity in rflagellin-treated mice correlated with a significantly reduced liver viral load and increased nos. of Ly49H+ and Ly49D+ activated cytotoxic NK cells. Addnl., the increased anti-mCMV immunity of NK cells was directly correlated with increased nos. of IFN-γ, granzyme B- and CD107a producing NK cells following mCMV infection. rFlagellin-induced anti-mCMV immunity was TLR5-dependent as rflagellin-treated TLR5 KO mice had ∼10-fold increased liver viral load compared with rflagellin-treated WT B6 mice. However, the increased anti-mCMV immunity of NK cells in rflagellin-treated mice is regulated indirectly as mouse NK cells do not express TLR5. Collectively, these data suggest that rflagellin treatment indirectly leads to activation of NK cells, which may be an important adjunct benefit of administering rflagellin in allo-BMT recipients.
- 58Jahanban-Esfahlan, R.; Seidi, K.; Majidinia, M.; Karimian, A.; Yousefi, B.; Nabavi, S. M.; Astani, A.; Berindan-Neagoe, I.; Gulei, D.; Fallarino, F.; Gargaro, M.; Manni, G.; Pirro, M.; Xu, S.; Sadeghi, M.; Nabavi, S. F.; Shirooie, S. Toll-like Receptors as Novel Therapeutic Targets for Herpes Simplex Virus Infection. Rev. Med. Virol. 2019, 29 (4), e2048, DOI: 10.1002/rmv.2048
- 59Pickens, J. A.; Tripp, R. A. Verdinexor Targeting of CRM1 Is a Promising Therapeutic Approach against RSV and Influenza Viruses. Viruses 2018, 10 (1), 48, DOI: 10.3390/v10010048[Crossref], [CAS], Google Scholar59https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXitFyqu7vL&md5=c920202b091fb5ef1aa76d9c77472774Verdinexor targeting of CRM1 is a promising therapeutic approach against RSV and influenza virusesPickens, Jennifer A.; Tripp, Ralph A.Viruses (2018), 10 (1), 48/1-48/24CODEN: VIRUBR; ISSN:1999-4915. (MDPI AG)Two primary causes of respiratory tract infections are respiratory syncytial virus (RSV) and influenza viruses, both of which remain major public health concerns. There are a limited no. of antiviral drugs available for the treatment of RSV and influenza, each having limited effectiveness and each driving selective pressure for the emergence of drug-resistant viruses. Novel broad-spectrum antivirals are needed to circumvent problems with current disease intervention strategies, while improving the cytokine-induced immunopathol. assocd. with RSV and influenza infections. In this review, we examine the use of Verdinexor (KPT-335, a novel orally bioavailable drug that functions as a selective inhibitor of nuclear export, SINE), as an antiviral with multifaceted therapeutic potential. KPT-335 works to (1) block CRM1 (i.e., Chromosome Region Maintenance 1; exportin 1 or XPO1) mediated export of viral proteins crit. for RSV and influenza pathogenesis; and (2) repress nuclear factor κB (NF-κB) activation, thus reducing cytokine prodn. and eliminating virus-assocd. immunopathol. The repurposing of SINE compds. as antivirals shows promise not only against RSV and influenza virus but also against other viruses that exploit the nucleus as part of their viral life cycle.
- 60Matz, K. M.; Guzman, R. M.; Goodman, A. G. The Role of Nucleic Acid Sensing in Controlling Microbial and Autoimmune Disorders. In International Review of Cell and Molecular Biology, Vol. 345; Elsevier, 2019; Chapter 2, pp 35– 136, DOI: 10.1016/bs.ircmb.2018.08.002 .
- 61Uppal, T.; Sarkar, R.; Dhelaria, R.; Verma, S. C. Role of Pattern Recognition Receptors in KSHV Infection. Cancers 2018, 10 (3), 85, DOI: 10.3390/cancers10030085[Crossref], [CAS], Google Scholar61https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhtV2htb7N&md5=b4da634d774738158e9678f239e05e5aRole of pattern recognition receptors in KSHV infectionUppal, Timsy; Sarkar, Roni; Dhelaria, Ranjit; Verma, Subhash C.Cancers (2018), 10 (3), 85/1-85/21CODEN: CANCCT; ISSN:2072-6694. (MDPI AG)Kaposi's sarcoma-assocd. herpesvirus or Human herpesvirus-8 (KSHV/HHV-8), an oncogenic human herpesvirus and the leading cause of cancer in HIV-infected individuals, is a major public health concern with recurring reports of epidemics on a global level. The early detection of KSHV virus and subsequent activation of the antiviral immune response by the host's immune system are crucial to prevent KSHV infection. The host's immune system is an evolutionary conserved system that provides the most important line of defense against invading microbial pathogens, including viruses. Viruses are initially detected by the cells of the host innate immune system, which evoke concerted antiviral responses via the secretion of interferons (IFNs) and inflammatory cytokines/chemokines for elimination of the invaders. Type I IFN and cytokine gene expression are regulated by multiple intracellular signaling pathways that are activated by germline-encoded host sensors, i.e., pattern recognition receptors (PRRs) that recognize a conserved set of ligands, known as 'pathogen-assocd. mol. patterns (PAMPs)'. On the contrary, persistent and dysregulated signaling of PRRs promotes numerous tumor-causing inflammatory events in various human cancers. Being an integral component of the mammalian innate immune response and due to their constitutive activation in tumor cells, targeting PRRs appears to be an effective strategy for tumor prevention and/or treatment. Cellular PRRs are known to respond to KSHV infection, and KSHV has been shown to be armed with an array of strategies to selectively inhibit cellular PRR-based immune sensing to its benefit. In particular, KSHV has acquired specific immunomodulatory genes to effectively subvert PRR responses during the early stages of primary infection, lytic reactivation and latency, for a successful establishment of a life-long persistent infection. The current review aims to comprehensively summarize the latest advances in our knowledge of role of PRRs in KSHV infections.
- 62Guo, H. Y.; Zhang, X. C.; Jia, R. Y. Toll-like Receptors and RIG-I-like Receptors Play Important Roles in Resisting Flavivirus. J. Immunol. Res. 2018, 2018, 6106582, DOI: 10.1155/2018/6106582[Crossref], [PubMed], [CAS], Google Scholar62https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC1MblvFSqsw%253D%253D&md5=44a91ed8e853ca0f5abc6119dae1d8c7Toll-Like Receptors and RIG-I-Like Receptors Play Important Roles in Resisting FlavivirusGuo Hong-Yan; Zhang Xing-Cui; Jia Ren-Yong; Guo Hong-Yan; Zhang Xing-Cui; Jia Ren-Yong; Guo Hong-Yan; Zhang Xing-Cui; Jia Ren-YongJournal of immunology research (2018), 2018 (), 6106582 ISSN:.Flaviviridae family is a class of single-stranded RNA virus, which is fatal to human and animals and mainly prevalent in subtropic and tropic countries. Even though people and animals are barraged with flavivirus infection every year, we have not invented either vaccines or antiviral for most flavivirus infections yet. Innate immunity is the first line of defense in resisting pathogen invasion, serving an important role in a resisting virus. Toll-like receptors (TLRs) and retinoic acid-inducible gene I- (RIG-I-) like receptors (RLRs) are crucial pattern recognition receptors (PRRs) that play essential roles in recognizing and clearing pathogens, including resisting flavivirus. In the present review, we provide a significant reference for further research on the function of innate immunity in resisting flavivirus.
- 63Macedo, A. B.; Novis, C. L.; Bosque, A. Targeting Cellular and Tissue HIV Reservoirs With Toll-Like Receptor Agonists. Front. Immunol. 2019, 10, 2450, DOI: 10.3389/fimmu.2019.02450[Crossref], [PubMed], [CAS], Google Scholar63https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXps1Gitbc%253D&md5=961ab621dfe62fdd4557ce84359d963cTargeting cellular and tissue HIV reservoirs with toll-like receptor agonistsMacedo, Amanda B.; Novis, Camille L.; Bosque, AlbertoFrontiers in Immunology (2019), 10 (), 2450CODEN: FIRMCW; ISSN:1664-3224. (Frontiers Media S.A.)A review. The elimination of both cellular and tissue latent reservoirs is a challenge toward a successful HIV cure. "Shock and Kill" are among the therapeutic strategies that have been more extensively studied to target these reservoirs. These strategies are aimed toward the reactivation of the latent reservoir using a latency-reversal agent (LRA) with the subsequent killing of the reactivated cell either by the cytotoxic arm of the immune system, including NK and CD8 T cells, or by viral cytopathic mechanisms. Numerous LRAs are currently being investigated in vitro, ex vivo as well as in vivo for their ability to reactivate and reduce latent reservoirs. Among those, several toll-like receptor (TLR) agonists have been shown to reactivate latent HIV. In humans, there are 10 TLRs that recognize different pathogen-assocd. mol. patterns. TLRs are present in several cell types, including CD4 T cells, the cell compartment that harbors the majority of the latent reservoir. Besides their ability to reactivate latent HIV, TLR agonists also increase immune activation and promote an antiviral response. These combined properties make TLR agonists unique among the different LRAs characterized to date. Addnl., some of these agonists have shown promise toward finding an HIV cure in animal models. When in combination with broadly neutralizing antibodies, TLR-7 agonists have shown to impact the SIV latent reservoir and delay viral rebound. Moreover, there are FDA-approved TLR agonists that are currently being investigated for cancer therapy and other diseases. All these has prompted clin. trials using TLR agonists either alone or in combination toward HIV eradication approaches. In this review, we provide an extensive characterization of the state-of-the-art of the use of TLR agonists toward HIV eradication strategies and the mechanism behind how TLR agonists target both cellular and tissue HIV reservoirs.
- 64Das, D.; Sengupta, I.; Sarkar, N.; Pal, A.; Saha, D.; Bandopadhyay, M.; Das, C.; Narayan, J.; Singh, S. P.; Chakrabarti, S.; Chakravarty, R. Anti-Hepatitis B Virus (HBV) Response of Imiquimod Based Toll like Receptor 7 Ligand in Hbv-Positive Human Hepatocelluar Carcinoma Cell Line. BMC Infect. Dis. 2017, 17 (1), 1– 12, DOI: 10.1186/s12879-017-2189-z
- 65Lebold, K. M.; Jacoby, D. B.; Drake, M. G. Toll-Like Receptor 7-Targeted Therapy in Respiratory Disease. Transfus. Med. Hemotherapy 2016, 43 (2), 114– 119, DOI: 10.1159/000445324[Crossref], [PubMed], [CAS], Google Scholar65https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC2s%252FjvVertw%253D%253D&md5=1c53ce28311f89d8315052a01c032ba3Toll-Like Receptor 7-Targeted Therapy in Respiratory DiseaseLebold Katie M; Jacoby David B; Drake Matthew GTransfusion medicine and hemotherapy : offizielles Organ der Deutschen Gesellschaft fur Transfusionsmedizin und Immunhamatologie (2016), 43 (2), 114-9 ISSN:1660-3796.Allergic asthma and allergic rhinitis are inflammatory diseases of the respiratory tract characterized by an excessive type-2 T helper cell (Th2) immune response. Toll-like receptor 7 (TLR7) is a single-stranded viral RNA receptor expressed in the airway that initiates a Th1 immune response and has garnered interest as a novel therapeutic target for treatment of allergic airway diseases. In animal models, synthetic TLR7 agonists reduce airway hyperreactivity, eosinophilic inflammation, and airway remodeling while decreasing Th2-associated cytokines. Furthermore, activation of TLR7 rapidly relaxes airway smooth muscle via production of nitric oxide. Thus, TLR7 has dual bronchodilator and anti-inflammatory effects. Two TLR7 ligands with promising pharmacologic profiles have entered clinical trials for the treatment of allergic rhinitis. Moreover, TLR7 agonists are potential antiviral therapies against respiratory viruses. TLR7 agonists enhance influenza vaccine efficacy and also reduce viral titers when given during an active airway infection. In this review, we examine the current data supporting TLR7 as a therapeutic target in allergic airway diseases.
- 66Vanwalscappel, B.; Tada, T.; Landau, N. R. Toll-like Receptor Agonist R848 Blocks Zika Virus Replication by Inducing the Antiviral Protein Viperin. Virology 2018, 522, 199– 208, DOI: 10.1016/j.virol.2018.07.014[Crossref], [PubMed], [CAS], Google Scholar66https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhtlKmur7P&md5=294a6661456935f303071befd5909353Toll-like receptor agonist R848 blocks Zika virus replication by inducing the antiviral protein viperinVanwalscappel, Benedicte; Tada, Takuya; Landau, Nathaniel R.Virology (2018), 522 (), 199-208CODEN: VIRLAX; ISSN:0042-6822. (Elsevier B.V.)Zika virus (ZIKV) is an emerging pathogen linked to neurol. disorders for which there is currently no targeted therapy. To identify host innate immune response proteins that restrict ZIKV replication, the authors treated monocytes and macrophages with toll-like receptor (TLR) agonists. Of those tested, the TLR7/8 agonist R848 (resiquimod) was the most potent inhibitor of ZIKV replication. RNA-seq anal. identified several genes strongly induced by R848 in monocytes. Testing of several of these for their ability to restrict ZIKV replication identified viperin, an interferon-induced gene active against several viruses. Transduction of microglial CHME3 cells with a viperin lentiviral expression vector rendered them resistant to ZIKV infection, preventing the synthesis of viral RNA and protein. CRISPR/Cas9 knock-out of viperin in macrophages relieved the block to infection, demonstrating that viperin is a major innate immune response protein able to block ZIKV replication. TLR agonists may be useful for the prophylactic or therapeutic treatment for ZIKV.
- 67Sui, Y.; Berzofsky, J. A. Myeloid Cell-Mediated Trained Innate Immunity in Mucosal AIDS Vaccine Development. Front. Immunol. 2020, 11, 315, DOI: 10.3389/fimmu.2020.00315[Crossref], [PubMed], [CAS], Google Scholar67https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhsVGitb%252FF&md5=3187eb55d2d0deb8c89e49213d916a5dMyeloid cell-mediated trained innate immunity in mucosal AIDS vaccine developmentSui, Yongjun; Berzofsky, Jay A.Frontiers in Immunology (2020), 11 (), 315CODEN: FIRMCW; ISSN:1664-3224. (Frontiers Media S.A.)A review. Trained innate immunity has recently emerged as a novel concept of innate immune cells, such as myeloid cells, exhibiting immune memory, and nonspecific heterologous immunity to protect against infections. The memory and specificity are mediated by epigenetic, metabolic, and functional reprogramming of the myeloid cells and myeloid progenitors (and/or NK cells) in the bone marrow and peripheral tissues such as gut and lung mucosa. A variety of agents, such as BCG, viruses, and their components, as well as TLR agonists, and cytokines have been shown to be involved in the induction of trained immunity. Since these agents have been widely used in AIDS vaccine development as antigen delivery vectors or adjuvants, myeloid cell mediated trained immunity might also play an important role in protecting against mucosal AIDS virus transmission or in control of virus replication in the major gut mucosal reservoir. Here we review the trained innate immunity induced by these vectors/adjuvants that have been used in AIDS vaccine studies and discuss their role in mucosal vaccine efficacy and possible utilization in AIDS vaccine development. Delineating the protective effect of the trained innate immunity mediated by myeloid cells will guide the design of novel AIDS vaccines.
- 68Miller, S. M.; Cybulski, V.; Whitacre, M.; Bess, L. S.; Livesay, M. T.; Walsh, L.; Burkhart, D.; Bazin, H. G.; Evans, J. T. Novel Lipidated Imidazoquinoline TLR7/8 Adjuvants Elicit Influenza-Specific Th1 Immune Responses and Protect Against Heterologous H3N2 Influenza Challenge in Mice. Front. Immunol. 2020, 11, 406, DOI: 10.3389/fimmu.2020.00406[Crossref], [PubMed], [CAS], Google Scholar68https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhsVGitLfN&md5=c7e282f0f2c4d7c58568fcbd4c2531e2Novel lipidated imidazoquinoline TLR7/8 adjuvants elicit influenza-specific Th1 immune responses and protect against heterologous H3N2 influenza challenge in miceMiller, Shannon M.; Cybulski, Van; Whitacre, Margaret; Bess, Laura S.; Livesay, Mark T.; Walsh, Lois; Burkhart, David; Bazin, Helene G.; Evans, Jay T.Frontiers in Immunology (2020), 11 (), 406CODEN: FIRMCW; ISSN:1664-3224. (Frontiers Media S.A.)Most licensed seasonal influenza vaccines are non-adjuvanted and rely primarily on vaccine-induced antibody titers for protection. As such, seasonal antigenic drift and suboptimal vaccine strain selection often results in reduced vaccine efficacy. Further, seasonal H3N2 influenza vaccines demonstrate poor efficacy compared to H1N1 and influenza type B vaccines. New vaccines, adjuvants, or delivery technologies that can induce broader or cross-seasonal protection against drifted influenza virus strains, likely through induction of protective T cell responses, are urgently needed. Here, we report novel lipidated TLR7/8 ligands that act as strong adjuvants to promote influenza-virus specific Th1-and Th17-polarized T cell responses and humoral responses in mice with no observable toxicity. Further, the adjuvanted influenza vaccine provided protection against a heterologous H3N2 influenza challenge in mice. These responses were further enhanced when combined with a synthetic TLR4 ligand adjuvant. Despite differences between human and mouse TLR7/8, these novel lipidated imidazoquinolines induced the prodn. of cytokines required to polarize a Th1 and Th17 immune response in human PBMCs providing addnl. support for further development of these compds. as novel adjuvants for the induction of broad supra-seasonal protection from influenza virus.
- 69Macedo, A. B.; Novis, C. L.; De Assis, C. M.; Sorensen, E. S.; Moszczynski, P.; Huang, S. H.; Ren, Y.; Spivak, A. M.; Jones, R. B.; Planelles, V.; Bosque, A. Dual TLR2 and TLR7 Agonists as HIV Latency-Reversing Agents. JCI insight 2018, 3 (19), e122673, DOI: 10.1172/jci.insight.122673
- 70Hu, Y.; Tang, L.; Zhu, Z.; Meng, H.; Chen, T.; Zhao, S.; Jin, Z.; Wang, Z.; Jin, G. A Novel TLR7 Agonist as Adjuvant to Stimulate High Quality HBsAg-Specific Immune Responses in an HBV Mouse Model. J. Transl. Med. 2020, 18 (1), 112, DOI: 10.1186/s12967-020-02275-2[Crossref], [PubMed], [CAS], Google Scholar70https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB387psVansQ%253D%253D&md5=79befa3840c23c8bcc22545c785d5931A novel TLR7 agonist as adjuvant to stimulate high quality HBsAg-specific immune responses in an HBV mouse modelHu Yunlong; Tang Li; Chen Tingting; Zhao Sheng; Jin Zhenchao; Wang Zhulin; Jin Guangyi; Hu Yunlong; Tang Li; Chen Tingting; Zhao Sheng; Jin Zhenchao; Wang Zhulin; Jin Guangyi; Hu Yunlong; Tang Li; Zhu Zhengyu; Meng HeJournal of translational medicine (2020), 18 (1), 112 ISSN:.BACKGROUND: The global burden of hepatitis B virus (HBV) infection in terms of morbidity and mortality is immense. Novel treatments that can induce a protective immune response are urgently needed to effectively control the HBV epidemic and eventually eradicate chronic HBV infection. METHODS: We designed and evaluated an HBV therapeutic vaccine consisting of a novel Toll-like receptor 7 (TLR7) agonist T7-EA, an Alum adjuvant and a recombinant HBsAg protein. We used RNA-seq, ELISA and hTLR7/8 reporting assays to characterize T7-EA in vitro and real-time PCR to evaluate the tissue-retention characteristics in vivo. To evaluate the adjuvant potential, we administrated T7-EA intraperitoneally in a formulation with an Alum adjuvant and HBsAg in normal and HBV mice, then, we evaluated the HBsAg-specific immune responses by ELISA and Elispot assays. RESULTS: T7-EA acted as an hTLR7-specific agonist and induced a similar gene expression pattern as an unmodified TLR7 ligand when Raw 264.7 cells were exposed to T7-EA; however, T7-EA was more potent than the unmodified TLR7 ligand. In vivo studies showed that T7-EA had tissue-retaining activity with stimulating local cytokine and chemokine expression for up to 7 days. T7-EA could induce Th1-type immune responses, as evidenced by an increased HBsAg-specific IgG2a titer and a T-cell response in normal mice compared to mice received traditional Alum-adjuvant HBV vaccine. Importantly, T7-EA could break immune tolerance and induce persistent HBsAg-specific antibody and T-cell responses in an HBV mouse model. CONCLUSIONS: T7-EA might be a candidate adjuvant in a prophylactic and therapeutic HBV vaccine.
- 71Chan, M.; Hayashi, T.; Kuy, C. S.; Gray, C. S.; Wu, C. C. N.; Corr, M.; Wrasidlo, W.; Cottam, H. B.; Carson, D. A. Synthesis and Immunological Characterization of Toll-Like Receptor 7 Agonistic Conjugates. Bioconjugate Chem. 2009, 20 (6), 1194– 1200, DOI: 10.1021/bc900054q[ACS Full Text], [CAS], Google Scholar71https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1MXlvFCrs7Y%253D&md5=945810b3e5d1a5ab14fc998ce1c0989dSynthesis and Immunological Characterization of Toll-Like Receptor 7 Agonistic ConjugatesChan, Michael; Hayashi, Tomoko; Kuy, Crystal S.; Gray, Christine S.; Wu, Christina C. N.; Corr, Maripat; Wrasidlo, Wolfgang; Cottam, Howard B.; Carson, Dennis A.Bioconjugate Chemistry (2009), 20 (6), 1194-1200CODEN: BCCHES; ISSN:1043-1802. (American Chemical Society)Activation of toll-like receptors (TLRs) on cells of the innate immune system initiates, amplifies, and directs the antigen-specific acquired immune response. Ligands that stimulate TLRs, therefore, represent potential immune adjuvants. In this study, a potent TLR7 agonist was conjugated to phospholipids, poly(ethylene glycol) (PEG), or phospholipid-PEG via a versatile benzoic acid functional group. Compared to the unmodified TLR7 agonist, each conjugate displayed a distinctive immunol. profile in vitro and in vivo. In mouse macrophages and human peripheral blood mononuclear cells, the phospholipid TLR7 agonist conjugate was at least 100-fold more potent than the free TLR7 ligands, while the potency of PEG-phospholipid conjugate was similar to that of the unmodified TLR7 agonist. When administered systemically in mice, the phospholipid and phospholipid-PEG TLR7 conjugates induced prolonged increases in the levels of proinflammatory cytokines in serum, compared to the unmodified TLR7 activator. When the conjugates were used as adjuvants during vaccination, only the phospholipid TLR7 agonist conjugates induced both Th1 and Th2 antigen-specific immune responses. These data show that the immunostimulatory activity of a TLR7 ligand can be amplified and focused by conjugation, thus broadening the potential therapeutic application of these agents.
- 72McGowan, D.; Herschke, F.; Pauwels, F.; Stoops, B.; Last, S.; Pieters, S.; Scholliers, A.; Thoné, T.; Van Schoubroeck, B.; De Pooter, D.; Mostmans, W.; Khamlichi, M. D.; Embrechts, W.; Dhuyvetter, D.; Smyej, I.; Arnoult, E.; Demin, S.; Borghys, H.; Fanning, G.; Vlach, J.; Raboisson, P. Novel Pyrimidine Toll-like Receptor 7 and 8 Dual Agonists to Treat Hepatitis B Virus. J. Med. Chem. 2016, 59 (17), 7936– 7949, DOI: 10.1021/acs.jmedchem.6b00747[ACS Full Text], [CAS], Google Scholar72https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28Xhtlamt7vF&md5=f98f5bf04418de548b34463b3ebf2c2eNovel Pyrimidine Toll-like Receptor 7 and 8 Dual Agonists to Treat Hepatitis B VirusMcGowan, David; Herschke, Florence; Pauwels, Frederik; Stoops, Bart; Last, Stefaan; Pieters, Serge; Scholliers, Annick; Thone, Tine; Van Schoubroeck, Bertrand; De Pooter, Dorien; Mostmans, Wendy; Khamlichi, Mourad Daoubi; Embrechts, Werner; Dhuyvetter, Deborah; Smyej, Ilham; Arnoult, Eric; Demin, Samuel; Borghys, Herman; Fanning, Gregory; Vlach, Jaromir; Raboisson, PierreJournal of Medicinal Chemistry (2016), 59 (17), 7936-7949CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)Toll-like receptor (TLR) 7 and 8 agonists can potentially be used in the treatment of viral infections and are particularly promising for chronic hepatitis B virus (HBV) infection. An internal screening effort identified a pyrimidine Toll-like receptor 7 and 8 dual agonist. This provided a novel alternative over the previously reported adenine and pteridone type of agonists. Structure-activity relationship, lead optimization, in silico docking, pharmacokinetics, and demonstration of ex vivo and in vivo cytokine prodn. of the lead compd. are presented.
- 73Embrechts, W.; Herschke, F.; Pauwels, F.; Stoops, B.; Last, S.; Pieters, S.; Pande, V.; Pille, G.; Amssoms, K.; Smyej, I.; Dhuyvetter, D.; Scholliers, A.; Mostmans, W.; Van Dijck, K.; Van Schoubroeck, B.; Thone, T.; De Pooter, D.; Fanning, G.; Jonckers, T. H. M.; Horton, H.; Raboisson, P.; McGowan, D. 2,4-Diaminoquinazolines as Dual Toll-like Receptor (TLR) 7/8 Modulators for the Treatment of Hepatitis B Virus. J. Med. Chem. 2018, 61 (14), 6236– 6246, DOI: 10.1021/acs.jmedchem.8b00643[ACS Full Text], [CAS], Google Scholar73https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXht1CqurvM&md5=7cc741c6b341d318798e26150ce7856c2,4-Diaminoquinazolines as Dual Toll-like Receptor (TLR) 7/8 Modulators for the Treatment of Hepatitis B VirusEmbrechts, Werner; Herschke, Florence; Pauwels, Frederik; Stoops, Bart; Last, Stefaan; Pieters, Serge; Pande, Vineet; Pille, Geert; Amssoms, Katie; Smyej, Ilham; Dhuyvetter, Deborah; Scholliers, Annick; Mostmans, Wendy; Van Dijck, Kris; Van Schoubroeck, Bertrand; Thone, Tine; De Pooter, Dorien; Fanning, Gregory; Jonckers, Tim H. M.; Horton, Helen; Raboisson, Pierre; McGowan, DavidJournal of Medicinal Chemistry (2018), 61 (14), 6236-6246CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)A novel series of 2,4-diaminoquinazolines was identified as potent dual Toll-like receptor (TLR) 7 and 8 agonists with reduced off-target activity. The stereochem. of the amino alc. was found to influence the TLR7/8 selectivity with the (R) isomer resulting in selective TLR8 agonism. Lead optimization toward a dual agonist afforded (S)-3-((2-amino-8-fluoroquinazolin-4-yl)amino)hexanol 31 as a potent analog, being structurally different from previously described dual agonists (McGowan J. Med. Chem. 2016, 59, 7936). Pharmacokinetic and pharmacodynamic (PK/PD) studies revealed the desired high first pass profile aimed at limiting systemic cytokine activation. In vivo pharmacodynamic studies with lead compd. 31 demonstrated prodn. of cytokines consistent with TLR7/8 activation in mice and cynomolgus monkeys and ex vivo inhibition of hepatitis B virus (HBV).
- 74McGowan, D. C.; Herschke, F.; Pauwels, F.; Stoops, B.; Smyej, I.; Last, S.; Pieters, S.; Embrechts, W.; Khamlichi, M. D.; Thoné, T.; Van Schoubroeck, B.; Mostmans, W.; Wuyts, D.; Verstappen, D.; Scholliers, A.; De Pooter, D.; Dhuyvetter, D.; Borghys, H.; Tuefferd, M.; Arnoult, E.; Hong, J.; Fanning, G.; Bollekens, J.; Urmaliya, V.; Teisman, A.; Horton, H.; Jonckers, T. H. M.; Raboisson, P. Identification and Optimization of Pyrrolo[3,2-d]Pyrimidine Toll-like Receptor 7 (TLR7) Selective Agonists for the Treatment of Hepatitis B. J. Med. Chem. 2017, 60 (14), 6137– 6151, DOI: 10.1021/acs.jmedchem.7b00365[ACS Full Text], [CAS], Google Scholar74https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXhtV2qsr%252FL&md5=6482b94555be9b33acf895dff88bd253Identification and Optimization of Pyrrolo[3,2-d]pyrimidine Toll-like Receptor 7 (TLR7) Selective Agonists for the Treatment of Hepatitis BMcGowan, David C.; Herschke, Florence; Pauwels, Frederik; Stoops, Bart; Smyej, Ilham; Last, Stefaan; Pieters, Serge; Embrechts, Werner; Khamlichi, Mourad Daoubi; Thone, Tine; Van Schoubroeck, Bertrand; Mostmans, Wendy; Wuyts, Debbie; Verstappen, Dorien; Scholliers, Annick; De Pooter, Dorien; Dhuyvetter, Deborah; Borghys, Herman; Tuefferd, Marianne; Arnoult, Eric; Hong, Jin; Fanning, Gregory; Bollekens, Jacques; Urmaliya, Vijay; Teisman, Ard; Horton, Helen; Jonckers, Tim H. M.; Raboisson, PierreJournal of Medicinal Chemistry (2017), 60 (14), 6137-6151CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)Pyrrolo[3,2-d]pyrimidines were identified as a new series of potent and selective TLR7 agonists. Compds. were optimized for their activity and selectivity over TLR8. This presents an advantage over recently described scaffolds that have residual TLR8 activity, which may be detrimental to the tolerability of the candidate drug. Oral administration of the lead compd. 54 effectively induced a transient interferon stimulated gene (ISG) response in mice and cynomolgus monkeys. We aimed for a high first pass effect, limiting cytokine induction systemically, and demonstrated the potential for the immunotherapy of viral hepatitis.
- 75Wang, H.-f.; Wang, S.-s.; Tang, Y.-J.; Chen, Y.; Zheng, M.; Tang, Y.-l.; Liang, X.-h. The Double-Edged Sword—How Human Papillomaviruses Interact with Immunity in Head and Neck Cancer. Front. Immunol. 2019, 10, 653, DOI: 10.3389/fimmu.2019.00653[Crossref], [PubMed], [CAS], Google Scholar75https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhtlyrsrfL&md5=b839b72f4a6016e9e888f0a29579efa8The double-edged sword-how human papillomaviruses interact with immunity in head and neck cancerWang, Hao-fan; Wang, Sha-sha; Tang, Ya-Jie; Chen, Yu; Zheng, Min; Tang, Ya-ling; Liang, Xin-huaFrontiers in Immunology (2019), 10 (), 653CODEN: FIRMCW; ISSN:1664-3224. (Frontiers Media S.A.)A review. Patients with human papilloma virus (HPV)-assocd. head and neck squamous cell carcinoma (HNSCC) have remarkably better prognosis, which differs from HPV-neg. oropharyngeal squamous cell carcinoma (OPSCC) with respect to clin., genomic, mol., and immunol. aspects, esp. having the characteristics of high levels of immune cell infiltration and high degrees of immunosuppression. This review will summarize immune evasion mechanisms in HPV-pos. HNSCC, analyze the host various immune responses to HPV and abundant nos. of infiltrating immune cell, and discuss the differences between HPV-pos. HNSCC with cervical cancer. A deeper understanding of the immune landscape will help new concepts to emerge in immune-checkpoint oncol., which might be a valuable add-on to established concepts.
- 76Martinelli, E.; Cicala, C.; Van Ryk, D.; Goode, D. J.; Macleod, K.; Arthos, J.; Fauci, A. S. HIV-1 Gp120 Inhibits TLR9-Mediated Activation and IFN-α Secretion in Plasmacytoid Dendritic Cells. Proc. Natl. Acad. Sci. U. S. A. 2007, 104 (9), 3396– 3401, DOI: 10.1073/pnas.0611353104[Crossref], [PubMed], [CAS], Google Scholar76https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2sXjtVWltL4%253D&md5=f5b850475a90af47c6fb89c30aa03a01HIV-1 gp120 inhibits TLR9-mediated activation and IFN-α secretion in plasmacytoid dendritic cellsMartinelli, Elena; Cicala, Claudia; Van Ryk, Donald; Goode, Diana J.; Macleod, Katilyn; Arthos, James; Fauci, Anthony S.Proceedings of the National Academy of Sciences of the United States of America (2007), 104 (9), 3396-3401CODEN: PNASA6; ISSN:0027-8424. (National Academy of Sciences)Plasmacytoid dendritic cells (pDCs) play a central role in innate and adaptive immune responses against viral infections. pDCs secrete type I IFNs and proinflammatory cytokines upon stimulation by either TLR7 or TLR9. Throughout the course of HIV infection, the prodn. of type-I IFNs is profoundly impaired, and total pDC cell counts in peripheral blood correlates inversely with viral load and pos. with CD4+ T cell count. The origin of these defects is unclear. PDCs express CD4, CCR5, and CXCR4, the primary receptor and coreceptors, resp., for the HIV envelope; yet little is known concerning the effects of the viral envelope on these cells. Here, the authors show that exposure of pDCs to gp120 results in the suppression of activation of these cells. This suppression is specific for TLR9-mediated responses, because TLR7-mediated responses are unaffected by gp120. Gp120 also suppressed TLR9-mediated induction of proinflammatory cytokines and expression of CD83, a marker of DC activation. Finally, gp120 suppressed pDC-induced cytolytic activity of natural killer cells. Taken together, these data demonstrate that the direct interaction of HIV-1 gp120 with pDCs interferes with TLR9 activation resulting in a decreased ability of pDCs to secrete antiviral and inflammatory factors that play a central role in initiating host immune responses against invading pathogens.
- 77Kaminski, J. J.; Schattgen, S. A.; Tzeng, T.; Bode, C.; Klinman, D. M.; Fitzgerald, K. A. Synthetic Oligodeoxynucleotides Containing Suppressive TTAGGG Motifs Inhibit AIM2 Inflammasome Activation. J. Immunol. 2013, 191 (7), 3876– 3883, DOI: 10.4049/jimmunol.1300530[Crossref], [PubMed], [CAS], Google Scholar77https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXhsV2nsLfO&md5=ac712232cd8eb5ce369aa622fc5869d3Synthetic Oligodeoxynucleotides Containing Suppressive TTAGGG Motifs Inhibit AIM2 Inflammasome ActivationKaminski, John J.; Schattgen, Stefan A.; Tzeng, Te-Chen; Bode, Christian; Klinman, Dennis M.; Fitzgerald, Katherine A.Journal of Immunology (2013), 191 (7), 3876-3883CODEN: JOIMA3; ISSN:0022-1767. (American Association of Immunologists)Synthetic oligodeoxynucleotides (ODNs) comprised of the immunosuppressive motif TTAGGG block TLR9 signaling, prevent STAT1 and STAT4 phosphorylation and attenuate a variety of inflammatory responses in vivo. In this study, we demonstrate that such suppressive ODN abrogate activation of cytosolic nucleic acid-sensing pathways. Pretreatment of dendritic cells and macrophages with the suppressive ODN-A151 abrogated type I IFN, TNF-α, and ISG induction in response to cytosolic dsDNA. In addn., A151 abrogated caspase-1-dependent IL-1β and IL-18 maturation in dendritic cells stimulated with dsDNA and murine CMV. Inhibition was dependent on A151's phosphorothioate backbone, whereas substitution of the guanosine residues for adenosine neg. affected potency. A151 mediates these effects by binding to AIM2 in a manner that is competitive with immune-stimulatory DNA and as a consequence prevents AIM2 inflammasome complex formation. Collectively, these findings reveal a new route by which suppressive ODNs modulate the immune system and unveil novel applications for suppressive ODNs in the treatment of infectious and autoimmune diseases.
- 78Noh, J. Y.; Yoon, S. R.; Kim, T. D.; Choi, I.; Jung, H. Toll-Like Receptors in Natural Killer Cells and Their Application for Immunotherapy. J. Immunol. Res. 2020, 2020, 2045860, DOI: 10.1155/2020/2045860[Crossref], [PubMed], [CAS], Google Scholar78https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB38vjvV2ltA%253D%253D&md5=5302aca03ac3981983ec6c2ea34fb84fToll-Like Receptors in Natural Killer Cells and Their Application for ImmunotherapyNoh Ji-Yoon; Yoon Suk Ran; Kim Tae-Don; Choi Inpyo; Jung Haiyoung; Yoon Suk Ran; Kim Tae-Don; Choi InpyoJournal of immunology research (2020), 2020 (), 2045860 ISSN:.Innate immunity represents the first barrier for host defense against microbial infection. Toll-like receptors (TLRs) are the most well-defined PRRs with respect to PAMP recognition and induction of innate immune responses. They recognize pathogen-associated molecular patterns (PAMPs) and trigger innate immune responses by inducing inflammatory cytokines, chemokines, antigen-presenting molecules, and costimulatory molecules. TLRs are expressed either on the cell surface or within endosomes of innate immune cells. NK cells are one of the innate immune cells and also express TLRs to recognize or respond to PAMPs. TLRs in NK cells induce the innate immune responses against bacterial and viral infections via inducing NK cytotoxicity and cytokine production. In this review, we will discuss the expression and cellular function of TLRs in NK cells and also introduce some therapeutic applications of TLR agonists for NK cell-mediated immunotherapy.
- 79Chen, L.; Yu, J. Modulation of Toll-like Receptor Signaling in Innate Immunity by Natural Products. Int. Immunopharmacol. 2016, 37, 65– 70, DOI: 10.1016/j.intimp.2016.02.005[Crossref], [PubMed], [CAS], Google Scholar79https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XisFyis78%253D&md5=263a3dc283d703e63f007c925af2fa67Modulation of Toll-like receptor signaling in innate immunity by natural productsChen, Luxi; Yu, JianhuaInternational Immunopharmacology (2016), 37 (), 65-70CODEN: IINMBA; ISSN:1567-5769. (Elsevier B.V.)For centuries, natural products and their derivs. have provided a rich source of compds. for the development of new immunotherapies in the treatment of human disease. Many of these compds. are currently undergoing clin. trials, particularly as anti-oxidative, anti-microbial, and anti-cancer agents. However, the function and mechanism of natural products in how they interact with our immune system has yet to be extensively explored. Natural immune modulators may provide the key to control and ultimately defeat disorders affecting the immune system. They can either up- or down-regulate the immune response with few undesired adverse effects. In this review, we summarize the recent advancements made in utilizing natural products for immunomodulation and their important mol. targets, members of the Toll-like receptor (TLR) family, in the innate immune system.
- 80Fraietta, J. A.; Mueller, Y. M.; Do, D. H.; Holmes, V. M.; Howett, M. K.; Lewis, M. G.; Boesteanu, A. C.; Alkan, S. S.; Katsikis, P. D. Phosphorothioate 2′ Deoxyribose Oligomers as Microbicides That Inhibit Human Immunodeficiency Virus Type 1 (HIV-1) Infection and Block Toll-like Receptor 7 (TLR7) and TLR9 Triggering by HIV-1. Antimicrob. Agents Chemother. 2010, 54 (10), 4064– 4073, DOI: 10.1128/AAC.00367-10[Crossref], [PubMed], [CAS], Google Scholar80https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3cXhtlegsbfN&md5=b48670ab862461c81d9b568fc6da616aPhosphorothioate 2' deoxyribose oligomers as microbicides that inhibit human immunodeficiency virus type 1 (HIV-1) infection and block Toll-like receptor 7 (TLR7) and TLR9 triggering by HIV-1Fraietta, Joseph A.; Mueller, Yvonne M.; Do, Duc H.; Holmes, Veronica M.; Howett, Mary K.; Lewis, Mark G.; Boesteanu, Alina C.; Alkan, Sefik S.; Katsikis, Peter D.Antimicrobial Agents and Chemotherapy (2010), 54 (10), 4064-4073CODEN: AMACCQ; ISSN:0066-4804. (American Society for Microbiology)Topical microbicides may prove to be an important strategy for preventing human immunodeficiency virus type 1 (HIV-1) transmission. We examd. the safety and efficacy of sequence-nonspecific phosphorothioate 2' deoxyribose oligomers as potential novel microbicides. A short, 13-mer poly(T) phosphorothioate oligodeoxynucleotide (OPB-T) significantly inhibited infection of primary peripheral blood mononuclear cells (PBMC) by high-titer HIV-1Ba-L and simian immunodeficiency virus mac251 (SIVmac251). Continuous exposure of human vaginal and foreskin tissue explants to OPB-T showed no toxicity. An abasic 14-mer phosphorothioate 2' deoxyribose backbone (PDB) demonstrated enhanced anti-HIV-1 activity relative to OPB-T and other homo-oligodeoxynucleotide analogs. When PDB was used to pretreat HIV-1, PDB was effective against R5 and X4 isolates at a half-maximal inhibitory concn. (IC50) of <1 μM in both PBMC and P4-R5 MAGI cell infections. PDB also reduced HIV-1 infectivity following the binding of virus to target cells. This novel topical microbicide candidate exhibited an excellent in vitro safety profile in human PBMC and endocervical epithelial cells. PDB also retained activity in hydroxyethylcellulose gel at pH 4.4 and after transition to a neutral pH and was stable in this formulation for 30 days at room temp. Furthermore, the compd. displayed potent antiviral activity following incubation with a Lactobacillus strain derived from normal vaginal flora. Most importantly, PDB can inhibit HIV-1-induced alpha interferon prodn. Phosphorothioate 2' deoxyribose oligomers may therefore be promising microbicide candidates that inhibit HIV-1 infection and also dampen the inflammation which is crit. for the initial spread of the virus.
- 81Udgata, A.; Dolasia, K.; Ghosh, S.; Mukhopadhyay, S. Dribbling through the Host Defence: Targeting the TLRs by Pathogens. Crit. Rev. Microbiol. 2019, 45 (3), 354– 368, DOI: 10.1080/1040841X.2019.1608904[Crossref], [PubMed], [CAS], Google Scholar81https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXht1Gis7bJ&md5=7590824d76dfc3fb5b180bc672b63a4dDribbling through the host defence: targeting the TLRs by pathogensUdgata, Atul; Dolasia, Komal; Ghosh, Sudip; Mukhopadhyay, SangitaCritical Reviews in Microbiology (2019), 45 (3), 354-368CODEN: CRVMAC; ISSN:1040-841X. (Taylor & Francis Ltd.)A review. The immune system is well-equipped with sensors that detect invading pathogens and dictate subsequent immune responses for clearing the infections. One such class of sensor is the toll-like receptor (TLR), that can sense diverse mols. of pathogen origin such as proteins, lipids, carbohydrate, DNA, RNA, and trigger suitable immune responses to prevent infections. However, successful pathogens have evolved strategies to bypass the TLR-driven host immune responses to enable their survival inside the host. In this review, we have discussed about the recent advances in TLR biol. and strategies adopted by various pathogens (bacteria, virus, and parasites) to subvert the TLR-signalling for evading host-immune attack. Further, we have discussed how TLRs are linked in augmenting infection burden and disease severity in host during co-infection. This information is likely to be helpful to design TLR-based immunotherapeutics to control various infections and pathophysiol. disorders.
- 82Oliveira-Nascimento, L.; Massari, P.; Wetzler, L. M. The Role of TLR2 in Infection and Immunity. Front. Immunol. 2012, 3, 1– 17, DOI: 10.3389/fimmu.2012.00079
- 83Vidya, M. K.; Kumar, V. G.; Sejian, V.; Bagath, M.; Krishnan, G.; Bhatta, R. Toll-like Receptors: Significance, Ligands, Signaling Pathways, and Functions in Mammals. Int. Rev. Immunol. 2018, 37 (1), 20– 36, DOI: 10.1080/08830185.2017.1380200[Crossref], [PubMed], [CAS], Google Scholar83https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXhs1Gks7fN&md5=5082ffcd87854b5c09da1e2483880536Toll-like receptors: Significance, ligands, signaling pathways, and functions in mammalsVidya, Mallenahally Kusha; Kumar, V. Girish; Sejian, Veerasamy; Bagath, Madiajagan; Krishnan, Govindan; Bhatta, RaghavendraInternational Reviews of Immunology (2018), 37 (1), 20-36CODEN: IRIMEH; ISSN:0883-0185. (Taylor & Francis Ltd.)This review attempts to cover the implication of the toll-like receptors (TLRs) in controlling immune functions with emphasis on their significance, function, regulation and expression patterns. The tripartite TLRs are type I integral transmembrane receptors that are involved in recognition and conveying of pathogens to the immune system. These paralogs are located on cell surfaces or within endosomes. The TLRs are found to be functionally involved in the recognition of self and non-self-antigens, maturation of DCs and initiation of antigen-specific adaptive immune responses as they bridge the innate and adaptive immunity. Interestingly, they also have a significant role in immunotherapy and vaccination. Signals generated by TLRs are transduced through NFκB signaling and MAP kinases pathway to recruit pro-inflammatory cytokines and co-stimulatory mols., which promote inflammatory responses. The excess prodn. of these cytokines leads to grave systemic disorders like tumor growth and autoimmune disorders. Hence, regulation of the TLR signaling pathway is necessary to keep the host system safe. Many mols. like LPS, SOCS1, IRAK1, NFκB, and TRAF3 are involved in modulating the TLR pathways to induce appropriate response. Though quantification of these TLRs helps in correlating the magnitude of immune response exhibited by the animal, there are several internal, external, genetic and animal factors that affect their expression patterns. So it can be concluded that any identification based on those expression profiles may lead to improper diagnosis during certain conditions.
- 84Fitzgerald, K. A.; Kagan, J. C. Toll-like Receptors and the Control of Immunity. Cell 2020, 180 (6), 1044– 1066, DOI: 10.1016/j.cell.2020.02.041[Crossref], [PubMed], [CAS], Google Scholar84https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXkvVeltbc%253D&md5=8d4428b11fd797f7e661c7f321193cccToll-like Receptors and the Control of ImmunityFitzgerald, Katherine A.; Kagan, Jonathan C.Cell (Cambridge, MA, United States) (2020), 180 (6), 1044-1066CODEN: CELLB5; ISSN:0092-8674. (Cell Press)A review. The study of innate immunity and its link to inflammation and host defense encompasses diverse areas of biol., ranging from genetics and biophysics to signal transduction and physiol. Central to our understanding of these events are the Toll-like receptors (TLRs), an evolutionarily ancient family of pattern recognition receptors. Herein, we describe the mechanisms and consequences of TLR-mediated signal transduction with a focus on themes identified in the TLR pathways that also explain the operation of other immune signaling pathways. These themes include the detection of conserved microbial structures to identify infectious agents and the use of supramol. organizing centers (SMOCs) as signaling organelles that ensure digital cellular responses. Further themes include mechanisms of inducible gene expression, the coordination of gene regulation and metab., and the influence of these activities on adaptive immunity. Studies in these areas have informed the development of next-generation therapeutics, thus ensuring a bright future for research in this area.
- 85Mifsud, E. J.; Tan, A. C. L.; Jackson, D. C. TLR Agonists as Modulators of the Innate Immune Response and Their Potential as Agents against Infectious Disease. Front. Immunol. 2014, 5, 79, DOI: 10.3389/fimmu.2014.00079[Crossref], [PubMed], [CAS], Google Scholar85https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC2cflslSjsg%253D%253D&md5=cf341d326f79a1c5a47d7efd5679a7beTLR Agonists as Modulators of the Innate Immune Response and Their Potential as Agents Against Infectious DiseaseMifsud Edin J; Tan Amabel C L; Jackson David CFrontiers in immunology (2014), 5 (), 79 ISSN:1664-3224.Immunotherapies that can either activate or suppress innate immune responses are being investigated as treatments against infectious diseases and the pathology they can cause. The objective of these therapies is to elicit protective immune responses thereby limiting the harm inflicted by the pathogen. The Toll-like receptor (TLR) signaling pathway plays critical roles in numerous host immune defenses and has been identified as an immunotherapeutic target against the consequences of infectious challenge. This review focuses on some of the recent advances being made in the development of TLR-ligands as potential prophylactic and/or therapeutic agents.
- 86Salunke, D. B.; Connelly, S. W.; Shukla, N. M.; Hermanson, A. R.; Fox, L. M.; David, S. A. Design and Development of Stable, Water-Soluble, Human Toll-like Receptor 2 Specific Monoacyl Lipopeptides as Candidate Vaccine Adjuvants. J. Med. Chem. 2013, 56 (14), 5885– 5900, DOI: 10.1021/jm400620g[ACS Full Text], [CAS], Google Scholar86https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXpvFans7s%253D&md5=cb0eb5192ab742a75d8a43edf7f5f20aDesign and Development of Stable, Water-Soluble, Human Toll-like Receptor 2 Specific Monoacyl Lipopeptides as Candidate Vaccine AdjuvantsSalunke, Deepak B.; Connelly, Seth W.; Shukla, Nikunj M.; Hermanson, Alec R.; Fox, Lauren M.; David, Sunil A.Journal of Medicinal Chemistry (2013), 56 (14), 5885-5900CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)Antigens in modern subunit vaccines are largely sol. and poorly immunogenic proteins inducing relatively short-lived immune responses. Appropriate adjuvants initiate early innate immune responses, amplifying subsequent adaptive immune responses. Agonists of Toll-like receptor 2 (TLR2) are devoid of significant proinflammatory activity in ex vivo human blood models and yet are potently adjuvantic, suggesting that this chemotype may be a safe and effective adjuvant. Our earlier work on the monoacyl lipopeptide class of TLR2 agonists led to the design of a highly potent lead but with negligible aq. soly., necessitating the reintroduction of aq. soly. We explored several strategies of introducing ionizable groups on the lipopeptide, as well as the systematic evaluation of chem. stable bioisosteres of the ester-linked palmitoyl group. These studies have led to a fully optimized, chem. stable, and highly water-sol. human TLR2-specific agonist, which was found to have an excellent safety profile and displayed prominent adjuvantic activities in rabbit models.
- 87Tan, A. C. L.; Deliyannis, G.; Bharadwaj, M.; Brown, L. E.; Zeng, W.; Jackson, D. C. The Design and Proof of Concept for a CD8+ T Cell-Based Vaccine Inducing Cross-Subtype Protection against Influenza A Virus. Immunol. Cell Biol. 2013, 91 (1), 96– 104, DOI: 10.1038/icb.2012.54[Crossref], [PubMed], [CAS], Google Scholar87https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXms12jtA%253D%253D&md5=fc1ebe7af4709ff25f25288f286de90dThe design and proof of concept for a CD8+ T cell-based vaccine inducing cross-subtype protection against influenza A virusTan, Amabel C. L.; Deliyannis, Georgia; Bharadwaj, Mandvi; Brown, Lorena E.; Zeng, Weiguang; Jackson, David C.Immunology & Cell Biology (2013), 91 (1), 96-104CODEN: ICBIEZ; ISSN:0818-9641. (NPG Nature Asia-Pacific)In this study, the authors examd. the reactivity of human peripheral blood mononuclear cells to a panel of influenza A virus (IAV) CD8+ T-cell epitopes that are recognized by the major human leukocyte antigen (HLA) groups represented in the human population. The authors examd. the level of recognition in a sample of the human population and the potential coverage that could be achieved if these were incorporated into a T-cell epitope-based vaccine. The authors then designed a candidate influenza vaccine that incorporated three of the examd. HLA-A2-restricted influenza epitopes into Pam2Cys-based lipopeptides. These lipopeptides do not require the addn. of an adjuvant and can be delivered directly to the respiratory mucosa enabling the generation of local memory cell populations that are crucial for clearance of influenza. Intranasal administration of a mixt. of three lipopeptides to HLA-A2 transgenic HHD mice elicited multiple CD8+ T-cell specificities in the spleen and lung that closely mimicked the response generated following natural infection with influenza. These CD8+ T cells were assocd. with viral redn. following H3N1 influenza virus challenge for as long as 3 mo after lipopeptide administration. In addn., lipopeptides contg. IAV-targeting epitopes conferred substantial benefit against death following infection with a virulent H1N1 strain. Because CD8+ T cell epitopes are often derived from highly conserved regions of influenza viruses, such vaccines need not be reformulated annually and unlike current antibody-inducing vaccines could provide cross-protective immunity against newly emerging pandemic viruses. Immunol. and Cell Biol. (2013) 91, 96-104; doi:10.1038/icb.2012.54; published online 13 Nov. 2012.
- 88Mifsud, E. J.; Tan, A. C.; Short, K. R.; Brown, L. E.; Chua, B. Y.; Jackson, D. C. Reducing the Impact of Influenza-Associated Secondary Pneumococcal Infections. Immunol. Cell Biol. 2016, 94 (1), 101– 108, DOI: 10.1038/icb.2015.71[Crossref], [PubMed], [CAS], Google Scholar88https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXht1Wqt7zK&md5=463e1e13037ecf03fc2202042c28de8dReducing the impact of influenza-associated secondary pneumococcal infectionsMifsud, Edin J.; Tan, Amabel C.; Short, Kirsty R.; Brown, Lorena E.; Chua, Brendon Y.; Jackson, David C.Immunology & Cell Biology (2016), 94 (1), 101-108CODEN: ICBIEZ; ISSN:0818-9641. (NPG Nature Asia-Pacific)When administered prophylactically, we show that the Toll-like receptor-2 (TLR-2) agonist PEG-Pam2Cys (pegylated-S-(2,3-bis(palmitoyloxy)propyl)cysteine) not only mediates potent anti-viral activity against influenza virus but also reduces the impact of secondary infections with Streptococcus pneumoniae (the pneumococcus) by reducing (i) pulmonary viral and bacterial burdens, (ii) the levels of proinflammatory cytokines that normally accompany influenza and S. pneumoniae secondary infections and (iii) the vascular permeability of the pulmonary tract that can allow bacterial invasion of the blood in mice. We also show that an inactivated detergent-disrupted influenza virus vaccine formulated with the Pam2Cys-based adjuvant R4-Pam2Cys provides the host with both immediate and long-term protection against secondary pneumococcal infections following influenza virus infection through innate and specific immune mechanisms, resp. Vaccinated animals generated influenza virus-specific immune responses that provided the host with long-term protection against influenza virus and its sequelae. This vaccine, which generates an immediate response, provides an addnl. countermeasure, which is ideal for use even in the midst of an influenza outbreak.
- 89Wu, W.; Li, R.; Malladi, S. S.; Warshakoon, H. J.; Kimbrell, M. R.; Amolins, M. W.; Ukani, R.; Datta, A.; David, S. A. Structure-Activity Relationships in Toll-like Receptor-2 Agonistic Diacylthioglycerol Lipopeptides. J. Med. Chem. 2010, 53 (8), 3198– 3213, DOI: 10.1021/jm901839g[ACS Full Text], [CAS], Google Scholar89https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3cXjs1Wktb8%253D&md5=49dd3dd1a4967d5694564fdc4ccfeebbStructure-Activity Relationships in Toll-like Receptor-2 Agonistic Diacylthioglycerol LipopeptidesWu, Wenyan; Li, Rongti; Malladi, Subbalakshmi S.; Warshakoon, Hemamali J.; Kimbrell, Matthew R.; Amolins, Michael W.; Ukani, Rehman; Datta, Apurba; David, Sunil A.Journal of Medicinal Chemistry (2010), 53 (8), 3198-3213CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)The N-termini of bacterial lipoproteins are acylated with a (S)-(2,3-bisacyloxypropyl)cysteinyl residue. Lipopeptides derived from lipoproteins activate innate immune responses by engaging Toll-like receptor 2 (TLR2) and are highly immunostimulatory and yet without apparent toxicity in animal models. The lipopeptides may therefore be useful as potential immunotherapeutic agents. Previous structure-activity relationships in such lipopeptides have largely been obtained using murine cells, and it is now clear that significant species-specific differences exist between human and murine TLR responses. We have examd. in detail the role of the highly conserved Cys residue as well as the geometry and stereochem. of the Cys-Ser dipeptide unit. (R)-Diacylthioglycerol analogs are maximally active in reporter gene assays using human TLR2. The Cys-Ser dipeptide unit represents the minimal part-structure, but its stereochem. was found not to be a crit. determinant of activity. The thioether bridge between the diacyl and dipeptide units is crucial, and replacement by an oxoether bridge results in a dramatic decrease in activity.
- 90Salunke, D. B.; Shukla, N. M.; Yoo, E.; Crall, B. M.; Balakrishna, R.; Malladi, S. S.; David, S. A. Structure-Activity Relationships in Human Toll-like Receptor 2-Specific Monoacyl Lipopeptides. J. Med. Chem. 2012, 55 (7), 3353– 3363, DOI: 10.1021/jm3000533[ACS Full Text], [CAS], Google Scholar90https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC38XjtFGmt70%253D&md5=f03c060a2bcb85190ff6a8b792fe564cStructure-Activity Relationships in Human Toll-like Receptor 2-Specific Monoacyl LipopeptidesSalunke, Deepak B.; Shukla, Nikunj M.; Yoo, Euna; Crall, Breanna M.; Balakrishna, Rajalakshmi; Malladi, Subbalakshmi S.; David, Sunil A.Journal of Medicinal Chemistry (2012), 55 (7), 3353-3363CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)Toll-like receptor 2-agonistic lipopeptides typified by S-[2,3-bis(palmitoyloxy)-(2RS)-propyl]-R-cysteinyl-S-serine (PAM2CS) compds. are potential vaccine adjuvants. We had previously detd. that at least one acyl group of optimal length (C16) and an appropriately oriented ester carbonyl group is essential for TLR2-agonistic activity. We now show that these structurally simpler analogs display agonistic activities with human, but not murine, TLR2. SAR studies on the monoacyl derivs. show that the optimal acyl chain length is C16, and aryl substituents are not tolerated. A variety of alkyl and acyl substituents on the cysteine amine were examd. All N-alkyl derivs. were inactive. In contradistinction, short-chain N-acyl analogs were found to be highly active, with a clear dependence on the chain length. A cysteine N-acetyl analog was found to be the most potent (EC50: 1 nM), followed by the N-butyryl analog. The N-acetyl analog is human TLR2-specific, with its potency comparable to that of PAM2CS.
- 91Steinhagen, F.; Kinjo, T.; Bode, C.; Klinman, D. M. TLR-Based Immune Adjuvants. Vaccine 2011, 29 (17), 3341– 3355, DOI: 10.1016/j.vaccine.2010.08.002[Crossref], [PubMed], [CAS], Google Scholar91https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3MXkvVWjsb0%253D&md5=fdf92eff10e87ac4f2264541740a8991TLR-based immune adjuvantsSteinhagen, Folkert; Kinjo, Takeshi; Bode, Christian; Klinman, Dennis M.Vaccine (2011), 29 (17), 3341-3355CODEN: VACCDE; ISSN:0264-410X. (Elsevier Ltd.)A review. This work describes the nature and strength of the immune response induced by various Toll-like receptor ligands and their ability to act as vaccine adjuvants. It reviews the various ligands capable of triggering individual TLRs, and then focuses on the efficacy and safety of those agents for which clin. results are available.
- 92Luo, Y.; Friese, O. V.; Runnels, H. A.; Khandke, L.; Zlotnick, G.; Aulabaugh, A.; Gore, T.; Vidunas, E.; Raso, S. W.; Novikova, E.; Byrne, E.; Schlittler, M.; Stano, D.; Dufield, R. L.; Kumar, S.; Anderson, A. S.; Jansen, K. U.; Rouse, J. C. The Dual Role of Lipids of the Lipoproteins in Trumenba, a Self-Adjuvanting Vaccine Against Meningococcal Meningitis B Disease. AAPS J. 2016, 18 (6), 1562– 1575, DOI: 10.1208/s12248-016-9979-x[Crossref], [PubMed], [CAS], Google Scholar92https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XhvFCqtbbO&md5=08e8c20ebde879649793707dd829c992The Dual Role of Lipids of the Lipoproteins in Trumenba, a Self-Adjuvanting Vaccine Against Meningococcal Meningitis B DiseaseLuo, Yin; Friese, Olga V.; Runnels, Herbert A.; Khandke, Lakshmi; Zlotnick, Gary; Aulabaugh, Ann; Gore, Thomas; Vidunas, Eugene; Raso, Stephen W.; Novikova, Elena; Byrne, Emilia; Schlittler, Michael; Stano, Donald; Dufield, Robert L.; Kumar, Sandeep; Anderson, Annaliesa S.; Jansen, Kathrin U.; Rouse, Jason C.AAPS Journal (2016), 18 (6), 1562-1575CODEN: AJAOB6; ISSN:1550-7416. (Springer)Trumenba (bivalent rLP2086) is a vaccine licensed for the prevention of meningococcal meningitis disease caused by Neisseria meningitidis serogroup B (NmB) in individuals 10-25 years of age in the USA. The vaccine is composed of two factor H binding protein (fHbp) variants that were recombinantly expressed in Escherichia coli as native lipoproteins: rLP2086-A05 and rLP2086-B01. The vaccine was shown to induce potent bactericidal antibodies against a broad range of NmB isolates expressing fHbp that were different in sequence from the fHbp vaccine antigens. Here, we describe the characterization of the vaccine antigens including the elucidation of their structure which is characterized by two distinct motifs, the polypeptide domain and the N-terminal lipid moiety. In the vaccine formulation, the lipoproteins self-assoc. to form micelles driven by the hydrophobicity of the lipids and limited by the size of the folded polypeptides. The micelles help to increase the structural stability of the lipoproteins in the absence of bacterial cell walls. Anal. of the lipoproteins in Toll-like receptor (TLR) activation assays revealed their TLR2 agonist activity. This activity was lost with removal of the O-linked fatty acids, similar to removal of all lipids, demonstrating that this moiety plays an adjuvant role in immune activation. The thorough understanding of the structure and function of each moiety of the lipoproteins, as well as their relationship, lays the foundation for identifying crit. parameters to guide vaccine development and manuf.
- 93Seib, K. L.; Scarselli, M.; Comanducci, M.; Toneatto, D.; Masignani, V. Neisseria Meningitidis Factor H-Binding Protein FHbp: Key Virulence Factor and Vaccine Antigen. Expert Rev. Vaccines 2015, 14 (6), 841– 859, DOI: 10.1586/14760584.2015.1016915[Crossref], [PubMed], [CAS], Google Scholar93https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXotFWltL8%253D&md5=16b961e1e4fb96f95ff16239f38d3601Neisseria meningitidis factor H-binding protein fHbp: a key virulence factor and vaccine antigenSeib, Kate L.; Scarselli, Maria; Comanducci, Maurizio; Toneatto, Daniela; Masignani, VegaExpert Review of Vaccines (2015), 14 (6), 841-859CODEN: ERVXAX; ISSN:1476-0584. (Informa Healthcare)Neisseria meningitidis is a leading cause of meningitis and sepsis worldwide. The first broad-spectrum multicomponent vaccine against serogroup B meningococcus (MenB), 4CMenB (Bexsero), was approved by the EMA in 2013, for prevention of MenB disease in all age groups, and by the US FDA in Jan. 2015 for use in adolescents. A second protein-based MenB vaccine has also been approved in the USA for adolescents (rLP2086, Trumenba). Both vaccines contain the lipoprotein factor H-binding protein (fHbp). Preclin. studies demonstrated that fHbp elicits a robust bactericidal antibody response that correlates with the amt. of fHbp expressed on the bacterial surface. FHbp is able to selectively bind human factor H, the key regulator of the alternative complement pathway, and this has important implications both for meningococcal pathogenesis and for vaccine design. Here, we review the functional and structural properties of fHbp, the strategies that led to the design of the two fHbp-based vaccines and the data generated during clin. studies.
- 94Murgueitio, M. S.; Rakers, C.; Frank, A.; Wolber, G. Balancing Inflammation: Computational Design of Small-Molecule Toll-like Receptor Modulators. Trends Pharmacol. Sci. 2017, 38 (2), 155– 168, DOI: 10.1016/j.tips.2016.10.007[Crossref], [PubMed], [CAS], Google Scholar94https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XhslKnu7jK&md5=ba4f734c3604910c1f56ec6d6d3717f9Balancing Inflammation: Computational Design of Small-Molecule Toll-like Receptor ModulatorsMurgueitio, Manuela S.; Rakers, Christin; Frank, Anne; Wolber, GerhardTrends in Pharmacological Sciences (2017), 38 (2), 155-168CODEN: TPHSDY; ISSN:0165-6147. (Elsevier Ltd.)As essential proteins of the innate immune system, Toll-like receptors (TLRs) are involved in a plethora of physiol. pathologies and their modulation is an ongoing quest in the field of drug discovery. Although TLRs recognize an unusually broad range of different mol. patterns, only a few small-mol. TLR modulators have been reported to date. Recent advances in crystallog. and in silico techniques provide promising opportunities for TLR investigations and drug design. Here, three application areas for computational approaches are considered: (i) exploration of TLR structure and activation; (ii) understanding TLR modulation; and (iii) TLR drug discovery. By providing an overview on state-of-the-art computational methods, we highlight the value of mol. modeling in mechanistically understanding TLR function and guiding drug design.
- 95Cheng, K.; Gao, M.; Godfroy, J. I.; Brown, P. N.; Kastelowitz, N.; Yin, H. Specific Activation of the TLR1-TLR2 Heterodimer by Small-Molecule Agonists. Sci. Adv. 2015, 1 (3), e1400139, DOI: 10.1126/sciadv.1400139[Crossref], [PubMed], [CAS], Google Scholar95https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28Xht1Oqt7vP&md5=d072710e2bbaaab12f74abc7ac0e3868Specific activation of the TLR1-TLR2 heterodimer by small-molecule agonistsCheng, Kui; Gao, Meng; Godfroy, James I.; Brown, Peter N.; Kastelowitz, Noah; Yin, HangScience Advances (2015), 1 (3), e1400139/1-e1400139/12CODEN: SACDAF; ISSN:2375-2548. (American Association for the Advancement of Science)Toll-like receptor (TLR) agonists activate both the innate and the adaptive immune systems. These TLR agonists have been exploited as potent vaccine adjuvants and antitumor agents. We describe the identification and characterization of a small mol., N-methyl-4-nitro-2-(4-(4-(trifluoromethyl)phenyl)-1H-imidazol-1-yl)aniline (CU-T12-9), that directly targets TLR1/2 to initiate downstream signaling. CU-T12-9 specifically induces TLR1/2 activation, which can be blocked by either the anti-hTLR1 or the anti-hTLR2 antibody, but not the anti-hTLR6 antibody. Using a variety of different biophys. assays, we have demonstrated the binding mode of CU-T12-9. By binding to both TLR1 and TLR2, CU-T12-9 facilitates the TLR1/2 heterodimeric complex formation, which in turn activates the downstream signaling. Fluorescence anisotropy assays revealed competitive binding to the TLR1/2 complex between CU-T12-9 and Pam3CSK4 with a half-maximal inhibitory concn. (IC50) of 54.4 nM. Finally, we showed that CU-T12-9 signals through nuclear factor κB (NF-κB) and invokes an elevation of the downstream effectors tumor necrosis factor-α (TNF-α), interleukin-10 (IL-10), and inducible nitric oxide synthase (iNOS). Thus, our studies not only provide compelling new insights into the regulation of TLR1/2 signaling transduction but also may facilitate future therapeutic developments.
- 96Botos, I.; Segal, D. M.; Davies, D. R. The Structural Biology of Toll-like Receptors. Structure 2011, 19 (4), 447– 459, DOI: 10.1016/j.str.2011.02.004[Crossref], [PubMed], [CAS], Google Scholar96https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3MXksFyit78%253D&md5=7c71f872271b6b299a016bbc9f44ec80The Structural Biology of Toll-like ReceptorsBotos, Istvan; Segal, David M.; Davies, David R.Structure (Cambridge, MA, United States) (2011), 19 (4), 447-459CODEN: STRUE6; ISSN:0969-2126. (Cell Press)A review. The membrane-bound Toll-like receptors (TLRs) trigger innate immune responses after recognition of a wide variety of pathogen-derived compds. Despite the wide range of ligands recognized by TLRs, the receptors share a common structural framework in their extracellular, ligand-binding domains. These domains all adopt horseshoe-shaped structures built from leucine-rich repeat motifs. Typically, on ligand binding, two extracellular domains form an "m"-shaped dimer sandwiching the ligand mol. bringing the transmembrane and cytoplasmic domains in close proximity and triggering a downstream signaling cascade. Although the ligand-induced dimerization of these receptors has many common features, the nature of the interactions of the TLR extracellular domains with their ligands varies markedly between TLR paralogs.
- 97Hu, Z.; Banothu, J.; Beesu, M.; Gustafson, C. J.; Brush, M. J. H.; Trautman, K. L.; Salyer, A. C. D.; Pathakumari, B.; David, S. A. Identification of Human Toll-like Receptor 2 - Agonistic Activity in Dihydropyridine – Quinolone Carboxamides. ACS Med. Chem. Lett. 2019, 10, 132– 136, DOI: 10.1021/acsmedchemlett.8b00540[ACS Full Text], [CAS], Google Scholar97https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXisFKitLfE&md5=fdb3779fa549649651f4aa8026e7a13dIdentification of Human Toll-like Receptor 2-Agonistic Activity in Dihydropyridine-Quinolone CarboxamidesHu, Ziwei; Banothu, Janardhan; Beesu, Mallesh; Gustafson, Collin J.; Brush, Michael J. H.; Trautman, Kathryn L.; Salyer, Alex C. D.; Pathakumari, Balaji; David, Sunil A.ACS Medicinal Chemistry Letters (2019), 10 (1), 132-136CODEN: AMCLCT; ISSN:1948-5875. (American Chemical Society)Using a multiplexed, reporter gene-based, high-throughput screen, we identified 9-fluoro-7-hydroxy-3-methyl-5-oxo-N-(pyridin-3-ylmethyl)-2,3-dihydro-1H,5H-pyrido[3,2,1-ij]quinoline-6-carboxamide as a TLR2 agonist. Preliminary structure-activity relationship studies on the carboxamide moiety led to the identification of analogs that induce chemokines and cytokines in a TLR2-dependent manner. These results represent new leads for the development of vaccine adjuvants.
- 98Ribes, S.; Adam, N.; Ebert, S.; Regen, T.; Bunkowski, S.; Hanisch, U. K.; Nau, R. The Viral TLR3 Agonist Poly(I:C) Stimulates Phagocytosis and Intracellular Killing of Escherichia Coli by Microglial Cells. Neurosci. Lett. 2010, 482 (1), 17– 20, DOI: 10.1016/j.neulet.2010.06.078[Crossref], [PubMed], [CAS], Google Scholar98https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3cXhtVeht7rF&md5=a649e8cdd932760121555bbb99a9ba4bThe viral TLR3 agonist poly(I:C) stimulates phagocytosis and intracellular killing of Escherichia coli by microglial cellsRibes, Sandra; Adam, Nina; Ebert, Sandra; Regen, Tommy; Bunkowski, Stephanie; Hanisch, Uwe-Karsten; Nau, RolandNeuroscience Letters (2010), 482 (1), 17-20CODEN: NELED5; ISSN:0304-3940. (Elsevier Ireland Ltd.)A review. Stimulation of murine primary microglia with Toll-like receptor (TLR) agonists enhances their ability to phagocytose and kill bacteria. Here we show that the viral TLR3 agonist poly(I:C) stimulates the release of cyto-/chemokines and nitric oxide by microglia. Poly(I:C) increases microglial phagocytosis and intracellular killing of Escherichia coli K1, a pathogenic encapsulated bacterial strain, after 30 and 90 min of co-incubation. Stimulation with a viral epitope may strengthen the resistance of the brain to bacterial infections in vivo. Our data encourage animal expts. with poly(I:C) derivs. to assess whether this approach can increase the resistance of the CNS against bacterial infections.
- 99Molteni, M.; Gemma, S.; Rossetti, C. The Role of Toll-Like Receptor 4 in Infectious and Noninfectious Inflammation. Mediators Inflammation 2016, 2016, 6978936, DOI: 10.1155/2016/6978936[Crossref], [PubMed], [CAS], Google Scholar99https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC2s%252FpsFCktA%253D%253D&md5=2eb5be39fefa9201ffd703f2d3f112caThe Role of Toll-Like Receptor 4 in Infectious and Noninfectious InflammationMolteni Monica; Gemma Sabrina; Rossetti CarloMediators of inflammation (2016), 2016 (), 6978936 ISSN:.Toll-like receptor 4 (TLR4) belongs to the family of pattern recognition receptors (PRRs). They are highly conserved receptors that recognize conserved pathogen-associated molecular patterns (PAMPs), thus representing the first line of defense against infections. TLR4 has been long recognized as the sensing receptor for gram-negative lipopolysaccharide (LPS). In addition, it also binds endogenous molecules produced as a result of tissue injury. Hence, TLR4 represents a key receptor on which both infectious and noninfectious stimuli converge to induce a proinflammatory response. TLR4-mediated inflammation, triggered by exogenous or endogenous ligands, is also involved in several acute and chronic diseases, having a pivotal role as amplifier of the inflammatory response. This review focuses on the research progress about the role of TLR4 activation in infectious and noninfectious (e.g., sterile) inflammation and the effects of TLR4 signaling in some pathological conditions.
- 100Kumar, S.; Sunagar, R.; Gosselin, E. Bacterial Protein Toll-like-Receptor Agonists: A Novel Perspective on Vaccine Adjuvants. Front. Immunol. 2019, 10, 1144, DOI: 10.3389/fimmu.2019.01144[Crossref], [PubMed], [CAS], Google Scholar100https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhs1aiu7s%253D&md5=5951dbba0e55a7f0e40e1a4aac94b84aBacterial protein toll-like-receptor agonists: a novel perspective on vaccine adjuvantsKumar, Sudeep; Sunagar, Raju; Gosselin, EdmundFrontiers in Immunology (2019), 10 (), 1144CODEN: FIRMCW; ISSN:1664-3224. (Frontiers Media S.A.)Adjuvants have been used in vaccines for over a century, however, the search for safe and effective vaccine adjuvants continues. In recent decades toll-like-receptor (TLR) agonists have been investigated as potential vaccine adjuvants. In this regard, the majority of the currently investigated TLR agonists are non-protein microbial components such as lipopolysaccharides, oligonucleotides, and lipopeptides. On the other hand, a growing no. of studies reveal that TLR signaling and immune responses can be activated by numerous bacterial proteins. However, their potential roles as adjuvants have been somewhat overlooked. Herein, we discuss several such bacterial proteins which exhibit adjuvant properties, including the activation of TLR signaling, antigen presenting cell maturation, pro-inflammatory cytokine prodn. and adaptive immune response. The protein nature of these TLR agonists presents several unique features not shared by non-protein TLR agonists. These properties include the amenability for modifying the structure and function as necessary for optimal immunogenicity and minimal toxicity. Protein adjuvants can be genetically fused to protein antigens which ensure the co-delivery of adjuvant-antigen not only into the same cell but also in the same endocytic cargo, leading to more effective activation of innate and adaptive immune response.
- 101Needham, B. D.; Trent, M. S. Fortifying the Barrier: The Impact of Lipid A Remodelling on Bacterial Pathogenesis. Nat. Rev. Microbiol. 2013, 11, 467– 481, DOI: 10.1038/nrmicro3047[Crossref], [PubMed], [CAS], Google Scholar101https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXptValtrY%253D&md5=3e284d1c60e14246f886691001b5aba3Fortifying the barrier: the impact of lipid A remodelling on bacterial pathogenesisNeedham, Brittany D.; Trent, M. StephenNature Reviews Microbiology (2013), 11 (7), 467-481CODEN: NRMACK; ISSN:1740-1526. (Nature Publishing Group)A review. Gram-neg. bacteria decorate their outermost surface structure, lipopolysaccharide, with elaborate chem. moieties, which effectively disguises them from immune surveillance and protects them from the onslaught of host defences. Many of these changes occur on the lipid A moiety of lipopolysaccharide, a component that is crucial for host recognition of Gram-neg. infection. In this Review, we describe the regulatory mechanisms controlling lipid A modification and discuss the impact of modifications on pathogenesis, bacterial physiol. and bacterial interactions with the host immune system.
- 102Fensterheim, B. A.; Young, J. D.; Luan, L.; Kleinbard, R. R.; Stothers, C. L.; Patil, N. K.; Mcatee-pereira, A. G.; Guo, Y.; Trenary, I.; Hernandez, A.; Fults, J. B.; Williams, D. L.; Sherwood, E. R.; Bohannon, J. K. The TLR4 Agonist Monophosphoryl Lipid A Drives Broad Resistance to Infection via Dynamic Reprogramming of Macrophage Metabolism. J. Immunol. 2018, 200, 3777– 3789, DOI: 10.4049/jimmunol.1800085[Crossref], [PubMed], [CAS], Google Scholar102https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXpslOns7o%253D&md5=01f42d89e2f4e1f33d5228360d4572a1The TLR4 Agonist Monophosphoryl Lipid A Drives Broad Resistance to Infection via Dynamic Reprogramming of Macrophage MetabolismFensterheim, Benjamin A.; Young, Jamey D.; Luan, Liming; Kleinbard, Ruby R.; Stothers, Cody L.; Patil, Naeem K.; McAtee-Pereira, Allison G.; Guo, Yin; Trenary, Irina; Hernandez, Antonio; Fults, Jessica B.; Williams, David L.; Sherwood, Edward R.; Bohannon, Julia K.Journal of Immunology (2018), 200 (11), 3777-3789CODEN: JOIMA3; ISSN:0022-1767. (American Association of Immunologists)Monophosphoryl lipid A (MPLA) is a clin. used TLR4 agonist that has been found to drive nonspecific resistance to infection for up to 2 wk. However, the mol. mechanisms conferring protection are not well understood. In this study, we found that MPLA prompts resistance to infection, in part, by inducing a sustained and dynamic metabolic program in macrophages that supports improved pathogen clearance. Mice treated with MPLA had enhanced resistance to infection with Staphylococcus aureus and Candida albicans that was assocd. with augmented microbial clearance and organ protection. Tissue macrophages, which exhibited augmented phagocytosis and respiratory burst after MPLA treatment, were required for the beneficial effects of MPLA. Further anal. of the macrophage phenotype revealed that early TLR4-driven aerobic glycolysis was later coupled with mitochondrial biogenesis, enhanced malate shuttling, and increased mitochondrial ATP prodn. This metabolic program was initiated by overlapping and redundant contributions of MyD88- and TRIF-dependent signaling pathways as well as downstream mTOR activation. Blockade of mTOR signaling inhibited the development of the metabolic and functional macrophage phenotype and ablated MPLA-induced resistance to infection in vivo. Our findings reveal that MPLA drives macrophage metabolic reprogramming that evolves over a period of days to support a macrophage phenotype highly effective at mediating microbe clearance and that this results in nonspecific resistance to infection.
- 103Bowen, W. S.; Minns, L. A.; Johnson, D. A.; Mitchell, T. C.; Hutton, M. M.; Evans, J. T. Selective TRIF-Dependent Signaling by a Synthetic Toll-Like Receptor 4 Agonist. Sci. Signaling 2012, 5 (211), ra13, DOI: 10.1126/scisignal.2001963
- 104Garcia, M. M.; Goicoechea, C.; Molina-Álvarez, M.; Pascual, D. Toll-like Receptor 4: A Promising Crossroads in the Diagnosis and Treatment of Several Pathologies. Eur. J. Pharmacol. 2020, 874, 172975, DOI: 10.1016/j.ejphar.2020.172975[Crossref], [PubMed], [CAS], Google Scholar104https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXjtFCjsrs%253D&md5=12b7076a514fc843103578e1b9b0ce0dToll-like receptor 4: A promising crossroads in the diagnosis and treatment of several pathologiesGarcia, Miguel M.; Goicoechea, Carlos; Molina-Alvarez, Miguel; Pascual, DavidEuropean Journal of Pharmacology (2020), 874 (), 172975CODEN: EJPHAZ; ISSN:0014-2999. (Elsevier B.V.)Toll-like receptor 4 (TLR4) is expressed in a wide variety of cells and is the central component of the mammalian innate immune system. Precisely, the finding of conserved sequence homol. among species along with the mol. and functional characterization of the TLR4 gene enabled researchers to envisage a common operating system in the activation of innate immunity and the initiation of plastic changes at the onset of chronic pain. Malfunctioning in other conditions was conceived in parallel. In this respect, "pivot" proteins and pathway redundancy are not just evolutionary leftovers but essential for normal functioning or cell survival. Indeed, at present, TLR4 single nucleotide polymorphisms (SNP) and their assocn. with certain dysfunctions and diseases are being confirmed in different pools of patients. However, despite its ability to trigger pathogen infection or alternatively tissue injury communications to immune system, TLR4 targeting might not be considered a panacea. This review article represents a compilation of what we know about TLR4 from clinics and basic research on the 20th anniversary of its discovery. Understanding how to fine-tune the interaction between TLR4 and its specific ligands may lead in the next decades to the development of promising new treatments, reducing polypharmacy and probably having an impact on drug use in numerous pathologies.
- 105Yang, J.; Yan, H. TLR5: Beyond the Recognition of Flagellin. Cell. Mol. Immunol. 2017, 14, 1017– 1019, DOI: 10.1038/cmi.2017.122[Crossref], [PubMed], [CAS], Google Scholar105https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXhvFSmsrfL&md5=ef95bbd5b1f36740a4537aa9738940d6TLR5: beyond the recognition of flagellinYang, Jingyi; Yan, HuiminCellular & Molecular Immunology (2017), 14 (12), 1017-1019CODEN: CMIEAO; ISSN:1672-7681. (Nature Research)The innate immune system plays an essential role in the host defense against infections by initially sensing and recognizing diverse microbial pathogens and directing adaptive immune responses to their infections.
- 106Song, W. S.; Jeon, Y. J.; Namgung, B.; Hong, M.; Yoon, S. Il. A Conserved TLR5 Binding and Activation Hot Spot on Flagellin. Sci. Rep. 2017, 7, 40878, DOI: 10.1038/srep40878[Crossref], [PubMed], [CAS], Google Scholar106https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXhsFamsrk%253D&md5=3515af1f8c2672830128bd47592532a4A conserved TLR5 binding and activation hot spot on flagellinSong, Wan Seok; Jeon, Ye Ji; Namgung, Byeol; Hong, Minsun; Yoon, Sung-ilScientific Reports (2017), 7 (), 40878CODEN: SRCEC3; ISSN:2045-2322. (Nature Publishing Group)Flagellin is a bacterial protein that polymerizes into the flagellar filament and is essential for bacterial motility. When flagellated bacteria invade the host, flagellin is recognized by Toll-like receptor 5 (TLR5) as a pathogen invasion signal and eventually evokes the innate immune response. Here, we provide a conserved structural mechanism by which flagellins from Gram-neg. γ-proteobacteria and Gram-pos. Firmicutes bacteria bind and activate TLR5. The comparative structural anal. using our crystal structure of a complex between Bacillus subtilis flagellin (bsflagellin) and TLR5 at 2.1 Å resoln., combined with the alanine scanning anal. of the binding interface, reveals a common hot spot in flagellin for TLR5 activation. An arginine residue (bsflagellin R89) of the flagellin D1 domain and its adjacent residues (bsflagellin E114 and L93) constitute a hot spot that provides shape and chem. complementarity to a cavity generated by the loop of leucine-rich repeat 9 in TLR5. In addn. to the flagellin D1 domain, the D0 domain also contributes to TLR5 activity through structurally dispersed regions, but not a single focal area. These results establish the groundwork for the future design of flagellin-based therapeutics.
- 107Taylor, D. N.; Treanor, J. J.; Strout, C.; Johnson, C.; Fitzgerald, T.; Kavita, U.; Ozer, K.; Tussey, L.; Shaw, A. Induction of a Potent Immune Response in the Elderly Using the TLR-5 Agonist, Flagellin, with a Recombinant Hemagglutinin Influenza-Flagellin Fusion Vaccine (VAX125, STF2.HA1 SI). Vaccine 2011, 29 (31), 4897– 4902, DOI: 10.1016/j.vaccine.2011.05.001[Crossref], [PubMed], [CAS], Google Scholar107https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3MXotl2ltL8%253D&md5=cfde3d5ce936071e57480bd9c734fefcInduction of a potent immune response in the elderly using the TLR-5 agonist, flagellin, with a recombinant hemagglutinin influenza-flagellin fusion vaccine (VAX125, STF2.HA1 SI)Taylor, David N.; Treanor, John J.; Strout, Cynthia; Johnson, Casey; Fitzgerald, Theresa; Kavita, Uma; Ozer, Karen; Tussey, Lynda; Shaw, AlanVaccine (2011), 29 (31), 4897-4902CODEN: VACCDE; ISSN:0264-410X. (Elsevier Ltd.)Background: Influenza vaccines perform poorly in the elderly with reduced serol. response and vaccine efficacy. We evaluated a novel influenza vaccine consisting of the globular head of the HA1 domain of the A/Solomon Islands/3/2006 (H1N1) influenza virus (VAX125) genetically fused to the TLR5 ligand, flagellin, and produced in Escherichia coli. Methods: 120 subjects ≥65 years old were enrolled at three clin. centers. VAX125 vaccine was administered at doses of 0.5, 1, 2, 3, 5 or 8 μg delivered i.m. as a single dose vaccination on Day 0 using a dose-escalation with 20 subjects in each dose level. Subjects were followed for adverse events and sera were tested by hemagglutination-inhibition (HAI) against egg-grown virus on days 0, 7, 14, and 28. Serum C-reactive protein (CRP) and anti-flagellin antibody were also assessed. Results: The mean age was 71 years. The vaccine was well tolerated at all dose levels, with no more than mild to moderate local or systemic symptoms. The geometric mean titers (GMT) increased in all dose groups. In the 5 μg group the day 14 post-vaccination HAI titer was 1:226 showing a 12-fold increase over baseline. The 8 μg group showed a similar post-vaccination GMT increase (∼8-fold). In the combined 5 and 8 μg groups, the seroconversion rate was 75% and the seroprotection rate was 98%. Conclusions: A 5 μg dose of VAX125 was safe and able to induce a greater than 10-fold increase HAI antibody levels and nearly complete seroprotection in subjects over 65 years old. The use of flagellin to adjuvant influenza vaccines via the TLR5 innate immune pathway appears to be a useful approach to overcome poor immune responses in the elderly. VAX125 is a promising new candidate for prevention of influenza A disease in both young adults and the elderly.
- 108Yan, L.; Liang, J.; Yao, C.; Wu, P.; Zeng, X.; Cheng, K.; Yin, H. Pyrimidine Triazole Thioether Derivatives as Toll-Like Receptor 5 (TLR5)/Flagellin Complex Inhibitors. ChemMedChem 2016, 11 (8), 822– 826, DOI: 10.1002/cmdc.201500471[Crossref], [PubMed], [CAS], Google Scholar108https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXhvFGjtL3L&md5=28495e1bd35a0f5559977bccfc0655ddPyrimidine Triazole Thioether Derivatives as Toll-Like Receptor 5 (TLR5)/Flagellin Complex InhibitorsYan, Lei; Liang, Jiaqi; Yao, Chengbo; Wu, Peiyao; Zeng, Xianfeng; Cheng, Kui; Yin, HangChemMedChem (2016), 11 (8), 822-826CODEN: CHEMGX; ISSN:1860-7179. (Wiley-VCH Verlag GmbH & Co. KGaA)Protein-protein interactions have been regarded as "undruggable" despite their importance in many biol. processes. The complex formed between host toll-like receptor 5 (TLR5) and flagellin, a globular protein that is the main component of a bacterial flagellum, plays a vital role in a no. of pathogen defenses, immunol. diseases and cancers. Through high-throughput screening, we identified two hits with a common pharmacophore, which were used to successfully develop a series of small-mol. probes as novel inhibitors of flagellin binding to TLR5. In a multitude of assays, 4-((4-benzyl-5-(pyridin4yl)-4H-1,2,4-triazol-3-yl)thio)pyrido[3',2':4,5]thieno[3,2-d]pyrimidine (TH1020) was identified as a potent antagonist of TLR5 signaling with promising activity (IC50=0.85±0.12 μM) and specificity. Furthermore, TH1020 was shown to repress the expression of downstream TNF-α signaling pathways mediated by the TLR5/flagellin complex formation. Based on mol. docking simulation, TH1020 is suggested to compete with flagellin and disrupt its assocn. with TLR5. TH1020 provides a much-needed mol. probe for studying this important protein-protein interaction and a lead compd. for identifying novel therapeutics targeting TLR5.
- 109Kauppila, J. H.; Mattila, A. E.; Karttunen, T. J.; Salo, T. Toll-like Receptor 5 and the Emerging Role of Bacteria in Carcinogenesis. Oncoimmunology 2013, 2 (4), e23620, DOI: 10.4161/onci.23620
- 110Yazar, V.; Kilic, G.; Bulut, O.; Canavar Yildirim, T.; Yagci, F. C; Aykut, G.; Klinman, D. M; Gursel, M.; Gursel, I. A Suppressive Oligodeoxynucleotide Expressing TTAGGG Motifs Modulates Cellular Energetics through the MTOR Signaling Pathway. Int. Immunol. 2020, 32 (1), 39– 48, DOI: 10.1093/intimm/dxz059[Crossref], [PubMed], [CAS], Google Scholar110https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhslSktLvK&md5=24aaa3626028ed79bfe8ccdee53025ccA suppressive oligodeoxynucleotide expressing TTAGGG motifs modulates cellular energetics through the mTOR signaling pathwayYazar, Volkan; Kilic, Gizem; Bulut, Ozlem; Yildirim, Tugce Canavar; Yagci, Fuat C.; Aykut, Gamze; Klinman, Dennis M.; Gursel, Mayda; Gursel, IhsanInternational Immunology (2020), 32 (1), 39-48CODEN: INIMEN; ISSN:1460-2377. (Oxford University Press)Immune-mediated inflammation must be down-regulated to facilitate tissue remodeling during homeostatic restoration of an inflammatory response. Uncontrolled or over-exuberant immune activation can cause autoimmune diseases, as well as tissue destruction. A151, the archetypal example of a chem. synthesized suppressive oligodeoxynucleotide (ODN) based on repetitive telomere-derived TTAGGG sequences, was shown to successfully down-regulate a variety of immune responses. However, the degree, duration and breadth of A151-induced transcriptome alterations remain elusive. Here, we performed a comprehensive microarray anal. in combination with Ingenuity Pathway Anal. (IPA) using murine splenocytes to investigate the underlying mechanism of A151-dependent immune suppression. Our results revealed that A151 significantly down-regulates crit. mammalian target of rapamycin (mTOR) activators (Pi3kcd, Pdpk1 and Rheb), elements downstream of mTOR signaling (Rps6ka1, Myc, Stat3 and Slc2a1), an important component of the mTORC2 protein complex (Rictor) and Mtor itself. The effects of A151 on mTOR signaling were dose- and time-dependent. Moreover, flow cytometry and immunoblotting analyses demonstrated that A151 is able to reverse mTOR phosphorylation comparably to the well-known mTOR inhibitor rapamycin. Furthermore, Seahorse metabolic assays showed an A151 ODN-induced decrease in both oxygen consumption and glycolysis implying that a metabolically inert state in macrophages could be triggered by A151 treatment. Overall, our findings suggested novel insights into the mechanism by which the immune system is metabolically modulated by A151 ODN.
- 111Relitti, N.; Saraswati, A. P.; Federico, S.; Khan, T.; Brindisi, M.; Zisterer, D.; Brogi, S.; Gemma, S.; Butini, S.; Campiani, G. Telomerase-Based Cancer Therapeutics: A Review on Their Clinical Trials. Curr. Top. Med. Chem. 2020, 20 (6), 433– 457, DOI: 10.2174/1568026620666200102104930[Crossref], [PubMed], [CAS], Google Scholar111https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXosVektbg%253D&md5=a73a8e16434993551ca487423068db35Telomerase-based Cancer Therapeutics: A Review on their Clinical TrialsRelitti, Nicola; Saraswati, Akella P.; Federico, Stefano; Khan, Tuhina; Brindisi, Margherita; Zisterer, Daniela; Brogi, Simone; Gemma, Sandra; Butini, Stefania; Campiani, GiuseppeCurrent Topics in Medicinal Chemistry (Sharjah, United Arab Emirates) (2020), 20 (6), 433-457CODEN: CTMCCL; ISSN:1568-0266. (Bentham Science Publishers Ltd.)A review. Telomeres are protective chromosomal ends that shield the chromosomes from DNA damage, exonucleolytic degrdn., recombination, and end-to-end fusion. Telomerase is a ribonucleoprotein that adds TTAGGG tandem repeats to the telomeric ends. It has been obsd. that 85 to 90% of human tumors express high levels of telomerase, playing a crucial role in the development of cancers. Interestingly, the telomerase activity is generally absent in normal somatic cells. This selective telomerase expression has driven scientists to develop novel anti-cancer therapeutics with high specificity and potency. Several advancements have been made in this area, which is reflected by the enormous success of the anticancer agent Imetelstat. Since the discovery of Imetelstat, several research groups have contributed to enrich the therapeutic arsenal against cancer. Such contributions include the application of new classes of small mols., peptides, and hTERT-based immunotherapeutic agents (p540, GV1001, GRNVAC1 or combinations of these such as Vx-001). Many of these therapeutic tools are under different stages of clin. trials and have shown promising outcomes. In this review, we highlight the current status of telomerase-based cancer therapeutics and the outcome of these investigations.
- 112Saraswati, A. P.; Relitti, N.; Brindisi, M.; Gemma, S.; Zisterer, D.; Butini, S.; Campiani, G. Raising the Bar in Anticancer Therapy: Recent Advances in, and Perspectives on, Telomerase Inhibitors. Drug Discovery Today 2019, 24 (7), 1370– 1388, DOI: 10.1016/j.drudis.2019.05.015[Crossref], [PubMed], [CAS], Google Scholar112https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhtVOgu7%252FJ&md5=17a0dff2d5905cf91e7651d5edbbbc1eRaising the bar in anticancer therapy: recent advances in, and perspectives on, telomerase inhibitorsSaraswati, A. Prasanth; Relitti, Nicola; Brindisi, Margherita; Gemma, Sandra; Zisterer, Daniela; Butini, Stefania; Campiani, GiuseppeDrug Discovery Today (2019), 24 (7), 1370-1388CODEN: DDTOFS; ISSN:1359-6446. (Elsevier Ltd.)A review. Telomerase is a ribonucleic reverse transcriptase enzyme that uses an integral RNA component as a template to add tandem telomeric DNA repeats, TTAGGG, at the 3' end of the chromosomes. 85-90% of human tumors and their derived cell lines predominantly express high levels of telomerase, therefore contributing to cancer cell development. However, in normal cells, telomerase activity is almost always absent except in germ cells and stem cells. This differential expression has been exploited to develop highly specific and potent cancer therapeutics. In this review, it outline recent advances in the development of telomerase inhibitors as anticancer agents.
- 113Golenkina, E. A.; Viryasova, G. M.; Dolinnaya, N. G.; Bannikova, V. A.; Gaponova, T. V.; Romanova, Y. M.; Sud'ina, G. F. The Potential of Telomeric G-Quadruplexes Containing Modified Oligoguanosine Overhangs in Activation of Bacterial Phagocytosis and Leukotriene Synthesis in Human Neutrophils. Biomolecules 2020, 10, 249, DOI: 10.3390/biom10020249[Crossref], [CAS], Google Scholar113https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXktVyms70%253D&md5=254d654b9ed21b503feea01666799a69The potential of telomeric G-quadruplexes containing modified oligoguanosine overhangs in activation of bacterial phagocytosis and leukotriene synthesis in human neutrophilsGolenkina, Ekaterina A.; Viryasova, Galina M.; Dolinnaya, Nina G.; Bannikova, Valeria A.; Gaponova, Tatjana V.; Romanova, Yulia M.; Sud'ina, Galina F.Biomolecules (2020), 10 (2), 249CODEN: BIOMHC; ISSN:2218-273X. (MDPI AG)Using HPLC anal., flow cytometry, and other biochem. methods, we studied the effect of synthetic oligodeoxyribonucleotides (ODNs) able to fold into G-quadruplex structures on the main functions of neutrophils. Designed ODNs contained four human telomere TTAGGG repeats (G4) including those with phosphorothioate oligoguanosines attached to the end(s) of G-quadruplex core. Just modified analogs of G4 was shown to more actively than parent ODN penetrate into cells, improve phagocytosis of Salmonella typhimurium bacteria, affect 5-LOX activation, the cytosol calcium ion level, and the oxidative status of neutrophils. As evident from CD and UV spectroscopy data, the presence of oligoguanosines flanking G4 sequence leads to dramatic changes in G-quadruplex topol. While G4 folds into a single antiparallel structure, two main folded forms have been identified in solns. of modified ODNs: antiparallel and dominant, more stable parallel. Thus, both the secondary structure of ODNs and their ability to penetrate into the cytoplasm of cells are important for the activation of neutrophil cellular effects. Our results offer new clues for understanding the role of G-quadruplex ligands in regulation of integral cellular processes and for creating the antimicrobial agents of a new generation.
- 114Yeh, D.-W.; Lai, C.-Y.; Liu, Y.-L.; Lu, C.-H.; Tseng, P.-H.; Yuh, C.-H.; Yu, G.-Y.; Liu, S.-J.; Leng, C.-H.; Chuang, T.-H. CpG-Oligodeoxynucleotides Developed for Grouper Toll-like Receptor (TLR) 21s Effectively Activate Mouse and Human TLR9s Mediated Immune Responses. Sci. Rep. 2017, 7, 17297, DOI: 10.1038/s41598-017-17609-2[Crossref], [PubMed], [CAS], Google Scholar114https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC1MzgsVWnug%253D%253D&md5=baf8d3e7e70c9a031537dd188224d791CpG-oligodeoxynucleotides developed for grouper toll-like receptor (TLR) 21s effectively activate mouse and human TLR9s mediated immune responsesYeh Da-Wei; Lai Chao-Yang; Liu Yi-Ling; Lu Chih-Hao; Chuang Tsung-Hsien; Lu Chih-Hao; Tseng Ping-Hui; Yuh Chiou-Hwa; Yu Guann-Yi; Liu Shih-Jen; Leng Chih-Hsiang; Chuang Tsung-HsienScientific reports (2017), 7 (1), 17297 ISSN:.Synthetic phosphorothiolate-modified CpG-oligodeoxynucleotides (CpG-ODNs) are potent immune stimuli. Toll-like receptor (TLR) 9 and TLR21 are their cellular receptors in different species. The structural requirements for CpG-ODN to strongly activate TLR9 have been relatively well studied, but studies on TLR21 are in their infancy. Therefore, in this study, we investigated the interaction between CpG-ODNs and TLR21s from groupers (Epinephelus spp.), which are economically important fish species. We cloned the cDNA of giant grouper (E. lanceolatus) TLR21, and compared its sequence with orange-spotted grouper (E. coioides) TLR21A and TLR21B. These three receptors were activated by CpG-ODNs containing the GTCGTT motif but not by those containing the GACGTT motif. We developed two CpG-ODNs that contained 19 phosphorothiolated deoxynucleotides with one or two GTCGTT motifs. These CpG-ODNs had better activity on grouper TLR21s than currently developed CpG-ODNs, and produced similar immune stimulatory profiles when applied to cells isolated from orange-spotted grouper. The developed CpG-ODNs also effectively activated both human and mouse TLR9-mediated NF-κB activation and cytokine productions. These findings suggest that the GTCGTT motif is required for CpG-ODNs to activate grouper TLR21s, and that the CpG-ODNs that were developed for grouper TLR21s contain structures that effectively activate human and mouse TLR9s.
- 115Mohamed, W.; Domann, E.; Chakraborty, T.; Mannala, G.; Lips, K. S.; Heiss, C.; Schnettler, R.; Alt, V. TLR9Mediates S. Aureus Killing inside Osteoblasts via Induction of Oxidative Stress. BMC Microbiol. 2016, 16, 230, DOI: 10.1186/s12866-016-0855-8[Crossref], [PubMed], [CAS], Google Scholar115https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXlsFCi&md5=4a08d03b142012c742fb41a54e6542b2TLR9 mediates S. aureus killing inside osteoblasts via induction of oxidative stressMohamed, Walid; Domann, Eugen; Chakraborty, Trinad; Mannala, Gopala; Lips, Katrin S.; Heiss, Christian; Schnettler, Reinhard; Alt, VolkerBMC Microbiology (2016), 16 (), 230/1-230/8CODEN: BMMIBC; ISSN:1471-2180. (BioMed Central Ltd.)Background:Staphylococcus aureus is the principle causative pathogen of osteomyelitis and implant-assocd. bone infections. It is able to invade and to proliferate inside osteoblasts thus avoiding antibiotic therapy and the host immune system. Therefore, development of alternative approaches to stimulate host innate immune responses could be beneficial in prophylaxis against S. aureus infection. TLR9 is the intracellular receptor which recognizes unmethylated bacterial CpG-DNA and activates immune cells. Synthetic CpG-motifs contg. oligodeoxynucleotide (CpG-ODNs) mimics the stimulatory effect of bacterial DNA. Results: Osteoblast-like SAOS-2 cells were pretreated with CpG-ODN type-A 2216, type-B 2006, or neg. CpG-ODN 2243 (neg. control) 4 h before infection with S. aureus isolate EDCC 5055 (= DSM 28763). Intracellular bacteria were streaked on BHI plates 4 h and 20 h after infection. ODN2216 as well as ODN2006 but not ODN2243 were able to significantly inhibit the intracellular bacterial growth because about 31 % as well as 43 % of intracellular S. aureus could survive the pretreatment of SAOS-2 cells with ODN2216 or ODN2006 resp. 4 h and 20 h post-infection. RT-PCR anal. of cDNAs from SAOS-2 cells showed that pretreatment with ODN2216 or ODN2006 stimulated the expression of TLR9. Pretreatment of SAOS-2 cells with ODN2216 or ODN2006 but not ODN2243 managed to induce reactive oxygen species (ROS) prodn. inside osteoblasts as measured by flow cytometry anal. Moreover, treating SAOS-2 cells with the antioxidant Diphenyleneiodonium (DPI) obviously reduced S. aureus killing ability of TLR9 agonists mediated by oxidative stress. Conclusions: In this work we demonstrated for the first time that CPG-ODNs have inhibitory effects on S. aureus survival inside SAOS-2 osteoblast-like cell line. This effect was attributed to stimulation of TLR9 and subsequent induction of oxidative stress. Pretreatment of infected SAOS-2 cells with ROS inhibitors resulted in the abolishment of the CPG-ODNs killing effects.
- 116Kim, T. H.; Kim, D.; Lee, H.; Kwak, M. H.; Park, S.; Lee, Y.; Kwon, H. J. CpG-DNA Induces Bacteria-Reactive IgM Enhancing Phagocytic Activity against Staphylococcus Aureus Infection. BMB Rep. 2019, 52 (11), 635– 640, DOI: 10.5483/BMBRep.2019.52.11.018[Crossref], [PubMed], [CAS], Google Scholar116https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhsVCiur0%253D&md5=c86afb6a22dc1ca77abf7d2268475d80CpG-DNA induces bacteria-reactive IgM enhancing phagocytic activity against Staphylococcus aureus infectionKim, Te Ha; Kim, Dongbum; Lee, Heesu; Kwak, Min Hyung; Park, Sangkyu; Lee, Younghee; Kwon, Hyung-JooBMB Reports (2019), 52 (11), 635-640CODEN: BRMEC2; ISSN:1976-670X. (Korean Society for Biochemistry and Molecular Biology)CpG-DNA triggers the proliferation and differentiation of B cells which results in the increased prodn. of antibodies. The presence of bacteria-reactive IgM in normal serum was reported; however, the relevance of CpG-DNA with the prodn. of bacteria-reactive IgM has not been investigated. Here, we proved the function of CpG-DNA for the prodn. of bacteria-reactive IgM. CpG-DNA administration led to increased prodn. of bacteria-reactive IgM both in the peritoneal fluid and serum through TLR9 signaling pathway. When we stimulated B cells with CpG-DNA, prodn. of bacteria-reactive IgM was reproduced in vitro. We established a bacteria-reactive monoclonal IgM antibody using CpG-DNA stimulated-peritoneal B cells. The monoclonal IgM antibody enhanced the phagocytic activity of RAW 264.7 cells against S. aureus MW2 infection. Therefore, we suggest that CpG-DNA enhances the antibacterial activity of the immune system by triggering the prodn. of bacteria-reactive IgM. We also suggest the possible application of the antibodies for the treatment of antibiotics-resistant bacterial infections.
- 117Duggan, J. M.; You, D.; Cleaver, J. O.; Larson, D. T.; Garza, R. J.; Guzmán Pruneda, F. A.; Tuvim, M. J.; Zhang, J.; Dickey, B. F.; Evans, S. E. Synergistic Interactions of TLR2/6 and TLR9 Induce a High Level of Resistance to Lung Infection in Mice. J. Immunol. 2011, 186 (10), 5916– 5926, DOI: 10.4049/jimmunol.1002122[Crossref], [PubMed], [CAS], Google Scholar117https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3MXlsFGrs7c%253D&md5=01f350dfb8e265cd9cf4995fe5bfb3fcSynergistic Interactions of TLR2/6 and TLR9 Induce a High Level of Resistance to Lung Infection in MiceDuggan, Jeffrey M.; You, Dahui; Cleaver, Jeffrey O.; Larson, Derek T.; Garza, R. Joshua; Guzman Pruneda, Francisco A.; Tuvim, Michael J.; Zhang, Jiexin; Dickey, Burton F.; Evans, Scott E.Journal of Immunology (2011), 186 (10), 5916-5926CODEN: JOIMA3; ISSN:0022-1767. (American Association of Immunologists)Infectious pneumonias exact an unacceptable mortality burden worldwide. Efforts to protect populations from pneumonia have focused historically on antibiotic development and vaccine-enhanced adaptive immunity. However, we have reported recently that the lungs' innate defenses can be induced therapeutically by inhalation of a bacterial lysate that protects mice against otherwise lethal pneumonia. In this study, we tested in mice the hypothesis that TLRs are required for this antimicrobial phenomenon and found that resistance could not be induced in the absence of the TLR signaling adaptor protein MyD88. We then attempted to recapitulate the protection afforded by the bacterial lysate by stimulating the lung epithelium with aerosolized synthetic TLR ligands. Although most single or combination treatments yielded no protection, simultaneous treatment with ligands for TLR2/6 and TLR9 conferred robust, synergistic protection against virulent Gram-pos. and Gram-neg. pathogens. Protection was assocd. with rapid pathogen killing in the lungs, and pathogen killing could be induced from lung epithelial cells in isolation. Taken together, these data demonstrate the requirement for TLRs in inducible resistance against pneumonia, reveal a remarkable, unanticipated synergistic interaction of TLR2/6 and TLR9, reinforce the emerging evidence supporting the antimicrobial capacity of the lung epithelium, and may provide the basis for a novel clin. therapeutic that can protect patients against pneumonia during periods of peak vulnerability.
- 118Savva, A.; Roger, T. TargetingToll-like Receptors : Promising Therapeutic Strategies for the Management of Sepsis-Associated Pathology and Infectious Diseases. Front. Immunol. 2013, 4, 387, DOI: 10.3389/fimmu.2013.00387[Crossref], [PubMed], [CAS], Google Scholar118https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC2cflsVWqtQ%253D%253D&md5=eb36f62cd3e4f15c96fe1568384a7484Targeting toll-like receptors: promising therapeutic strategies for the management of sepsis-associated pathology and infectious diseasesSavva Athina; Roger ThierryFrontiers in immunology (2013), 4 (), 387 ISSN:1664-3224.Toll-like receptors (TLRs) are pattern recognition receptors playing a fundamental role in sensing microbial invasion and initiating innate and adaptive immune responses. TLRs are also triggered by danger signals released by injured or stressed cells during sepsis. Here we focus on studies developing TLR agonists and antagonists for the treatment of infectious diseases and sepsis. Positioned at the cell surface, TLR4 is essential for sensing lipopolysaccharide of Gram-negative bacteria, TLR2 is involved in the recognition of a large panel of microbial ligands, while TLR5 recognizes flagellin. Endosomal TLR3, TLR7, TLR8, TLR9 are specialized in the sensing of nucleic acids produced notably during viral infections. TLR4 and TLR2 are favorite targets for developing anti-sepsis drugs, and antagonistic compounds have shown efficient protection from septic shock in pre-clinical models. Results from clinical trials evaluating anti-TLR4 and anti-TLR2 approaches are presented, discussing the challenges of study design in sepsis and future exploitation of these agents in infectious diseases. We also report results from studies suggesting that the TLR5 agonist flagellin may protect from infections of the gastrointestinal tract and that agonists of endosomal TLRs are very promising for treating chronic viral infections. Altogether, TLR-targeted therapies have a strong potential for prevention and intervention in infectious diseases, notably sepsis.
- 119Kuzmich, N. N.; Sivak, K. V.; Chubarev, V. N.; Porozov, Y. B.; Savateeva-lyubimova, T. N.; Peri, F. TLR4 Signaling Pathway Modulators as Potential Therapeutics in Inflammation and Sepsis. Vaccines 2017, 5, 34, DOI: 10.3390/vaccines5040034[Crossref], [CAS], Google Scholar119https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXitlOqt7vI&md5=df54d2a888ef4afdd58307ae5edee984TLR4 signaling pathway modulators as potential therapeutics in inflammation and sepsisKuzmich, Nikolay N.; Sivak, Konstantin V.; Chubarev, Vladimir N.; Porozov, Yury B.; Savateeva-Lyubimova, Tatiana N.; Peri, FrancescoVaccines (Basel, Switzerland) (2017), 5 (4), 34/1-34/25CODEN: VBSABP; ISSN:2076-393X. (MDPI AG)Toll-Like Receptor 4 (TLR4) signal pathway plays an important role in initiating the innate immune response and its activation by bacterial endotoxin is responsible for chronic and acute inflammatory disorders that are becoming more and more frequent in developed countries. Modulation of the TLR4 pathway is a potential strategy to specifically target these pathologies. Among the diseases caused by TLR4 abnormal activation by bacterial endotoxin, sepsis is the most dangerous one because it is a life-threatening acute system inflammatory condition that still lacks specific pharmacol. treatment. Here, we review mols. at a preclin. or clin. phase of development, that are active in inhibiting the TLR4-MyD88 and TLR4-TRIF pathways in animal models. These are low-mol. wt. compds. of natural and synthetic origin that can be considered leads for drug development. The results of in vivo studies in the sepsis model and the mechanisms of action of drug leads are presented and critically discussed, evidencing the differences in treatment results from rodents to humans.
- 120Steinhagen, F.; Schmidt, S. V.; Schewe, J.; Peukert, K.; Klinman, D. M.; Bode, C. Immunotherapy in Sepsis - Brake or Accelerate?. Pharmacol. Ther. 2020, 208, 107476, DOI: 10.1016/j.pharmthera.2020.107476[Crossref], [PubMed], [CAS], Google Scholar120https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhtFCru7w%253D&md5=390ff4ee02c08cd10108b008ddf5267eImmunotherapy in sepsis - brake or accelerate?Steinhagen, Folkert; Schmidt, Susanne V.; Schewe, Jens-Christian; Peukert, Konrad; Klinman, Dennis M.; Bode, ChristianPharmacology & Therapeutics (2020), 208 (), 107476CODEN: PHTHDT; ISSN:0163-7258. (Elsevier)A review. Sepsis, a life threating syndrome characterized by organ failure after infection, is the most common cause of death in hospitalized patients. The treatment of sepsis is generally supportive in nature, involving the administration of i.v. fluids, vasoactive substances and oxygen plus antibiotics to eliminate the pathogen. No drugs have been approved specifically for the treatment of sepsis, and clin. trials of potential therapies have failed to reduce mortality - suggesting that new approaches are needed. Abnormalities in the immune response elicited by the pathogen, ranging from excessive inflammation to immunosuppression, contribute to disease pathogenesis. Although hundreds of immunomodulatory agents are potentially available, it remains unclear which patient benefits from which immune therapy at a given time point. Results indicate the importance of personalized therapy, specifically the need to identify the type of intervention required by each individual patient at a given point in the disease process. To address this issue will require using biomarkers to stratify patients based on their individual immune status. This article reviews recent and ongoing clin. investigations using immunostimulatory or immunosuppressive therapies against sepsis including non-pharmacol. and novel preclin. approaches.
- 121Chavez, S. A.; Martinko, A. J.; Lau, C.; Pham, M. N.; Cheng, K.; Bevan, D. E.; Mollnes, T. E.; Yin, H. Development of β -Amino Alcohol Derivatives That Inhibit Toll-like Receptor 4 Mediated Inflammatory Response as Potential Antiseptics. J. Med. Chem. 2011, 54, 4659– 4669, DOI: 10.1021/jm2003365[ACS Full Text], [CAS], Google Scholar121https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3MXmvFOjtLo%253D&md5=1b068f29d0001e28ba30af500af04cc9Development of β-Amino Alcohol Derivatives That Inhibit Toll-like Receptor 4 Mediated Inflammatory Response as Potential AntisepticsChavez, Sherry A.; Martinko, Alexander J.; Lau, Corinna; Pham, Michael N.; Cheng, Kui; Bevan, Douglas E.; Mollnes, Tom E.; Yin, HangJournal of Medicinal Chemistry (2011), 54 (13), 4659-4669CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)Toll-like receptor 4 (TLR4) induced proinflammatory signaling has been directly implicated in severe sepsis and represents an attractive therapeutic target. Herein, we report our investigations into the structure-activity relationship and preliminary drug metab./pharmacokinetics study of β-amino alc. derivs. that inhibit the TLR4 signaling pathway. Lead compds. were identified from in vitro cellular examn. with micromolar potency for their inhibitory effects on TLR4 signaling and subsequently assessed for their ability to suppress the TLR4-induced inflammatory response in an ex vivo whole blood model. In addn., the toxicol., specificity, soly., brain-blood barrier permeability, and drug metab. of several compds. were evaluated. Although further optimizations are needed, our findings lay the groundwork for the future drug development of this class of small mol. agents for the treatment of severe sepsis.
- 122Cighetti, R.; Ciaramelli, C.; Sestito, E.; Zanoni, I.; Kubik, Ł.; Arda-Freire, A.; Calabrese, V.; Granucci, F.; Jerala, R.; Martín-Santamaría, S.; Jimenez-Barbero, J.; Peri, F. Modulation of CD14 and TLR4 · MD-2 Activities by a Synthetic Lipid A Mimetic. ChemBioChem 2014, 15, 250– 258, DOI: 10.1002/cbic.201300588[Crossref], [PubMed], [CAS], Google Scholar122https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXhvFWrtb%252FE&md5=151e5741457211ca7d67e6d1843935b2Modulation of CD14 and TLR4·MD-2 Activities by a Synthetic Lipid A MimeticCighetti, Roberto; Ciaramelli, Carlotta; Sestito, Stefania Enza; Zanoni, Ivan; Kubik, Lukasz; Arda-Freire, Ana; Calabrese, Valentina; Granucci, Francesca; Jerala, Roman; Martin-Santamaria, Sonsoles; Jimenez-Barbero, Jesus; Peri, FrancescoChemBioChem (2014), 15 (2), 250-258CODEN: CBCHFX; ISSN:1439-4227. (Wiley-VCH Verlag GmbH & Co. KGaA)Monosaccharide lipid A mimetics based on a glucosamine core linked to two fatty acid chains and bearing one or two phosphate groups have been synthesized. Compds. 1 and 2, each with one phosphate group, were practically inactive in inhibiting LPS-induced TLR4 signaling and cytokine prodn. in HEK-blue cells and murine macrophages, but compd. 3, with two phosphate groups, was found to be active in efficiently inhibiting TLR4 signal in both cell types. The direct interaction between compd. 3 and the MD-2 coreceptor was investigated by NMR spectroscopy and mol. modeling/docking anal. This compd. also interacts directly with the CD14 receptor, stimulating its internalization by endocytosis. Expts. on macrophages show that the effect on CD14 reinforces the activity on MD-2·TLR4 because compd. 3's activity is higher when CD14 is important for TLR4 signaling (i.e., at low LPS concn.). The dual targeting of MD-2 and CD14, accompanied by good soly. in water and lack of toxicity, suggests the use of monosaccharide 3 as a lead compd. for the development of drugs directed against TLR4related syndromes.
- 123Zaffaroni, L.; Peri, F. Recent Advances on Toll-like Receptor 4 Modulation: New Therapeutic Perspectives. Future Med. Chem. 2018, 10 (4), 461– 476, DOI: 10.4155/fmc-2017-0172[Crossref], [PubMed], [CAS], Google Scholar123https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXivFCntbg%253D&md5=cae56465df8e23632a549bdaaae1343bRecent advances on Toll-like receptor 4 modulation: new therapeutic perspectivesZaffaroni, Lenny; Peri, FrancescoFuture Medicinal Chemistry (2018), 10 (4), 461-476CODEN: FMCUA7; ISSN:1756-8919. (Future Science Ltd.)Activation or inhibition of TLR4 by small mols. will provide in the next few years a new generation of therapeutics. TLR4 stimulation (agonism) by high-affinity ligands mimicking lipid A gave vaccine adjuvants with improved specificity and efficacy that have been licensed and entered into the market. TLR4 inhibition (antagonism) prevents cytokine prodn. at a very early stage; this is in principle a more efficient method to block inflammatory diseases compared to cytokines neutralization by antibodies. Advances in TLR4 modulation by drug-like small mols. achieved in the last years are reviewed. Recently discovered TLR4 agonists and antagonists of natural and synthetic origin are presented, and their mechanism of action and structure-activity relationship are discussed.
- 124Liang, Q.; Wu, Q.; Jiang, J.; Duan, J.; Wang, C.; Smith, M. D.; Lu, H.; Wang, Q.; Nagarkatti, P.; Fan, D. Characterization of Sparstolonin B, a Chinese Herb-Derived Compound, as a Selective Toll-like Receptor Antagonist with Potent Anti-Inflammatory Properties. J. Biol. Chem. 2011, 286 (30), 26470– 26479, DOI: 10.1074/jbc.M111.227934[Crossref], [PubMed], [CAS], Google Scholar124https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3MXpt1Kktbo%253D&md5=acd3a0d119e9dbf2aa7ea83072e838dbCharacterization of Sparstolonin B, a Chinese Herb-derived Compound, as a Selective Toll-like Receptor Antagonist with Potent Anti-inflammatory PropertiesLiang, Qiao-Li; Wu, Qi-Nan; Jiang, Ji-Hong; Duan, Jin-Ao; Wang, Chao; Smith, Mark D.; Lu, Hong; Wang, Qian; Nagarkatti, Prakash; Fan, Da-PingJournal of Biological Chemistry (2011), 286 (30), 26470-26479, S26470/1-S26470/8CODEN: JBCHA3; ISSN:0021-9258. (American Society for Biochemistry and Molecular Biology)Blockade of excessive Toll-like receptor (TLR) signaling is a therapeutic approach being actively pursued for many inflammatory diseases. Here we report a Chinese herb-derived compd., sparstolonin B (SsnB), which selectively blocks TLR2- and TLR4-mediated inflammatory signaling. SsnB was isolated from a Chinese herb, Sparganium stoloniferum; its structure was detd. by NMR spectroscopy and x-ray crystallog. SsnB effectively inhibited inflammatory cytokine expression in mouse macrophages induced by lipopolysaccharide (LPS, a TLR4 ligand), Pam3CSK4 (a TLR1/TLR2 ligand), and Fsl-1 (a TLR2/TLR6 ligand) but not that by poly(I:C) (a TLR3 ligand) or ODN1668 (a TLR9 ligand). It suppressed LPS-induced cytokine secretion from macrophages and diminished phosphorylation of Erk1/2, p38a, IκBα, and JNK in these cells. In THP-1 cells expressing a chimeric receptor CD4-TLR4, which triggers constitutive NF-κB activation, SsnB effectively blunted the NF-κB activity. Co-immunopptn. showed that SsnB reduced the assocn. of MyD88 with TLR4 and TLR2, but not that with TLR9, in HEK293T cells and THP-1 cells overexpressing MyD88 and TLRs. Furthermore, administration of SsnB suppressed splenocyte inflammatory cytokine expression in mice challenged with LPS. These results demonstrate that SsnB acts as a selective TLR2 and TLR4 antagonist by blocking the early intracellular events in the TLR2 and TLR4 signaling. Thus, SssB may serve as a promising lead for the development of selective TLR antagonistic agents for inflammatory diseases.
- 125Pollock, J. A.; Sharma, N.; Ippagunta, S. K.; Redecke, V.; Häcker, H.; Katzenellenbogen, J. A. Triaryl Pyrazole Toll-Like Receptor Signaling Inhibitors: Structure–Activity Relationships Governing Pan- and Selective Signaling Inhibitors. ChemMedChem 2018, 13 (20), 2208– 2216, DOI: 10.1002/cmdc.201800417[Crossref], [PubMed], [CAS], Google Scholar125https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhslSrsLrN&md5=a23002828b400218d1de99c494ff02f0Triaryl Pyrazole Toll-Like Receptor Signaling Inhibitors: Structure-Activity Relationships Governing Pan- and Selective Signaling InhibitorsPollock, Julie A.; Sharma, Naina; Ippagunta, Sirish K.; Redecke, Vanessa; Haecker, Hans; Katzenellenbogen, John A.ChemMedChem (2018), 13 (20), 2208-2216CODEN: CHEMGX; ISSN:1860-7179. (Wiley-VCH Verlag GmbH & Co. KGaA)The immune system uses members of the toll-like receptor (TLR) family to recognize a variety of pathogen- and host-derived mols. in order to initiate immune responses. Although TLR-mediated, pro-inflammatory immune responses are essential for host defense, prolonged and exaggerated activation can result in inflammation pathol. that manifests in a variety of diseases. Therefore, small-mol. inhibitors of the TLR signaling pathway might have promise as anti-inflammatory drugs. We previously identified a class of triaryl pyrazole compds. that inhibit TLR signaling by modulation of the protein-protein interactions essential to the pathway. We have now systematically examd. the structural features essential for inhibition of this pathway, revealing characteristics of compds. that inhibited all TLRs tested (pan-TLR signaling inhibitors) as well as compds. that selectively inhibited certain TLRs. These findings reveal interesting classes of compds. that could be optimized for particular inflammatory diseases governed by different TLRs.
- 126Paul, B.; Rahaman, O.; Roy, S.; Pal, S.; Satish, S.; Mukherjee, A.; Ghosh, A. R.; Raychaudhuri, D.; Bhattacharya, R.; Goon, S.; Ganguly, D.; Talukdar, A. Activity-Guided Development of Potent and Selective Toll-like Receptor 9 Antagonists. Eur. J. Med. Chem. 2018, 159, 187– 205, DOI: 10.1016/j.ejmech.2018.09.058[Crossref], [PubMed], [CAS], Google Scholar126https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhvVKntbbL&md5=2b30577538a603af0204de5edaf3f6cbActivity-guided development of potent and selective toll-like receptor 9 antagonistsPaul, Barnali; Rahaman, Oindrila; Roy, Swarnali; Pal, Sourav; Satish, Sohal; Mukherjee, Ayan; Ghosh, Amrit R.; Raychaudhuri, Deblina; Bhattacharya, Roopkatha; Goon, Sunny; Ganguly, Dipyaman; Talukdar, ArindamEuropean Journal of Medicinal Chemistry (2018), 159 (), 187-205CODEN: EJMCA5; ISSN:0223-5234. (Elsevier Masson SAS)TLR9 is one of the major innate immune receptors expressed in the endosomes of pDCs and B cells in humans. Aberrant TLR9 activation is implicated in several autoimmune and metabolic disorders as well as in sepsis, making this receptor an important therapeutic target, though specific TLR9 antagonists are yet to be available for clin. use. Here we elucidate the importance of specific physiochem. properties through substitution patterns in quinazoline scaffold to achieve potent hTLR9 inhibition at < 50 nM as well as > 600 fold selectivity against hTLR7, another closely related TLR that shares downstream signaling with TLR9 but plays distinct roles in physiol. and pathol. Assays were performed using hPBMC and reporter cell lines. Favorable in vitro ADME profile, pharmacokinetics as well as validation in a clin. relevant in vivo TLR9-inhibition efficacy model in mice establish these novel TLR9-antagonists as candidate therapeutic agents in relevant clin. contexts.
- 127D’Alessandro, S.; Alfano, G.; Di Cerbo, L.; Brogi, S.; Chemi, G.; Relitti, N.; Brindisi, M.; Lamponi, S.; Novellino, E.; Campiani, G.; Gemma, S.; Basilico, N.; Taramelli, D.; Baratto, M. C.; Pogni, R.; Butini, S. Bridged Bicyclic 2,3-Dioxabicyclo[3.3.1]Nonanes as Antiplasmodial Agents: Synthesis, Structure-Activity Relationships and Studies on Their Biomimetic Reaction with Fe(II). Bioorg. Chem. 2019, 89, 103020, DOI: 10.1016/j.bioorg.2019.103020[Crossref], [PubMed], [CAS], Google Scholar127https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhtFClt7%252FO&md5=9f454170238b307d4fd0c31a34701b0bBridged bicyclic 2,3-dioxabicyclo[3.3.1]nonanes as antiplasmodial agents: Synthesis, structure-activity relationships and studies on their biomimetic reaction with Fe(II)D'Alessandro, Sarah; Alfano, Gloria; Di Cerbo, Luisa; Brogi, Simone; Chemi, Giulia; Relitti, Nicola; Brindisi, Margherita; Lamponi, Stefania; Novellino, Ettore; Campiani, Giuseppe; Gemma, Sandra; Basilico, Nicoletta; Taramelli, Donatella; Baratto, Maria Camilla; Pogni, Rebecca; Butini, StefaniaBioorganic Chemistry (2019), 89 (), 103020CODEN: BOCMBM; ISSN:0045-2068. (Elsevier B.V.)Despite recent advancements in its control, malaria is still a deadly parasitic disease killing millions of people each year. Progresses in combating the infection have been made by using the so-called artemisinin combination therapies (ACTs). Natural and synthetic peroxides are an important class of antimalarials. Here we describe a new series of peroxides synthesized through a new elaboration of the scaffold of bicyclic-fused/bridged synthetic endoperoxides previously developed by us. These peroxides are produced by a straightforward synthetic protocol and are characterized by submicromolar potency when tested against both chloroquine-sensitive and chloroquine-resistant Plasmodium falciparum strains. To investigate their mode of action, the biomimetic reaction of the representative compd. I with Fe(II) was studied by EPR and the reaction products were characterized by NMR. Rationalization of the obsd. structure-activity relationship studies was performed by mol. docking. Taken together, our data robustly support the hypothesized mode of activation of peroxides and led to the definition of the key structural requirements responsible for the antiplasmodial potency. These data will pave the way in future to the rational design of novel optimized antimalarials suitable for in vivo investigation.
- 128Kalantari, P. The Emerging Role of Pattern Recognition Receptors in the Pathogenesis of Malaria. Vaccines 2018, 6, 13, DOI: 10.3390/vaccines6010013[Crossref], [CAS], Google Scholar128https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhtVGntrnL&md5=c9af2a81c30383275239227b22193237The emerging role of pattern recognition receptors in the pathogenesis of malariaKalantari, ParisaVaccines (Basel, Switzerland) (2018), 6 (1), 13/1-13/15CODEN: VBSABP; ISSN:2076-393X. (MDPI AG)Despite a global effort to develop an effective vaccine, malaria is still a significant health problem. Much of the pathol. of malaria is immune mediated. This suggests that host immune responses have to be finely regulated. The innate immune system initiates and sets the threshold of the acquired immune response and dets. the outcome of the disease. Yet, our knowledge of the regulation of innate immune responses during malaria is limited. Theor., inadequate activation of the innate immune system could result in unrestrained parasite growth. Conversely, hyperactivation of the innate immune system, is likely to cause excessive prodn. of proinflammatory cytokines and severe pathol. Toll-like receptors (TLRs) have emerged as essential receptors which detect signature mols. and shape the complex host response during malaria infection. This review will highlight the mechanisms by which Plasmodium components are recognized by innate immune receptors with particular emphasis on TLRs. A thorough understanding of the complex roles of TLRs in malaria may allow the delineation of pathol. vs. protective host responses and enhance the efficacy of anti-malarial treatments and vaccines.
- 129Eriksson, E. M.; Sampaio, N. G.; Schofield, L. Toll-Like Receptors and Malaria – Sensing and Susceptibility. J. Trop. Dis. 2014, 2 (1), 1– 7, DOI: 10.4172/2329-891X.1000126
- 130Ernest, M.; Hunja, C.; Arakura, Y.; Haraga, Y.; Abkallo, H. M.; Zeng, W.; Jackson, D. C.; Chua, B.; Culleton, R. The Toll-Like Receptor 2 Agonist PEG-Pam2Cys as an Immunochemoprophylactic and Immunochemotherapeutic against the Liver and Transmission Stages of Malaria Parasites. Int. J. Parasitol.: Drugs Drug Resist. 2018, 8 (3), 451– 458, DOI: 10.1016/j.ijpddr.2018.10.006[Crossref], [PubMed], [CAS], Google Scholar130https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB3cvmsl2htQ%253D%253D&md5=2dd8e3c53c65e77ab3108549f3da718eThe Toll-Like Receptor 2 agonist PEG-Pam2Cys as an immunochemoprophylactic and immunochemotherapeutic against the liver and transmission stages of malaria parasitesErnest Medard; Hunja Carol; Arakura Yuka; Haraga Yohei; Abkallo Hussein M; Zeng Weiguang; Jackson David C; Chua Brendon; Culleton RichardInternational journal for parasitology. Drugs and drug resistance (2018), 8 (3), 451-458 ISSN:.Both vaccine and therapeutic approaches to malaria are based on conventional paradigms; whole organism or single antigen epitope-based vaccines administered with or without an adjuvant, and chemotherapeutics (anti-malaria drugs) that are toxic to the parasite. Two major problems that limit the effectiveness of these approaches are i) high levels of antigenic variation within parasite populations rendering vaccination efficacy against all variants difficult, and ii) the capacity of the parasite to quickly evolve resistance to drugs. We describe a new approach to both protection from and treatment of malaria parasites that involves the direct stimulation of the host innate immune response through the administration of a Toll-Like Receptor-2 (TLR2) agonist. The activity of PEG-Pam2Cys against the hepatocytic stages, erythrocytic stages and gametocytes of the rodent malaria parasite Plasmodium yoelii was investigated in laboratory mice. We show that administration of PEG-Pam2Cys, a soluble form of the TLR2 agonist S-[2,3-bis(palmitoyloxy)propyl] cysteine (Pam2Cys), significantly and dramatically reduces the numbers of malaria parasites that grow in the livers of mice following subsequent challenge with sporozoites. We also show that treatment can also clear parasites from the liver when administered subsequent to the establishment of infection. Finally, PEG-Pam2Cys can reduce the numbers of mosquitoes that are infected, and the intensity of their infection, following blood feeding on gametocytaemic mice. These results suggest that this compound could represent a novel liver stage anti-malarial that can be used both for the clearance of parasites following exposure and for the prevention of the establishment of infection.
- 131Kaur, A.; Kannan, D.; Mehta, S. K.; Singh, S.; Salunke, D. B. Synthetic Toll-like Receptor Agonists for the Development of Powerful Malaria Vaccines: A Patent Review. Expert Opin. Ther. Pat. 2018, 28 (11), 837– 847, DOI: 10.1080/13543776.2018.1530217[Crossref], [PubMed], [CAS], Google Scholar131https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhvFynt7nJ&md5=2ac288641c57ef14eae1d635e0f763fcSynthetic Toll-like receptor agonists for the development of powerful malaria vaccines: a patent reviewKaur, Arshpreet; Kannan, Deepika; Mehta, Surinder K.; Singh, Shailja; Salunke, Deepak B.Expert Opinion on Therapeutic Patents (2018), 28 (11), 837-847CODEN: EOTPEG; ISSN:1354-3776. (Taylor & Francis Ltd.)A review. Introduction: Currently, there is no efficient vaccine available against clin. malaria. However, continuous efforts have been committed to develop powerful antimalarial vaccine by discovery of novel antigens with in-depth understanding of its nature, immunogenicity, and presentation (delivery adjuvants). Moreover, another important part of vaccine development includes discovery of better immunostimulatory formulation components (immunostimulants). A protective vaccine against malaria requires antigen-specific B and T helper cell responses as well as cytotoxic T lymphocyte (CTL) responses. A long-lasting B and T memory cell prodn. is also required for effective malaria vaccine. Since activation of Toll-like receptors (TLRs) promotes both innate inflammatory responses as well as the induction of adaptive immunity, several initiatives have been mounted during the last few years for the use of TLR agonists as malaria vaccine adjuvants. Areas covered: The review summarizes reports related to the use and development of TLR agonists as malaria vaccine adjuvants and describes various strategies involved for the selection of specific antigens and TLR agonists. Expert opinion: TLR agonists are promising adjuvants for the development of effective malaria vaccine, allowing for both innate inflammatory responses as well as the induction of adaptive immunity.
- 132Coban, C.; Horii, T.; Akira, S.; Ishii, K. J. TLR9 and Endogenous Adjuvants of the Whole Blood-Stage Malaria Vaccine. Expert Rev. Vaccines 2010, 9 (7), 775– 784, DOI: 10.1586/erv.10.60[Crossref], [PubMed], [CAS], Google Scholar132https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3cXoslyltrs%253D&md5=c2ac8cde110358a1eeef6055c4d111e4TLR9 and endogenous adjuvants of the whole blood-stage malaria vaccineCoban, Cevayir; Horii, Toshihiro; Akira, Shizuo; Ishii, Ken J.Expert Review of Vaccines (2010), 9 (7), 775-784CODEN: ERVXAX; ISSN:1476-0584. (Expert Reviews Ltd.)A review. Vaccination has been a successful tool in the protection against many infectious diseases, and recent advances in biotechnol. have created new techniques and strategies to produce safe and efficacious vaccines for human use. However, developing a protective vaccine against malaria has been a challenge. In this article, we focus on an old approach with some new modifications, the so-called whole-parasite vaccination strategy against blood-stage Plasmodium falciparum, the deadliest human malarial agent. In addn., we discuss recent developments in our understanding of how the endogenous adjuvant activity in the parasites, which functions via Toll-like receptor 9, acts as a double-edged sword between protective vaccination and pathol. responses against malaria infection.
- 133Battista, T.; Colotti, G.; Ilari, A.; Fiorillo, A. Targeting Trypanothione Reductase, a Key Enzyme in the Redox Trypanosomatid Metabolism, to Develop New Drugs against Leishmaniasis and Trypanosomiases. Molecules 2020, 25 (8), 1924, DOI: 10.3390/molecules25081924[Crossref], [CAS], Google Scholar133https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhtVekur7M&md5=d19e3b7e88240c74ea2d9670ca357ec3Targeting trypanothione reductase, a key enzyme in the redox trypanosomatid metabolism, to develop new drugs against leishmaniasis and trypanosomiasesBattista, Theo; Colotti, Gianni; Ilari, Andrea; Fiorillo, AnnaritaMolecules (2020), 25 (8), 1924CODEN: MOLEFW; ISSN:1420-3049. (MDPI AG)A review. The protozoans Leishmania and Trypanosoma, belonging to the same Trypanosomatidae family, are the causative agents of Leishmaniasis, Chagas disease, and human African trypanosomiasis. Overall, these infections affect millions of people worldwide, posing a serious health issue as well as socio-economical concern. Current treatments are inadequate, mainly due to poor efficacy, toxicity, and emerging resistance; therefore, there is an urgent need for new drugs. Among several mol. targets proposed, trypanothione reductase (TR) is of particular interest for its crit. role in controlling the parasite's redox homeostasis and several classes of active compds. that inhibit TR have been proposed so far. This review provides a comprehensive overview of TR's structural characterization. In particular, we discuss all the structural features of TR relevant for drug discovery, with a focus on the recent advances made in the understanding of inhibitor binding. The reported cases show how, on the basis of the detailed structural information provided by the crystallog. anal., it is possible to rationally modify mol. scaffolds to improve their properties.
- 134Gemma, S.; Federico, S.; Brogi, S.; Brindisi, M.; Butini, S.; Campiani, G. Dealing with Schistosomiasis: Current Drug Discovery Strategies. Annu. Rep. Med. Chem. 2019, 53, 107– 138, DOI: 10.1016/bs.armc.2019.06.002
- 135Fouzder, C.; Mukhuty, A.; Das, S.; Chattopadhyay, D. TLR Signaling on Protozoan and Helminthic Parasite Infection. IntechOpen 2020, 1– 20, DOI: 10.5772/intechopen.84711
- 136Mukherjee, S.; Karmakar, S.; Babu, S. P. S. TLR2 and TLR4Mediated Host Immune Responses in Major Infectious Diseases: A Review. Braz. J. Infect. Dis. 2016, 20 (2), 193– 204, DOI: 10.1016/j.bjid.2015.10.011[Crossref], [PubMed], [CAS], Google Scholar136https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC28nhtV2hsQ%253D%253D&md5=74f6b80f6746c8cb52fecd019d913ae1TLR2 and TLR4 mediated host immune responses in major infectious diseases: a reviewMukherjee Suprabhat; Karmakar Subhajit; Babu Santi Prasad SinhaThe Brazilian journal of infectious diseases : an official publication of the Brazilian Society of Infectious Diseases (2016), 20 (2), 193-204 ISSN:.During the course of evolution, multicellular organisms have been orchestrated with an efficient and versatile immune system to counteract diverse group of pathogenic organisms. Pathogen recognition is considered as the most critical step behind eliciting adequate immune response during an infection. Hitherto Toll-like receptors (TLRs), especially the surface ones viz. TLR2 and TLR4 have gained immense importance due to their extreme ability of identifying distinct molecular patterns from invading pathogens. These pattern recognition receptors (PRRs) not only act as innate sensor but also shape and bridge innate and adaptive immune responses. In addition, they also play a pivotal role in regulating the balance between Th1 and Th2 type of response essential for the survivability of the host. In this work, major achievements rather findings made on the typical signalling and immunopathological attributes of TLR2 and TLR4 mediated host response against the major infectious diseases have been reviewed. Infectious diseases like tuberculosis, trypanosomiasis, malaria, and filariasis are still posing myriad threat to mankind. Furthermore, increasing resistance of the causative organisms against available therapeutics is also an emerging problem. Thus, stimulation of host immune response with TLR2 and TLR4 agonist can be the option of choice to treat such diseases in future.
- 137Wang, X.; Dong, L.; Ni, H.; Zhou, S.; Xu, Z.; Hoellwarth, J. S.; Chen, X.; Zhang, R.; Chen, Q.; Liu, F.; Wang, J.; Su, C. Combined TLR7/8 and TLR9 Ligands Potentiate the Activity of a Schistosoma Japonicum DNA Vaccine. PLoS Neglected Trop. Dis. 2013, 7 (4), e2164, DOI: 10.1371/journal.pntd.0002164[Crossref], [PubMed], [CAS], Google Scholar137https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXnsFaiurY%253D&md5=b91b5ddfb837cd25266fd81823dfa0b8Combined TLR7/8 and TLR9 ligands potentiate the activity of a Schistosoma japonicum DNA vaccineWang, Xuefeng; Dong, Liyang; Ni, Hongchang; Zhou, Sha; Xu, Zhipeng; Hoellwarth, Jason Shih; Chen, Xiaojun; Zhang, Rongbo; Chen, Qiaoyun; Liu, Feng; Wang, Jun; Su, ChuanPLoS Neglected Tropical Diseases (2013), 7 (4), e2164CODEN: PNTDAM; ISSN:1935-2735. (Public Library of Science)Background: Toll-like receptor (TLR) ligands have been explored as vaccine adjuvants for tumor and virus immunotherapy, but few TLR ligands affecting schistosoma vaccines have been characterized. Previously, the authors developed a partially protective DNA vaccine encoding the 26-kDa glutathione S-transferase of Schistosoma japonicum (pVAX1-Sj26GST). Methodol./Principal Findings: In this study, the authors evaluated a TLR7/8 ligand (R848) and a TLR9 ligand (CpG oligodeoxynucleotides, or CpG) as adjuvants for pVAX1-Sj26GST and assessed their effects on the immune system and protection against S. japonicum. The authors show that combining CpG and R848 with pVAX1-Sj26GST immunization significantly increases splenocyte proliferation and IgG and IgG2a levels, decreases CD4+CD25+Foxp3+ regulatory T cells (Treg) frequency in vivo and enhances protection against S. japonicum. CpG and R848 inhibited Treg-mediated immunosuppression, upregulated the prodn. of interferon (IFN)-γ, tumor necrosis factor (TNF)-α, interleukin (IL)-4, IL-10, IL-2 and IL-6 and decreased Foxp3 expression in vitro, which may contribute to prevent Treg suppression and conversion during vaccination and allow expansion of antigen-specific T cells against pathogens. Conclusions: Our data shows that selective TLR ligands can increase the protective efficacy of DNA vaccines against schistosomiasis, potentially through combined antagonism of Treg-mediated immunosuppression and conversion.
- 138Bourgeois, C.; Kuchler, K. Fungal Pathogens-a Sweet and Sour Treat for Toll-like Receptors. Front. Cell. Infect. Microbiol. 2012, 2, 142, DOI: 10.3389/fcimb.2012.00142[Crossref], [PubMed], [CAS], Google Scholar138https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC3s7ntVOnsw%253D%253D&md5=cec0c2b051ef4218be1aa74e825fed13Fungal pathogens-a sweet and sour treat for toll-like receptorsBourgeois Christelle; Kuchler KarlFrontiers in cellular and infection microbiology (2012), 2 (), 142 ISSN:.Hundred-thousands of fungal species are present in our environment, including normal colonizers that constitute part of the human microbiota. The homeostasis of host-fungus interactions encompasses efficient fungal sensing, tolerance at mucosal surfaces, as well as antifungal defenses. Decrease in host immune fitness or increase in fungal burden may favor pathologies, ranging from superficial mucocutaneous diseases to invasive life-threatening fungal infections. Toll-like receptors (TLRs) are essential players in this balance, due to their ability to control both inflammatory and anti-inflammatory processes upon recognition of fungal-specific pathogen-associated molecular patterns (PAMPs). Certain members of the TLR family participate to the initial recognition of fungal PAMPs on the cell surface, as well as inside phagosomes of innate immune cells. Active signaling cascades in phagocytes ultimately enable fungus clearance and the release of cytokines that shape and instruct other innate immune cells and the adaptive immune system. Some TLRs cooperate with other pattern recognition receptors (PRRs) (e.g., C-type lectins and Galectins), thus allowing for a tailored immune response. The spatio-temporal and physiological contributions of individual TLRs in fungal infections remains ill-defined, although in humans, TLR gene polymorphisms have been linked to increased susceptibility to fungal infections. This review focuses entirely on the role of TLRs that control the host susceptibility to environmental fungi (e.g., Aspergillus, Cryptoccocus, and Coccidoides), as well as to the most frequent human fungal pathogens represented by the commensal Candida species. The emerging roles of TLRs in modulating host tolerance to fungi, and the strategies that evolved in some of these fungi to evade or use TLR recognition to their advantage will also be discussed, as well as their potential suitability as targets in vaccine therapies.
- 139Patin, E. C.; Thompson, A.; Orr, S. J. Pattern Recognition Receptors in Fungal Immunity. Semin. Cell Dev. Biol. 2019, 89, 24– 33, DOI: 10.1016/j.semcdb.2018.03.003[Crossref], [PubMed], [CAS], Google Scholar139https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXkslWkt70%253D&md5=36ffa63b229ff244186d68354deb6bdePattern recognition receptors in fungal immunityPatin, Emmanuel C.; Thompson, Aiysha; Orr, Selinda J.Seminars in Cell & Developmental Biology (2019), 89 (), 24-33CODEN: SCDBFX; ISSN:1084-9521. (Elsevier Ltd.)Over the last decade, invasive fungal infections have emerged as a growing threat to human health worldwide and novel treatment strategies are urgently needed. In this context, investigations into host-pathogen interactions represent an important and promising field of research. Antigen presenting cells such as macrophages and dendritic cells are strategically located at the frontline of defense against potential invaders. Importantly, these cells express germline encoded pattern recognition receptors (PRRs), which sense conserved entities from pathogens and orchestrate innate immune responses. Herein, we review the latest findings regarding the biol. and functions of the different classes of PRRs involved in pathogenic fungal recognition. We also discuss recent literature on PRR collaboration/crosstalk and the mechanisms involved in inhibiting/regulating PRR signalling. Finally, we discuss how the accumulated knowledge on PRR biol., esp. Dectin-1, has been used for the design of new immunotherapies against fungal infections.
- 140Martínez, A.; Bono, C.; Megías, J.; Yáñez, A.; Gozalbo, D.; Gil, M. L. Systemic Candidiasis and TLR2 Agonist Exposure Impact the Antifungal Response of Hematopoietic Stem and Progenitor Cells. Front. Cell. Infect. Microbiol. 2018, 8, 309, DOI: 10.3389/fcimb.2018.00309[Crossref], [PubMed], [CAS], Google Scholar140https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhvVahtb3I&md5=fcee336466a51032db681a1bb6b35d17Systemic candidiasis and TLR2 agonist exposure impact the antifungal response of hematopoietic stem and progenitor cellsMartinez, Alba; Bono, Cristina; Megias, Javier; Yanez, Alberto; Gozalbo, Daniel; Gil, M. LuisaFrontiers in Cellular and Infection Microbiology (2018), 8 (), 309/1-309/15CODEN: FCIMAB; ISSN:2235-2988. (Frontiers Media S.A.)We have previously demonstrated that Candida albicans induces differentiation of hematopoietic stem and progenitor cells (HSPCs) toward the myeloid lineage both in vitro and in vivo in a TLR2- and Dectin-1-dependent manner, giving rise to functional macrophages. In this work, we used an ex vivo model to investigate the functional consequences for macrophages derived from HSPCs in vivo-exposed to Pam3CSK4 (a TLR2 agonist) or C. albicans infection. Short in vivo treatment of mice with Pam3CSK4 results in a tolerized phenotype of ex vivo HSPC-derived macrophages, whereas an extended Pam3CSK4 treatment confers a trained phenotype. Early during candidiasis, HSPCs give rise to macrophages trained in their response to Pam3CSK4 and with an increased fungicidal activity; however, as the infection progresses to higher fungal burden, HSPC-derived macrophages become tolerized, while their fungicidal capacity is maintained. These results demonstrate that memory-like innate immune responses, already described for monocytes and macrophages, also take place in HSPCs. Interestingly, extended Pam3CSK4 treatment leads to an expansion of spleen HSPCs and myeloid cells, and drastically reduces the fungal burden in the kidney and spleen during systemic C. albicans infection. This protection against tissue invasion is abrogated by immunodepletion of HSPCs, suggesting their protective role against infection in this model. In addn., HSPCs produce in vitro cytokines and chemokines in response to C. albicans and Pam3CSK4, and these secretomes are capable of inducing myeloid differentiation of HSPCs and modulating peritoneal macrophage cytokine responses. Taken together, these data assign an active role for HSPCs in sensing pathogens during infection and in contributing to host protection by diverse mechanisms.
- 141Redlich, S.; Ribes, S.; Schütze, S.; Eiffert, H.; Nau, R. Toll-like Receptor Stimulation Increases Phagocytosis of Cryptococcus Neoformans by Microglial Cells. J. Neuroinflammation 2013, 10, 841, DOI: 10.1186/1742-2094-10-71
- 142Oh, H. M.; Lee, S. W.; Park, M. H.; Kim, M. H.; Ryu, Y. B.; Kim, M. S.; Kim, H. H.; Park, K. H.; Lee, W. S.; Park, S. J.; Rho, M. C. Norkurarinol Inhibits Toll-Like Receptor 3 (TLR3)-Mediated pro-Inflammatory Signaling Pathway and Rotavirus Replication. J. Pharmacol. Sci. 2012, 118 (2), 161– 170, DOI: 10.1254/jphs.11077FP[Crossref], [PubMed], [CAS], Google Scholar142https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC38Xjt12hsr8%253D&md5=1eb18926ad3e77f6d0a463a9482c9670Norkurarinol inhibits toll-like receptor 3 (TLR3)-mediated pro-inflammatory signaling pathway and rotavirus replicationOh, Hyun-Mee; Lee, Seung Woong; Park, Mi Hye; Kim, Mi Hwa; Ryu, Young Bae; Kim, Myo Sun; Kim, Ha-Hyun; Park, Ki Hun; Lee, Woo Song; Park, Su-Jin; Rho, Mun-ChualJournal of Pharmacological Sciences (Tokyo, Japan) (2012), 118 (2), 161-170CODEN: JPSTGJ; ISSN:1347-8613. (Japanese Pharmacological Society)This study examd. the effect of norkurarinol on the toll-like receptor 3 (TLR3)-mediated signaling pathways and rotavirus replication. Norkurarinol, a lavandulylated flavanone, was isolated from the roots of Sophora flavescens, which has been shown to have anti-inflammatory activity. Norkurarinol suppressed the NF-κB and AP-1 inducible secreted embryonic alk. phosphatase (SEAP) activity induced by poly(I:C), TLR3 ligand, in THP1-Blue-CD14 cells with IC50 values of 20.9 μM. Norkurarinol also significantly suppressed the mRNA expression of pro-inflammatory and adhesive mols. induced by poly(I:C) and rotavirus infection. Pretreatment of norkurarinol blocked the NF-κB and AP-1 signaling pathway and the phosphorylation of MAPKs induced by poly(I:C). On the other hand, norkurarinol increased the level of IRF3 phosphorylation and IFNβ expression in a dose-dependent manner. Moreover, norkurarinol inhibited the rotavirus-induced cytopathic effects. These results suggest that norkurarinol can modulate the TLR3-mediated inflammatory responses and rotavirus replication.
- 143Engelmann, C.; Sheikh, M.; Sharma, S.; Kondo, T.; Loeffler-Wirth, H.; Zheng, Y. B.; Novelli, S.; Hall, A.; Kerbert, A. J. C.; Macnaughtan, J.; Mookerjee, R.; Habtesion, A.; Davies, N.; Ali, T.; Gupta, S.; Andreola, F.; Jalan, R. Toll-like Receptor 4 Is a Therapeutic Target for Prevention and Treatment of Liver Failure. J. Hepatol. 2020, 73 (1), 102– 112, DOI: 10.1016/j.jhep.2020.01.011[Crossref], [PubMed], [CAS], Google Scholar143https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXksV2jsro%253D&md5=c11b33143b00aca7d3763e70f2d3ffd7Toll-like receptor 4 is a therapeutic target for prevention and treatment of liver failureEngelmann, Cornelius; Sheikh, Mohammed; Sharma, Shreya; Kondo, Takayuki; Loeffler-Wirth, Henry; Zheng, Yu Bao; Novelli, Simone; Hall, Andrew; Kerbert, Annarein J. C.; MacNaughtan, Jane; Mookerjee, Rajeshwar; Habtesion, Abeba; Davies, Nathan; Ali, Tauhid; Gupta, Saurabh; Andreola, Fausto; Jalan, RajivJournal of Hepatology (2020), 73 (1), 102-112CODEN: JOHEEC; ISSN:0168-8278. (Elsevier B.V.)Toll-like receptor 4 (TLR4) plays an essential role in mediating organ injury in acute liver failure (ALF) and acute-on-chronic liver failure (ACLF). Herein, we assess whether inhibiting TLR4 signaling can ameliorate liver failure and serve as a potential treatment.Circulating TLR4 ligands and hepatic TLR4 expression were measured in plasma samples and liver biopsies from patients with cirrhosis. TAK-242 (TLR4 inhibitor) was tested in vivo (10 mg/kg i.p.) in rodent models of ACLF (bile duct ligation + lipopolysaccharide [LPS]; carbon tetrachloride + LPS) and ALF (galactosamine + LPS) and in vitro on immortalized human monocytes (THP-1) and hepatocytes (HHL5). The in vivo therapeutic effect was assessed by coma-free survival, organ injury and cytokine release and in vitro by measuring IL-6, IL-1β or cell injury (TUNEL), resp.In patients with cirrhosis, hepatic TLR4 expression was upregulated and circulating TLR4 ligands were increased (p <0.001). ACLF in rodents was assocd. with a switch from apoptotic cell death in ALF to non-apoptotic forms of cell death. TAK-242 reduced LPS-induced cytokine secretion and cell death (p = 0.002) in hepatocytes and monocytes in vitro. In rodent models of ACLF, TAK-242 administration improved coma-free survival, reduced the degree of hepatocyte cell death in the liver (p <0.001) and kidneys (p = 0.048) and reduced circulating cytokine levels (IL-1β, p <0.001). In a rodent model of ALF, TAK-242 prevented organ injury (p <0.001) and systemic inflammation (IL-1β, p <0.001).This study shows that TLR4 signaling is a key factor in the development of both ACLF and ALF; its inhibition reduces the severity of organ injury and improves outcome. TAK-242 may be of therapeutic relevance in patients with liver failure.Toll-like receptor 4 (or TLR4) mediates endotoxin-induced tissue injury in liver failure and cirrhosis. This receptor sensitizes cells to endotoxins, which are produced by gram-neg. bacteria. Thus, inhibiting TLR4 signaling with an inhibitor (TAK-242) ameliorates organ injury and systemic inflammation in rodent models of acute and acute-on-chronic liver failure.
- 144Papaioannou, A. I.; Spathis, A.; Kostikas, K.; Karakitsos, P.; Papiris, S.; Rossios, C. The Role of Endosomal Toll-like Receptors in Asthma. Eur. J. Pharmacol. 2017, 808 (September), 14– 20, DOI: 10.1016/j.ejphar.2016.09.033[Crossref], [PubMed], [CAS], Google Scholar144https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28Xhs1akt77P&md5=34a805658522703d2bcfcc326a4baeadThe role of endosomal toll-like receptors in asthmaPapaioannou, Andriana I.; Spathis, Aris; Kostikas, Konstantinos; Karakitsos, Petros; Papiris, Spyros; Rossios, ChristosEuropean Journal of Pharmacology (2017), 808 (), 14-20CODEN: EJPHAZ; ISSN:0014-2999. (Elsevier B.V.)Asthma is a heterogeneous inflammatory disease caused by assocn. of genetic and environmental factors and its incidence has significantly increased over the latest years. The clin. manifestations of asthma are the result of airway hyper-reactivity to a variety of triggers such as aeroallergens, viral and bacterial components. Toll-like receptors (TLRs) are pathogen assocd. mol. pattern receptors, which are also expressed in the lung tissue as well as in several cells of the innate and adaptive immune system. Ligation of TLRs results in alterations in the expression of several inflammatory and anti-inflammatory mediators, which are known to be involved in the pathogenesis of asthma. The endosomal TLRs have been shown to be assocd. with the induction of asthmatic inflammation (TLR3), and with disease exacerbations (TLR7, TLR8 and TLR9). Targeting these receptors seems to be an effective choice for suppressing airway inflammation, eosinophilia and airway hyperresponsiveness in asthmatic patients. In this review we provide information regarding endosomal TLRs and their role in the pathogenesis of asthma as well as their potential use as targets for the development of novel treatments for the therapy of asthma.
- 145Kim, J.; Durai, P.; Jeon, D.; Jung, I. D.; Lee, S. J.; Park, Y. M.; Kim, Y. Phloretin as a Potent Natural TLR2/1 Inhibitor Suppresses TLR2-Induced Inflammation. Nutrients 2018, 10 (7), 868, DOI: 10.3390/nu10070868[Crossref], [CAS], Google Scholar145https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXisFKls7%252FF&md5=d401bd5305121455a4a8a3d755d60816Phloretin as a potent natural TLR2/1 inhibitor suppresses TLR2-induced inflammationKim, Jieun; Durai, Prasannavenkatesh; Jeon, Dasom; Jung, In Duk; Lee, Seung Jun; Park, Yeong-Min; Kim, YangmeeNutrients (2018), 10 (7), 868/1-868/12CODEN: NUTRHU; ISSN:2072-6643. (MDPI AG)Here, we investigated whether the anti-inflammatory activity of phloretin is mediated through TLR2 pathways, and whether phloretin acts as an inhibitor of TLR2/1 heterodimerization using the TLR2/1 agonist Pam3CSK4. We tested the effects of phloretin on tumor necrosis factor (TNF)-α prodn. induced by various TLRs using known TLR-specific agonists. Phloretin significantly inhibited Pam3CSK4-induced TRL2/1 signaling in Raw264.7 cells compared to TLR signaling induced by the other agonists tested. Therefore, we further tested the effects of phloretin in human embryonic kidney (HEK) 293-hTLR2 cells induced by Pam3CSK4, and confirmed that phloretin has comparable inhibition of TLR2/1 heterodimerization to that induced by the known TLR2 inhibitor CU-CPT22. Moreover, phloretin reduced the secretion of the inflammatory cytokines TNF-α and interleukin (IL)-8 in Pam3CSK4-induced HEK293-hTLR2 cells, whereas it did not significantly reduce these cytokines under Pam2CSK4-induced activation. Western blot results showed that phloretin significantly suppressed Pam3CSK4-induced TLR2 and NF-κB p65 expression. Phloretin bound to TLR2 with micromolar binding affinity, and we proposed a binding model of phloretin at the TLR2-TLR1 interface. Overall, we confirmed that phloretin inhibits the heterodimerization of TLR2/1, highlighting TLR2 signaling as a therapeutic target for treating TLR2-mediated inflammatory immune diseases.
- 146Fußbroich, D.; Schubert, R.; Schneider, P.; Zielen, S.; Beermann, C. Impact of Soyasaponin I on TLR2 and TLR4 Induced Inflammation in the MUTZ-3-Cell Model. Food Funct. 2015, 6 (3), 1001– 1010, DOI: 10.1039/C4FO01065E[Crossref], [PubMed], [CAS], Google Scholar146https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXitlalsbc%253D&md5=755f02843c06e6782e583e961e0bdd80Impact of soyasaponin I on TLR2 and TLR4 induced inflammation in the MUTZ-3-cell modelFussbroich, Daniela; Schubert, Ralf; Schneider, Petra; Zielen, Stefan; Beermann, ChristopherFood & Function (2015), 6 (3), 1001-1010CODEN: FFOUAI; ISSN:2042-6496. (Royal Society of Chemistry)Previous studies have demonstrated that soyasaponin (SoSa) possesses anti-inflammatory properties in lipopolysaccharide (LPS)-stimulated immune cells by influencing the immune sensing of toll-like receptor (TLR) 4. The aim of this study was to investigate the immune modulatory effect of SoSa I on TLR2- and TLR4-induced inflammation within the monocytic MUTZ-3-cell model. MUTZ-3 cells were stimulated with gram-neg. (Escherichia coli) or gram-pos. (Staphylococcus aureus) bacteria or bacterial pathogen-assocd. mol. patterns (PAMPs) such as LPS or peptidoglycans (PGN) alone or in combination with SoSa I. Cell morphol. was characterized by raster scanning and light microscopy. Cytokine prodn. (IL-1β, IL-6, TNF-α, IP-10, RANTES and IL-8) was measured by cytometric bead array and the expression of surface markers was assessed by flow cytometry. MUTZ-3 cells revealed a cell maturation-like alteration in morphol. and increased expression of CD80, CD86, TLR2 and TLR4 after stimulation with either gram-neg. and gram-pos. bacteria or bacterial PAMPs. The addn. of SoSa I suppressed pro-inflammatory cytokine and chemokine secretions in a dose-dependent manner regardless of TLR2 or TLR4 stimulation. Interestingly, E. coli- and S. aureus-induced inflammation was always inhibited better by SoSa I than that induced by LPS and PGN. Addnl., SoSa I reduced the expression of CD86 in PGN- or LPS-stimulated cells. This study demonstrated that the anti-inflammatory capacity of SoSa I is based on influencing both monocytic TLR2 and TLR4 and that SoSa I inhibits more effectively whole bacteria compared to solely LPS or PGN what points to a broader role of SoSa I in the down-regulation of inflammation.
- 147Lim, H. J.; Jang, H.-J.; Kim, M. H.; Lee, S.; Lee, S. W.; Lee, S.-J.; Rho, M.-C. Oleanolic Acid Acetate Exerts Anti-Inflammatory Activity via IKKα/β Suppression in TLR3-Mediated NF-KB Activation. Molecules 2019, 24 (21), 4002, DOI: 10.3390/molecules24214002[Crossref], [CAS], Google Scholar147https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXitlCgurfJ&md5=21d6df22cb0d6f032d8538f49f4f53c6Oleanolic acid acetate exerts anti-inflammatory activity via IKKa/B suppression in TLR3-mediated NF-KB activationLim, Hyung Jin; Jang, Hyun-Jae; Kim, Mi Hwa; Lee, Soyoung; Lee, Seung Woong; Lee, Seung-Jae; Rho, Mun-ChualMolecules (2019), 24 (21), 4002CODEN: MOLEFW; ISSN:1420-3049. (MDPI AG)Here, we show the mol. basis for the effect of OAA on Toll-like receptor (TLR) downstream signaling. OAA treatment significantly inhibited the secretion of embryonic alk. phosphatase (SEAP) induced by polyinosinic acid (poly(I), TLR3 ligand) in a dose-dependent manner and without cytotoxicity in THP1-XBlue cells. In addn., OAA downregulated the gene expression of poly(I) induced pro-inflammatory cytokines and chemokines genes such as MCP-1, IL-1B, IL-8, VCAM-1 and ICAM-1. Furthermore, we found that the inhibition activity of OAA was accompanied by decreased activation of not only nuclear factor-kappa B (NF-KB) signaling but also mitogen-activated protein kinase (MAPK) signaling upon stimulation with the TLR3 agonist. Interestingly, the interaction of OAA with IKB kinase a/B (IKKa/B) strongly attenuated the prodn. of certain proteins and inflammatory cytokines in the TLR3 signaling pathway, such as nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha (IkBa), extracellular regulated kinases (ERK), and p38, in an in vitro model. These results reveal new insight into the understanding of the regulatory mechanisms of the downstream TLR3 signaling pathway and consequent inflammatory responses that are involved in the development and progression of inflammatory diseases.
- 148Okada, T.; Kawakita, F.; Nishikawa, H.; Nakano, F.; Liu, L.; Suzuki, H. Selective Toll-Like Receptor 4 Antagonists Prevent Acute Blood-Brain Barrier Disruption After Subarachnoid Hemorrhage in Mice. Mol. Neurobiol. 2019, 56 (2), 976– 985, DOI: 10.1007/s12035-018-1145-2[Crossref], [PubMed], [CAS], Google Scholar148https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhtVOls7rN&md5=0b14a479f1603b50aab3f5e3fcf1fd82Selective Toll-Like Receptor 4 Antagonists Prevent Acute Blood-Brain Barrier Disruption After Subarachnoid Hemorrhage in MiceOkada, Takeshi; Kawakita, Fumihiro; Nishikawa, Hirofumi; Nakano, Fumi; Liu, Lei; Suzuki, HidenoriMolecular Neurobiology (2019), 56 (2), 976-985CODEN: MONBEW; ISSN:0893-7648. (Humana Press Inc.)There are no direct evidences showing the linkage between Toll-like receptor 4 (TLR4) and blood-brain barrier (BBB) disruption after subarachnoid hemorrhage (SAH). The purpose of this study was to examine if selective blockage of TLR4 prevents BBB disruption after SAH in mice and if the TLR4 signaling involves mitogen-activated protein kinases (MAPKs). One hundred and fifty-one C57BL/6 male mice underwent sham or endovascular perforation SAH operation, randomly followed by an intracerebroventricular infusion of vehicle or two dosages (117 or 585 ng) of a selective TLR4 antagonist IAXO-102 at 30 min post-operation. The effects were evaluated by survival rates, neurol. scores, and brain water content at 24-72 h and IgG immunostaining and Western blotting at 24 h post-SAH. IAXO-102 significantly prevented post-SAH neurol. impairments, brain edema, and BBB disruption, resulting in improved survival rates. IAXO-102 also significantly suppressed post-SAH activation of a major isoform of MAPK p46 c-Jun N-terminal kinase (JNK) and matrix metalloproteinase-9 as well as periostin induction and preserved tight junction protein zona occludens-1. Another selective TLR4 antagonist TAK-242, which has a different binding site from IAXO-102, also showed similar effects to IAXO-102. This study first provided the evidence that TLR4 signaling is involved in post-SAH acute BBB disruption and that the signaling is mediated at least partly by JNK activation. TLR4-targeted therapy may be promising to reduce post-SAH morbidities and mortalities.
- 149Plunk, M. A.; Alaniz, A.; Olademehin, O. P.; Ellington, T. L.; Shuford, K. L.; Kane, R. R. Design and Catalyzed Activation of Tak-242 Prodrugs for Localized Inhibition of TLR4-Induced Inflammation. ACS Med. Chem. Lett. 2020, 11 (2), 141– 146, DOI: 10.1021/acsmedchemlett.9b00518[ACS Full Text], [CAS], Google Scholar149https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXjt1Gjug%253D%253D&md5=3d4e7b808795806e8b088aff98369e29Design and catalyzed activation of Tak-242 prodrugs for localized inhibition of TLR4-induced inflammationPlunk, Michael A.; Alaniz, Alyssa; Olademehin, Olatunde P.; Ellington, Thomas L.; Shuford, Kevin L.; Kane, Robert R.ACS Medicinal Chemistry Letters (2020), 11 (2), 141-146CODEN: AMCLCT; ISSN:1948-5875. (American Chemical Society)Tak-242 (resatorvid), a Toll-like Receptor 4 (TLR4) inhibitor, has been identified as a potent suppressor of innate inflammation. As a strategy to target Tak-242 to select tissue, four TLR4-inactive prodrugs were synthesized for activation via two different release mechanisms. Two nitrobenzyl Tak-242 prodrugs released the parent drug upon exposure to the exogenous enzyme nitroreductase, while the two propargyl prodrugs were converted to Tak-242 in the presence of Pd0.
- 150Facchini, F. A.; Zaffaroni, L.; Minotti, A.; Rapisarda, S.; Calabrese, V.; Forcella, M.; Fusi, P.; Airoldi, C.; Ciaramelli, C.; Billod, J. M.; Schromm, A. B.; Braun, H.; Palmer, C.; Beyaert, R.; Lapenta, F.; Jerala, R.; Pirianov, G.; Martin-Santamaria, S.; Peri, F. Structure-Activity Relationship in Monosaccharide-Based Toll-like Receptor 4 (TLR4) Antagonists. J. Med. Chem. 2018, 61 (7), 2895– 2909, DOI: 10.1021/acs.jmedchem.7b01803[ACS Full Text], [CAS], Google Scholar150https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXjs1ChtrY%253D&md5=dca4454e8d270b8b0ad8ba765bb547d7Structure-Activity Relationship in Monosaccharide-Based Toll-Like Receptor 4 (TLR4) AntagonistsFacchini, Fabio A.; Zaffaroni, Lenny; Minotti, Alberto; Rapisarda, Silvia; Calabrese, Valentina; Forcella, Matilde; Fusi, Paola; Airoldi, Cristina; Ciaramelli, Carlotta; Billod, Jean-Marc; Schromm, Andra; Braun, Harald; Palmer, Charys; Beyaert, Rudi; Lapenta, Fabio; Jerala, Roman; Pirianov, Grisha; Martin-Santamaria, Sonsoles; Peri, FrancescoJournal of Medicinal Chemistry (2018), 61 (7), 2895-2909CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)The structure-activity relationship was investigated in a series of synthetic TLR4 antagonists formed by a glucosamine core linked to two phosphate esters and two linear carbon chains. Mol. modeling showed that the compds. with 10, 12, and 14 carbons chains are assocd. with higher stabilization of the MD-2/TLR4 antagonist conformation than in the case of the C16 variant. Binding expts. with human MD-2 showed that the C12 and C14 variants have higher affinity than C10, while the C16 variant did not interact with the protein. The mols., with the exception of the C16 variant, inhibited the LPS-stimulated TLR4 signal in human and murine cells, and the antagonist potency mirrored the MD-2 affinity calcd. from in vitro binding expts. Fourier-transform IR, NMR, and small angle X-ray scattering measurements suggested that the aggregation state in aq. soln. depends on fatty acid chain lengths and that this property can influence TLR4 activity in this series of compds.
- 151Fernández, G.; Moraga, A.; Cuartero, M. I.; García-Culebras, A.; Peña-Martínez, C.; Pradillo, J. M.; Hernández-Jiménez, M.; Sacristán, S.; Ayuso, M. I.; Gonzalo-Gobernado, R.; Fernández-López, D.; Martín, M. E.; Moro, M. A.; González, V. M.; Lizasoain, I. TLR4-Binding DNA Aptamers Show a Protective Effect against Acute Stroke in Animal Models. Mol. Ther. 2018, 26 (8), 2047– 2059, DOI: 10.1016/j.ymthe.2018.05.019[Crossref], [PubMed], [CAS], Google Scholar151https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhsVekur%252FP&md5=0eab3caf2fdac646839068511b1e74e8TLR4-Binding DNA Aptamers Show a Protective Effect against Acute Stroke in Animal ModelsFernandez, Geronimo; Moraga, Ana; Cuartero, Maria I.; Garcia-Culebras, Alicia; Pena-Martinez, Carolina; Pradillo, Jesus M.; Hernandez-Jimenez, Macarena; Sacristan, Silvia; Ayuso, M. Irene; Gonzalo-Gobernado, Rafael; Fernandez-Lopez, David; Martin, M. Elena; Moro, Maria A.; Gonzalez, Victor M.; Lizasoain, IgnacioMolecular Therapy (2018), 26 (8), 2047-2059CODEN: MTOHCK; ISSN:1525-0024. (Cell Press)Since Toll-like receptor 4 (TLR4) mediates brain damage after stroke, development of TLR4 antagonists is a promising therapeutic strategy for this disease. Our aim was to generate TLR4-blocking DNA aptamers to be used for stroke treatment. From a random oligonucleotide pool, we identified two aptamers (ApTLR#1R, ApTLR#4F) with high affinity for human TLR4 by systematic evolution of ligands by exponential enrichment (SELEX). Optimized truncated forms (ApTLR#1RT, ApTLR#4FT) were obtained. Our data demonstrate specific binding of both aptamers to human TLR4 as well as a TLR4 antagonistic effect. ApTLR#4F and ApTLR#4FT showed a long-lasting protective effect against brain injury induced by middle cerebral artery occlusion (MCAO), an effect that was absent in TLR4-deficient mice. Similar effects were obtained in other MCAO models, including in rat. Addnl., efficacy of ApTLR#4FT in a model of brain ischemia-reperfusion in rat supports the use of this aptamer in patients undergoing artery recanalization induced by pharmacol. or mech. interventions. The absence of major toxicol. aspects and the good safety profile of the aptamers further encourage their future clin. positioning for stroke therapy and possibly other diseases in which TLR4 plays a deleterious role.
- 152Flacher, V.; Neuberg, P.; Point, F.; Daubeuf, F.; Muller, Q.; Sigwalt, D.; Fauny, J. D.; Remy, J. S.; Frossard, N.; Wagner, A.; Mueller, C. G.; Schaeffer, E. Mannoside Glycolipid Conjugates Display Anti-Inflammatory Activity by Inhibition of Toll-like Receptor-4 Mediated Cell Activation. ACS Chem. Biol. 2015, 10 (12), 2697– 2705, DOI: 10.1021/acschembio.5b00552[ACS Full Text], [CAS], Google Scholar152https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXhsFanu73O&md5=e1ddb8cccf5b4444815cfad54a96fd82Mannoside Glycolipid Conjugates Display Anti-inflammatory Activity by Inhibition of Toll-like Receptor-4 Mediated Cell ActivationFlacher, Vincent; Neuberg, Patrick; Point, Floriane; Daubeuf, Francois; Muller, Quentin; Sigwalt, David; Fauny, Jean-Daniel; Remy, Jean-Serge; Frossard, Nelly; Wagner, Alain; Mueller, Christopher G.; Schaeffer, EvelyneACS Chemical Biology (2015), 10 (12), 2697-2705CODEN: ACBCCT; ISSN:1554-8929. (American Chemical Society)Inhibition of excessive Toll-like receptor 4 (TLR4) signaling is a therapeutic approach pursued for many inflammatory diseases. We report that Mannoside Glycolipid Conjugates (MGCs) selectively blocked TLR4-mediated activation of human monocytes and monocyte-derived dendritic cells (DCs) by lipopolysaccharide (LPS). They potently suppressed pro-inflammatory cytokine secretion and maturation of DCs exposed to LPS, leading to impaired T cell stimulation. MGCs did not interfere with LPS and could act in a delayed manner, hours after LPS stimulation. Their inhibitory action required both the sugar heads and the lipid chain, although the nature of the sugar and the structure of the lipid tail could be modified. They blocked early signaling events at the cell membrane, enhanced internalization of CD14 receptors, and prevented colocalization of CD14 and TLR4, thereby abolishing NF-κB nuclear translocation. When the best lead conjugate was tested in a mouse model of LPS-induced acute lung inflammation, it displayed an anti-inflammatory action by suppressing the recruitment of neutrophils. Thus, MGCs could serve as promising leads for the development of selective TLR4 antagonistic agents for inflammatory diseases.
- 153Lu, M. Y.; Chen, C. C.; Lee, L. Y.; Lin, T. W.; Kuo, C. F. N6-(2-Hydroxyethyl)Adenosine in the Medicinal Mushroom Cordyceps Cicadae Attenuates Lipopolysaccharide-Stimulated Pro-Inflammatory Responses by Suppressing TLR4-Mediated NF-KB Signaling Pathways. J. Nat. Prod. 2015, 78 (10), 2452– 2460, DOI: 10.1021/acs.jnatprod.5b00573[ACS Full Text], [CAS], Google Scholar153https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXhs1yisb7O&md5=14acc56b55bd736a85a6c46c2224159cN6-(2-Hydroxyethyl)adenosine in the Medicinal Mushroom Cordyceps cicadae Attenuates Lipopolysaccharide-Stimulated Pro-inflammatory Responses by Suppressing TLR4-Mediated NF-κB Signaling PathwaysLu, Meng-Ying; Chen, Chin-Chu; Lee, Li-Ya; Lin, Ting-Wei; Kuo, Chia-FengJournal of Natural Products (2015), 78 (10), 2452-2460CODEN: JNPRDF; ISSN:0163-3864. (American Chemical Society-American Society of Pharmacognosy)Natural products play an important role in promoting health with relation to the prevention of chronic inflammation. N6-(2-Hydroxyethyl)adenosine (HEA), a physiol. active compd. in the medicinal mushroom Cordyceps cicadae, has been identified as a Ca2+ antagonist and shown to control circulation and possess sedative activity in pharmacol. tests. The fruiting body of C. cicadae has been widely applied in Chinese medicine. However, neither the anti-inflammatory activities of HEA nor the fruiting bodies of C. cicadae have been carefully examd. In this study, the authors first cultured the fruiting bodies of C. cicadae and then investigated the anti-inflammatory activities of water and methanol exts. of wild and artificially cultured C. cicadae fruiting bodies. Next, the authors detd. the amt. of three bioactive compds., adenosine, cordycepin, and HEA, in the exts. and evaluated their synergistic anti-inflammatory effects. Moreover, the possible mechanism involved in anti-inflammatory action of HEA isolated from C. cicadae was investigated. The results indicate that cordycepin is more potent than adenosine and HEA in suppressing the lipopolysaccharide (LPS)-stimulated release of pro-inflammatory cytokines by RAW 264.7 macrophages; however, no synergistic effect was obsd. with these three compds. HEA attenuated the LPS-induced pro-inflammatory responses by suppressing the toll-like receptor (TLR)4-mediated nuclear factor-κB (NF-κB) signaling pathway. This result will support the use of HEA as an anti-inflammatory agent and C. cicadae fruiting bodies as an anti-inflammatory mushroom.
- 154Li, S.; Gao, X.; Wu, X.; Wu, Z.; Cheng, L.; Zhu, L.; Shen, D.; Tong, X. Parthenolide Inhibits LPS-Induced Inflammatory Cytokines through the Toll-like Receptor 4 Signal Pathway in THP-1 Cells. Acta Biochim. Biophys. Sin. 2015, 47 (5), 368– 375, DOI: 10.1093/abbs/gmv019[Crossref], [PubMed], [CAS], Google Scholar154https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXhsFChsLjL&md5=f5b4274c91e0f7b672c8d2798941ad76Parthenolide inhibits LPS-induced inflammatory cytokines through the toll-like receptor 4 signal pathway in THP-1 cellsLi, Shuangshuang; Gao, Xiangli; Wu, Xiaoxin; Wu, Zhigang; Cheng, Linfang; Zhu, Lifen; Shen, Dan; Tong, XiangminActa Biochimica et Biophysica Sinica (2015), 47 (5), 368-375CODEN: ABBSC2; ISSN:1672-9145. (ABBS Editorial Office)Parthenolide (PTL) shows potent anti-inflammatory and anti-cancer activities. In the present study, the mol. mechanisms of PTL's activities were explored in lipopolysaccharide (LPS)-induced human leukemia monocytic THP-1 cells and human primary monocytes. The 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium salt (MTS) assay was used to analyze the effect of PTL on THP-1 cell viability. ELISA was used to det. the effect of PTL on LPS-induced inflammatory cytokine secretion. Flow cytometry and quant. real-time polymerase chain reaction were used to assess the effect of PTL on LPS-induced toll-like receptor 4 (TLR4) expression. Phosphorylation levels of signaling mols. were detd. by western blot anal. Results showed that PTL <12.5 μM did not significantly affect THP-1 cells viability. LPS treatment led to a marked up-regulation of interleukin (IL)-6, IL-1β, IL-8, IL-12p40, tumor necrosis factor-α, IL-18, and NO in THP-1 cells. However, PTL inhibited the expression of these cytokines in a dose-dependent manner, with IC50 values of 1.091-2.620 μM. PTL blocked TLR4 expression with an IC50 value of 1.373 μM as detd. by the flow cytometry anal., and this blocking effect was verified at both protein and mRNA levels. Up-regulation of phosphorylation levels of extracellular signal-regulated kinase 1/2, Jun N-terminal kinase, p38, nuclear factor κB (NF-κB) p65, and IκBα and up-regulation of expressions of other mols. (inducible nitric oxide synthase, TLR4, and TNF receptor-assocd. factor 6) induced by LPS were abolished by PTL in a dose-dependent manner. The anti-inflammatory mechanisms of PTL operate partly through the TLR4-mediated mitogen-activated protein kinase and NF-κB signaling pathways. Therefore, TLR4 may be a new target for anti-inflammation therapies.
- 155Ye, S.; Zheng, Q.; Zhou, Y.; Bai, B.; Yang, D.; Zhao, Z. Chlojaponilactone B Attenuates Lipopolysaccharide-Induced Inflammatory Responses by Suppressing TLR4-Mediated ROS Generation and NF-KB Signaling Pathway. Molecules 2019, 24 (20), 3731, DOI: 10.3390/molecules24203731[Crossref], [CAS], Google Scholar155https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXitlaiur%252FM&md5=64b81017e8b870c825c5d9847902aadeChlojaponilactone B attenuates lipopolysaccharide-induced inflammatory responses by suppressing TLR4-mediated ROS generation and NF-κB signaling pathwayYe, Shaoxia; Zheng, Qiyao; Zhou, Yang; Bai, Bai; Yang, Depo; Zhao, ZhiminMolecules (2019), 24 (20), 3731CODEN: MOLEFW; ISSN:1420-3049. (MDPI AG)The lindenane-type sesquiterpenoid chlojaponilactone B (1), isolated from Chloranthus japonicus, has been reported to possess anti-inflammatory properties. The present study aimed to further explore the mol. mechanisms underlying the anti-inflammatory activity of 1. RNA-seq analyses revealed the significant changes in the expression levels of genes related to multiple inflammatory pathways upon treatment of lipopolysaccharide (LPS)-induced RAW 264.7 murine macrophages with 1. Real time PCR (RT-PCR) and Western blotting were used to confirm the modulations in the expression of essential mols. related to inflammatory responses. Compd. 1 inhibited toll like receptor 4 (TLR4) and myeloid differentiation factor 88 (MyD88) activation upon LPS stimulation, influencing the expression of NF-κB and pro-inflammatory mediators. Mol. docking studies showed that 1 bound to TLR4 in a manner similar to that of TAK-242, a TLR4 inhibitor. Moreover, our results showed that 1 suppressed inflammatory responses by inhibiting TLR4 and subsequently decreasing reactive oxygen species (ROS) generation, downregulating the NF-κB, thus reducing the expression of the pro-inflammatory cytokines iNOS, NO, COX-2, IL-6 and TNF-α; these effects were similar to those of TAK-242. We proposed that 1 should be considered as a potential anti-inflammatory compd. in future research.
- 156He, J.; Han, S.; Li, X. X.; Wang, Q. Q.; Cui, Y.; Chen, Y.; Gao, H.; Huang, L.; Yang, S. Diethyl Blechnic Exhibits Anti-Inflammatory and Antioxidative Activity via the TLR4/MyD88 Signaling Pathway in LPS-Stimulated RAW264.7 Cells. Molecules 2019, 24 (24), 4502, DOI: 10.3390/molecules24244502[Crossref], [CAS], Google Scholar156https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhs1Ort78%253D&md5=9925b723d6a1839cc1f860f090267d75Diethyl blechnic exhibits anti-inflammatory and antioxidative activity via the TLR4/MyD88 signaling pathway in LPS-stimulated RAW264.7 cellsHe, Jia; Han, Shan; Li, Xin-Xing; Wang, Qin-Qin; Cui, Yushun; Chen, Yangling; Gao, Hongwei; Huang, Liting; Yang, ShilinMolecules (2019), 24 (24), 4502CODEN: MOLEFW; ISSN:1420-3049. (MDPI AG)Inflammation is a common pathogenesis in many diseases. Salvia miltiorrhiza Bunge (Danshen), a traditional Chinese medicine, has been considered to have good anti-inflammatory effects. In the present study, we investigated the anti-inflammatory effect of di-Et blechnic (DB), a novel compd. isolated from Danshen, and its possible mechanisms in lipopolysaccharide (LPS)-induced RAW264.7 macrophages. The results showed that DB can inhibit the LPS-induced pro-inflammatory cytokines release of prostaglandin E2 (PGE2) and mRNA expression of TNF-a, IL-6, and IL-1b. In addn., the results of the flow cytometry assay and the fluorometric intracellular ROS kit assay indicated that DB reduced the generation of ROS in LPS-stimualted RAW264.7 cells. DB reversed the LPS-induced loss of the mitochondrial membrane potential (MMP). Furthermore, DB suppressed the LPS-stimulated increased expression of Toll-like receptor 4 (TLR4), myeloid differential protein-88 (MyD88) and phosphorylation of TAK1, PI3K, and AKT. DB promoted NF-E2-related factor 2 (Nrf2) into the nucleus, increased the expression of heme oxygenase-1 (HO-1) and NAD(P)H dehydrogenase [quinone] 1 (NQO1) and reduced the expression of Keap1. In summary, DB may inhibit LPS-induced inflammation, which mainly occurs through TLR4/MyD88 and oxidative stress signaling pathways in RAW264.7 cells.
- 157Thakur, V. R.; Beladiya, J. V.; Chaudagar, K. K.; Mehta, A. A. An Anti-Asthmatic Activity of Natural Toll-like Receptor-4 Antagonist in OVA-LPS-Induced Asthmatic Rats. Clin. Exp. Pharmacol. Physiol. 2018, 45 (11), 1187– 1197, DOI: 10.1111/1440-1681.13002[Crossref], [PubMed], [CAS], Google Scholar157https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhtlOrtr3J&md5=b2b82cc778823a5a8962d6ac72af4461An anti-asthmatic activity of natural Toll-like receptor-4 antagonist in OVA-LPS-induced asthmatic ratsThakur, Vandana R.; Beladiya, Jayesh V.; Chaudagar, Kiranj K.; Mehta, Anita A.Clinical and Experimental Pharmacology and Physiology (2018), 45 (11), 1187-1197CODEN: CEXPB9; ISSN:0305-1870. (Wiley-Blackwell)Summary : Toll-like receptor-4 (TLR4) is a key component of the innate immune system and activation of TLR4 signaling has a significant role in the pathogenesis of asthma. In the in vivo study, rats were sensitized with ovalbumin (OVA) (100 μg/kg, i.p.) on the 7th, 14th and 21st days and challenged intranasally with OVA (100 μg/100 μL) and LPS (10 ng/100 μL), 4 days/wk for 3 wk. At the end of the expt., we performed lung function parameters (respiratory rate, tidal vol., airflow rate), inflammatory cytokines (interleukin [IL]-4, IL-5, IL-13), total and differential leukocytes in blood as well as bronchoalveolar lavage fluid (BALf) and histol. examns. The computational study indicated that TLR4 antagonist activity of soya PC is due to linoleic acid (18:2) fatty acid chain. Soya PC significantly suppressed the LPS-induced neutrophil adhesion in a concn.-dependent manner to 1 μg/mL. The treatment of soya PC (5 and 10 mg/kg, 18 days, i.p.) significantly improved the lung function parameters, total and differential leukocyte counts in blood and BALf in asthmatic rats. This efficacy of soya PC was in extent similar to dexamethasone (2.5 mg/kg, 18 days, i.p.). However, soya PC was superior to dexamethasone in terms of benefits. The protective action of soya PC may be due to TLR4 antagonist activity and linoleic acid compn.
- 158Sun, H.; Zhu, X.; Cai, W.; Qiu, L. Hypaphorine Attenuates Lipopolysaccharide-Induced Endothelial Inflammation via Regulation of TLR4 and PPAR-γ Dependent on PI3K/Akt/MTOR Signal Pathway. Int. J. Mol. Sci. 2017, 18 (4), 844, DOI: 10.3390/ijms18040844[Crossref], [CAS], Google Scholar158https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhvFGjs7nL&md5=f9555b96313868cc1be3b50f642bdea0Hypaphorine attenuates lipopolysaccharide-induced endothelial inflammation via regulation of TLR4 and PPAR-γ dependent on PI3K/Akt/mTOR signal pathwaySun, Haijian; Zhu, Xuexue; Cai, Weiwei; Qiu, LiyingInternational Journal of Molecular Sciences (2017), 18 (4), 844/1-844/15CODEN: IJMCFK; ISSN:1422-0067. (MDPI AG)Endothelial lesion response to injurious stimuli is a necessary step for initiating inflammatory cascades in blood vessels. Hypaphorine (Hy) from different marine sources is shown to exhibit anti-inflammatory properties. However, the potential roles and possible mol. mechanisms of Hy in endothelial inflammation have yet to be fully clarified. We showed that Hy significantly inhibited the pos. effects of lipopolysaccharide (LPS) on pro-inflammatory cytokines expressions, including tumor necrosis factor-± (TNF-±), interleukin-12 (IL-12), monocyte chemoattractant protein 1 (MCP-1) and vascular cellular adhesion mol.-1 (VCAM-1), as well as induction of the phosphorylation of Akt and mTOR in HMEC-1 cells. The downregulated peroxisome proliferator-activated receptor γ (PPAR-γ) and upregulated toll-like receptor 4 (TLR4) expressions in LPS-challenged endothelial cells were prevented by Hy. Inhibition of both PI3K and mTOR reversed LPS-stimulated increases in TLR4 expressions and decreases in PPAR-γ levels. Genetic silencing of TLR4 or PPAR-γ agonist pioglitazone obviously abrogated the levels of pro-inflammatory cytokines in LPS-treated HMEC-1 cells. These results suggest that Hy may exert anti-inflammatory actions through the regulation of TLR4 and PPAR-γ dependent on PI3K/Akt/mTOR signal pathways. Hy may be considered as a therapeutic agent that can potentially relieve or ameliorate endothelial inflammation-assocd. diseases.
- 159Malgorzata-Miller, G.; Heinbockel, L.; Brandenburg, K.; Van Der Meer, J. W. M.; Netea, M. G.; Joosten, L. A. B. Bartonella Quintana Lipopolysaccharide (LPS): Structure and Characteristics of a Potent TLR4 Antagonist for in-Vitro and in-Vivo Applications. Sci. Rep. 2016, 6, 34221, DOI: 10.1038/srep34221[Crossref], [PubMed], [CAS], Google Scholar159https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XhsF2qsL%252FP&md5=c84db4fb33eb8ee5e15ab0a7d70b61e0Bartonella quintana lipopolysaccharide (LPS): structure and characteristics of a potent TLR4 antagonist for in-vitro and in-vivo applicationsMalgorzata-Miller, Gosia; Heinbockel, Lena; Brandenburg, Klaus; van der Meer, Jos W. M.; Netea, Mihai G.; Joosten, Leo A. B.Scientific Reports (2016), 6 (), 34221CODEN: SRCEC3; ISSN:2045-2322. (Nature Publishing Group)The pattern recognition receptor TLR4 is well known as a crucial receptor during infection and inflammation. Several TLR4 antagonists have been reported to inhibit the function of TLR4. Both natural occurring antagonists, lipopolysaccharide (LPS) from Gram-neg. bacteria as well as synthetic compds. based on the lipid A structure of LPS have been described as potent inhibitors of TLR4. Here, we have examd. the characteristics of a natural TLR4 antagonist, isolated from Bartonella quintana bacterium by elucidating its chem. primary structure. We have found that this TLR4 antagonist is actually a lipooligosaccharide (LOS) instead of a LPS, and that it acts very effective, with a high inhibitory activity against triggering by the LPS-TLR4 system in the presence of a potent TLR4 agonist (E. coli LPS). Furthermore, we demonstrate that B. quintana LPS is not inactivated by polymyxin B, a classical cyclic cationic polypeptide antibiotic that bind the lipid A part of LPS, such as E. coli LPS. Using a murine LPS/D-galactosamine endotoxemia model we showed that treatment with B. quintana LPS could improve the survival rate significantly. Since endogenous TLR4 ligands have been assocd. with several inflammatory- and immune-diseases, B. quintana LPS might be a novel therapeutic strategy for TLR4-driven pathologies.
- 160Shih, T. L.; Liu, M. H.; Li, C. W.; Kuo, C. F. Halo-Substituted Chalcones and Azachalcones-Inhibited, Lipopolysaccharited-Stimulated, pro-Inflammatory Responses through the TLR4-Mediated Pathway. Molecules 2018, 23 (3), 597, DOI: 10.3390/molecules23030597
- 161Guo, X. Y.; Cao, Q. Y.; Tang, Y. M.; Liang, Q. L. Simple Synthesis and Anti-Inflammatory Activities of Spanrstolonin B Derivatives. Phytochem. Lett. 2018, 24, 158– 162, DOI: 10.1016/j.phytol.2018.02.011[Crossref], [CAS], Google Scholar161https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXjs1eitL4%253D&md5=306dd718526f5bb606324ed0d792e815Simple synthesis and anti-inflammatory activities of Spanrstolonin B derivativesGuo, Xing-Yu; Cao, Qing-Yun; Tang, Ya-Min; Liang, Qiao-LiPhytochemistry Letters (2018), 24 (), 158-162CODEN: PLHEBK; ISSN:1874-3900. (Elsevier B.V.)Toll-like receptors are identified as an important factor in regulation of expression of pro-inflammatory cytokines and used as an important target in the field of anti-inflammation. SpanrstoloninB (SsnB), a new isocoumarin compd. isolated from the tuber of Scirpus yagara, is a Toll-like receptor 2 (TLR2) and TLR4 antagonist and can selectively block TLR2- and TLR4- mediated macrophages inflammatory responses. In this study, ten derivs. (A1-A6, B1-B2, and C1-C2) were synthesized by the structural modification of compds. 1 and 2, of which nine derivs. are new compds. The n-octanol/water partition coeffs. (Kow) of these derivs. were detd. by high performance liq. chromatog. method, and their anti-inflammatory activities were evaluated of inhibiting the secretion of TNF-α and IL-6 in LPS- or Pam3csk4- induced RAW264.7 cells. Preliminary structure-activity relationship study revealed that methylated, acetylated and butyrylated derivs. (A1-A6) exhibited weaker activities of anti-inflammatory than compd. 1 and 2. However, hydrolyzed and isoquinolone derivs. (B1-B2 and C1-C2) had better potential to decrease the levels of TNF-α and IL-6.
- 162Arora, S.; Ahmad, S.; Irshad, R.; Goyal, Y.; Rafat, S.; Siddiqui, N.; Dev, K.; Husain, M.; Ali, S.; Mohan, A.; Syed, M. A. TLRs in Pulmonary Diseases. Life Sci. 2019, 233, 116671, DOI: 10.1016/j.lfs.2019.116671[Crossref], [PubMed], [CAS], Google Scholar162https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhsFGjsLnK&md5=be2ba61debcb16c8c2cb23451e5f3341TLRs in pulmonary diseasesArora, Shweta; Ahmad, Shaniya; Irshad, Rasha; Goyal, Yamini; Rafat, Sahar; Siddiqui, Neha; Dev, Kapil; Husain, Mohammad; Ali, Shakir; Mohan, Anant; Syed, Mansoor AliLife Sciences (2019), 233 (), 116671CODEN: LIFSAK; ISSN:0024-3205. (Elsevier B.V.)A review. Toll-like receptors (TLRs) comprise a clan of proteins involved in identification and triggering a suitable response against pathogenic attacks. As lung is steadily exposed to multiple infectious agents, antigens and host-derived danger signals, the inhabiting stromal and myeloid cells of the lung express an aggregate of TLRs which perceive the endogenously derived damage-assocd. mol. patterns (DAMPs) along with pathogen assocd. mol. patterns (PAMPs) and trigger the TLR-assocd. signalling events involved in host defense. Thus, they form an imperative component of host defense activation in case of microbial infections as well as non-infectious pulmonary disorders such as interstitial lung disease, acute lung injury and airways disease, such as COPD and asthma. They also play an equally important role in lung cancer. Targeting the TLR signalling network would pave ways to the design of more reliable and effective vaccines against infectious agents and control deadly infections, desensitize allergens and reduce inflammation. Moreover, TLR agonists may act as adjuvants by increasing the efficiency of cancer vaccines, thereby contributing their role in treatment of lung cancer too. Overall, TLRs present a compelling and expeditiously bolstered area of research and addressing their signalling events would be of significant use in pulmonary diseases.
- 163Biggadike, K.; Ahmed, M.; Ball, D. I.; Coe, D. M.; Dalmas Wilk, D. A.; Edwards, C. D.; Gibbon, B. H.; Hardy, C. J.; Hermitage, S. A.; Hessey, J. O.; Hillegas, A. E.; Hughes, S. C.; Lazarides, L.; Lewell, X. Q.; Lucas, A.; Mallett, D. N.; Price, M. A.; Priest, F. M.; Quint, D. J.; Shah, P.; Sitaram, A.; Smith, S. A.; Stocker, R.; Trivedi, N. A.; Tsitoura, D. C.; Weller, V. Discovery of 6-Amino-2-{[(1S)-1-Methylbutyl]Oxy}-9-[5-(1-Piperidinyl)Pentyl]-7,9-Dihydro-8H-Purin-8-One (GSK2245035), a Highly Potent and Selective Intranasal Toll-Like Receptor 7 Agonist for the Treatment of Asthma. J. Med. Chem. 2016, 59 (5), 1711– 1726, DOI: 10.1021/acs.jmedchem.5b01647[ACS Full Text], [CAS], Google Scholar163https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28Xit1aksrk%253D&md5=adab143ac46a049054d9ee4f52cf6292Discovery of 6-Amino-2-{[(1S)-1-methylbutyl]oxy}-9-[5-(1-piperidinyl)pentyl]-7,9-dihydro-8H-purin-8-one (GSK2245035), a Highly Potent and Selective Intranasal Toll-Like Receptor 7 Agonist for the Treatment of AsthmaBiggadike, Keith; Ahmed, Mahbub; Ball, Doug I.; Coe, Diane M.; Dalmas Wilk, Deidre A.; Edwards, Chris D.; Gibbon, Bob H.; Hardy, Charlotte J.; Hermitage, Stephen A.; Hessey, Joanne O.; Hillegas, Aimee E.; Hughes, Stephen C.; Lazarides, Linos; Lewell, Xiao Q.; Lucas, Amanda; Mallett, David N.; Price, Mark A.; Priest, Fiona M.; Quint, Diana J.; Shah, Poonam; Sitaram, Anesh; Smith, Stephen A.; Stocker, Richard; Trivedi, Naimisha A.; Tsitoura, Daphne C.; Weller, VictoriaJournal of Medicinal Chemistry (2016), 59 (5), 1711-1726CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)Induction of IFNα in the upper airways via activation of TLR7 represents a novel immunomodulatory approach to the treatment of allergic asthma. Exploration of 8-oxoadenine derivs. bearing satd. oxygen or nitrogen heterocycles in the N-9 substituent has revealed a remarkable selective enhancement in IFNα inducing potency in the nitrogen series. Further potency enhancement was achieved with the novel (S)-pentyloxy substitution at C-2 leading to the selection of GSK2245035 (32) as an intranasal development candidate. In human cell cultures, compd. 32 resulted in suppression of Th2 cytokine responses to allergens, while in vivo intranasal administration at very low doses led to local upregulation of TLR7-mediated cytokines (IP-10). Target engagement was confirmed in humans following single intranasal doses of 32 of ≥20 ng, and reproducible pharmacol. response was demonstrated following repeat intranasal dosing at weekly intervals.
- 164Yoo, E.; Crall, B. M.; Balakrishna, R.; Malladi, S. S.; Fox, L. M.; Hermanson, A. R.; David, S. A. Structure-Activity Relationships in Toll-like Receptor 7 Agonistic 1H-Imidazo[4,5-c]Pyridines. Org. Biomol. Chem. 2013, 11 (38), 6526– 6545, DOI: 10.1039/c3ob40816g[Crossref], [PubMed], [CAS], Google Scholar164https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXhsVCjtL3M&md5=3280f9fcbe6343d78656ed6a3fea08c2Structure-activity relationships in Toll-like receptor 7 agonistic 1H-imidazo[4,5-c]pyridinesYoo, Euna; Crall, Breanna M.; Balakrishna, Rajalakshmi; Malladi, Subbalakshmi S.; Fox, Lauren M.; Hermanson, Alec R.; David, Sunil A.Organic & Biomolecular Chemistry (2013), 11 (38), 6526-6545CODEN: OBCRAK; ISSN:1477-0520. (Royal Society of Chemistry)Engagement of TLR7 in plasmacytoid dendritic cells leads to the induction of IFN-α/β which plays essential functions in the control of adaptive immunity. We had previously examd. structure-activity relationships (SAR) in TLR7/8-agonistic imidazoquinolines with a focus on substituents at the N1, C2, N3 and N4 positions, and we now report SAR on 1H-imidazo[4,5-c]pyridines. 1-Benzyl-2-butyl-1H-imidazo[4,5-c]pyridin-4-amine was a pure TLR7-agonist with negligible activity on TLR8. Increase in potency was obsd. in N6-substituted analogs, esp. in those compds. with electron-rich substituents. Direct aryl-aryl connections at C6 abrogated activity, but TLR7 agonism was reinstated in 6-benzyl and 6-phenethyl analogs. Consistent with the pure TLR7-agonistic behavior, prominent IFN-α induction in human PBMCs was obsd. with minimal proinflammatory cytokine induction. A benzologue of imidazoquinoline was also synthesized which showed substantial improvements in potency over the parent imidazopyridine. Distinct differences in N6-substituted analogs were obsd. with respect to IFN-α induction in human PBMCs on the one hand, and CD69 upregulation in lymphocytic subsets, on the other.
- 165Beesu, M.; Caruso, G.; Salyer, A. C. D.; Shukla, N. M.; Khetani, K. K.; Smith, L. J.; Fox, L. M.; Tanji, H.; Ohto, U.; Shimizu, T.; David, S. A. Identification of a Human Toll-Like Receptor (TLR) 8-Specific Agonist and a Functional Pan-TLR Inhibitor in 2-Aminoimidazoles. J. Med. Chem. 2016, 59 (7), 3311– 3330, DOI: 10.1021/acs.jmedchem.6b00023[ACS Full Text], [CAS], Google Scholar165https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XjvFyrtr4%253D&md5=27518d2e31e1758818b6fb44b046938bIdentification of a Human Toll-Like Receptor (TLR) 8-Specific Agonist and a Functional Pan-TLR Inhibitor in 2-AminoimidazolesBeesu, Mallesh; Caruso, Giuseppe; Salyer, Alex C. D.; Shukla, Nijunj M.; Khetani, Karishma K.; Smith, Luke J.; Fox, Lauren M.; Tanji, Hiromi; Ohto, Umeharu; Shimizu, Toshiyuki; David, Sunil A.Journal of Medicinal Chemistry (2016), 59 (7), 3311-3330CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)Activation of human toll-like receptor-8 (TLR8), expressed in myeloid dendritic cells, monocytes, and monocyte-derived dendritic cells, evokes a distinct cytokine profile which favors the development of Type 1 helper T cells. Part-structures of the 2-aminobenzimidazole scaffold were examd. with a view to identifying structural requisites corresponding to the smallest possible fragment of the benzimidazole core that would allow for retention of TLR8-agonistic activity. TLR8-specific agonistic activity was retained in 1-pentyl-4-phenyl-1H-imidazol-2-amine. The crystal structure of this compd. bound to the TLR8 ectodomain displayed binding interactions that are common to other TLR8 agonists. This compd. showed markedly attenuated proinflammatory properties in ex vivo human blood models. SAR studies revealed that 4-(2-(benzyloxy)phenyl)-1-pentyl-1H-imidazol-2-amine inhibited TLR signaling in a variety of TLR reporter cell lines, as well as in pharmacol. relevant human blood model systems. A kinase screen of this compd. showed relative specificity for calmodulin kinases.
- 166Beesu, M.; Salyer, A. C. D.; Trautman, K. L.; Hill, J. K.; David, S. A. Human Toll-like Receptor (TLR) 8-Specific Agonistic Activity in Substituted Pyrimidine-2,4-Diamines. J. Med. Chem. 2016, 59 (17), 8082– 8093, DOI: 10.1021/acs.jmedchem.6b00872[ACS Full Text], [CAS], Google Scholar166https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28Xhtlamt7vI&md5=3632c71b22857ff6f3561dc372b5e52fHuman Toll-like Receptor (TLR) 8-Specific Agonistic Activity in Substituted Pyrimidine-2,4-diaminesBeesu, Mallesh; Salyer, Alex C. D.; Trautman, Kathryn L.; Hill, Justin K.; David, Sunil A.Journal of Medicinal Chemistry (2016), 59 (17), 8082-8093CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)Activation of human toll-like receptor-8 (TLR8) evokes a distinct cytokine profile favoring the generation of Type 1 helper T cells. A multiplexed high-throughput screen had led to the identification of N4-butyl-5-iodo-6-methylpyrimidine-2,4-diamine as a pure TLR8 agonist, and a detailed SAR study of this chemotype was undertaken. A Bu substituent at N4 was optimal, and replacement of the 5-iodo group with chloro, bromo, or fluoro groups led to losses in potency, as did the introduction of arom. bulk. Drawing from the previous structure-based design, several 5-alkylamino derivs. were evaluated. Significant enhancement of potency was achieved in 5-(4-aminobutyl)-N4-butyl-6-methylpyrimidine-2,4-diamine. This compd. potently induced Th1-biasing IFN-γ and IL-12 in human blood, but lower levels of the proinflammatory cytokines IL-1β, IL-6 and IL-8. These results suggest that the inflammatory and reactogenic propensities of this compd. could be considerably more favorable than other TLR8 agonists under evaluation.
- 167Jiang, S.; Tanji, H.; Yin, K.; Zhang, S.; Sakaniwa, K.; Huang, J.; Yang, Y.; Li, J.; Ohto, U.; Shimizu, T.; Yin, H. Rationally Designed Small-Molecule Inhibitors Targeting an Unconventional Pocket on the TLR8 Protein–Protein Interface. J. Med. Chem. 2020, 63 (8), 4117– 4132, DOI: 10.1021/acs.jmedchem.9b02128[ACS Full Text], [CAS], Google Scholar167https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXmtFOisLc%253D&md5=7f5dbb4b3c72454c4b87ac188a98a531Rationally Designed Small-Molecule Inhibitors Targeting an Unconventional Pocket on the TLR8 Protein-Protein InterfaceJiang, Shuangshuang; Tanji, Hiromi; Yin, Kejun; Zhang, Shuting; Sakaniwa, Kentaro; Huang, Jian; Yang, Yi; Li, Jing; Ohto, Umeharu; Shimizu, Toshiyuki; Yin, HangJournal of Medicinal Chemistry (2020), 63 (8), 4117-4132CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)Rational designs of small-mol. inhibitors targeting protein-protein interfaces have met little success. Herein, we have designed a series of triazole derivs. with a novel scaffold to specifically intervene with the interaction of TLR8 homomerization. In multiple assays, TH1027 was identified as a highly potent and specific inhibitor of TLR8. A successful soln. of the X-ray crystal structure of TLR8 in complex with TH1027 provided an in-depth mechanistic insight into its binding mode, validating that TH1027 was located between two TLR8 monomers and recognized as an unconventional pocket, thereby preventing TLR8 from activation. Further biol. evaluations showed that TH1027 dose-dependently suppressed the TLR8-mediated inflammatory responses in both human monocyte cell lines, peripheral blood mononuclear cells, and rheumatoid arthritis patient specimens, suggesting a strong therapeutic potential against autoimmune diseases.
- 168Cheng, B.; Yuan, W. E.; Su, J.; Liu, Y.; Chen, J. Recent Advances in Small Molecule Based Cancer Immunotherapy. Eur. J. Med. Chem. 2018, 157, 582– 598, DOI: 10.1016/j.ejmech.2018.08.028[Crossref], [PubMed], [CAS], Google Scholar168https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhsFOqsb%252FP&md5=e15fa8048cf9b12ecd494d9ff8db8be5Recent advances in small molecule based cancer immunotherapyCheng, Binbin; Yuan, Wei-En; Su, Jing; Liu, Yao; Chen, JianjunEuropean Journal of Medicinal Chemistry (2018), 157 (), 582-598CODEN: EJMCA5; ISSN:0223-5234. (Elsevier Masson SAS)A review. Immunotherapy has been increasingly utilized for the treatment of cancer. Currently available cancer immunotherapies mainly involve the use of antibodies, which have advantages in terms of pharmacodynamics such as efficacy and specificity, however, they exhibit disadvantages in regard to the pharmacokinetics including but not limited to poor tissue and tumor penetration, very long half-life, and the lack of oral bioavailability. Also they are immunogenic and may cause undesired side effects. In addn., they are difficult and expensive to produce. In contrast to therapeutic antibodies, small mol. immuno-oncol. agents generally have favorable pharmacokinetics, for example, better oral bioavailability, higher tissue and tumor penetration, reasonable half-lives etc. Furthermore, some small mols. are highly selective and efficacious with benign toxicity profiles. Therefore, small mol. immuno-oncol. agents have the potential to overcome the drawbacks of therapeutic antibodies, and they can complement existing therapeutic antibodies and may also be used in combination with antibodies to achieve synergistic effects. In this article, we summarize the current advances in the field of small mol. approaches in tumor immunol. which include the small mols. in clin. trials and preclin. studies, and the reported crystal structures of small mols. and their target proteins as well as the binding interactions between small mols. and the targets. The tumorigenesis mechanism of different targets (the programmed cell death 1/programmed cell death ligand 1(PD1/PD-L1), retinoic acid-related orphan receptor-gamma t (RORγt), Chemokine receptor, Stimulator of Interferon Genes (Sting), Indoleamine 2,3-dioxygenase (IDO), toll-like receptors (TLR) etc.) are also elucidated.
- 169Basith, S.; Manavalan, B.; Yoo, T. H.; Kim, S. G.; Choi, S. Roles of Toll-like Receptors in Cancer: A Double-Edged Sword for Defense and Offense. Arch. Pharmacal Res. 2012, 35 (8), 1297– 1316, DOI: 10.1007/s12272-012-0802-7[Crossref], [PubMed], [CAS], Google Scholar169https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC38Xht1yntLrN&md5=23942ce19adebbedcae86c83890e5dfeRoles of toll-like receptors in Cancer: A double-edged sword for defense and offenseBasith, Shaherin; Manavalan, Balachandran; Yoo, Tae Hyeon; Kim, Sang Geon; Choi, SangdunArchives of Pharmacal Research (2012), 35 (8), 1297-1316CODEN: APHRDQ; ISSN:0253-6269. (Pharmaceutical Society of Korea)A review. Toll-like receptors (TLRs) belong to a class of pattern-recognition receptors that play an important role in host defense against pathogens by recognizing a wide variety of pathogen-assocd. mol. patterns (PAMPs). Besides driving inflammatory responses, TLRs also regulate cell proliferation and survival by expanding useful immune cells and integrating inflammatory responses and tissue repair processes. TLR signaling, which is centrally involved in the initiation of both innate and adaptive immune responses, has been thought to be restricted to immune cells. However, recent studies have shown that functional TLRs are expressed not only on immune cells, but also on cancer cells, thus implicating a role of TLRs in tumor biol. Increasing bodies of evidence have suggested that TLRs act as a double-edged sword in cancer cells because uncontrolled TLR signaling provides a microenvironment that is necessary for tumor cells to proliferate and evade the immune response. Alternatively, TLRs can induce an antitumor immune response in order to inhibit tumor progression. In this review, we summarize the dual roles of TLRs in tumor cells and, more importantly, delve into the therapeutic potential of TLRs in the context of tumorigenesis.
- 170Hennessy, E. J.; Parker, A. E.; O’Neill, L. A. J. Targeting Toll-like Receptors: Emerging Therapeutics?. Nat. Rev. Drug Discovery 2010, 9 (4), 293– 307, DOI: 10.1038/nrd3203[Crossref], [PubMed], [CAS], Google Scholar170https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3cXksF2itb4%253D&md5=ed2da43668217c9d470f5a53dd214708Targeting Toll-like receptors: emerging therapeutics?Hennessy, Elizabeth J.; Parker, Andrew E.; O'Neill, Luke A. J.Nature Reviews Drug Discovery (2010), 9 (4), 293-307CODEN: NRDDAG; ISSN:1474-1776. (Nature Publishing Group)A review. There is a growing interest in the targeting of Toll-like receptors (TLRs) for the prevention and treatment of cancer, rheumatoid arthritis, inflammatory bowel disease and systemic lupus erythematosus (SLE). Several new compds. are now undergoing preclin. and clin. evaluation, with a particular focus on TLR7 and TLR9 activators as adjuvants in infection and cancer, and inhibitors of TLR2, TLR4, TLR7 and TLR9 for the treatment of sepsis and inflammatory diseases. Here, we focus on TLRs that hold the most promise for drug discovery research, highlighting agents that are in the discovery phase and in clin. trials, and on the emerging new aspects of TLR-mediated signaling - such as control by ubiquitination and regulation by microRNAs - that might offer further possibilities of therapeutic manipulation.
- 171Pradere, J. P.; Dapito, D. H.; Schwabe, R. F. The Yin and Yang of Toll-like Receptors in Cancer. Oncogene 2014, 33 (27), 3485– 3495, DOI: 10.1038/onc.2013.302[Crossref], [PubMed], [CAS], Google Scholar171https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXht1CgsLnP&md5=c2321ec82e156ea1f78735eab8e72fa2The Yin and Yang of Toll-like receptors in cancerPradere, J.-P.; Dapito, D. H.; Schwabe, R. F.Oncogene (2014), 33 (27), 3485-3495CODEN: ONCNES; ISSN:0950-9232. (Nature Publishing Group)A review. Recognition of non-self mol. patterns by pattern recognition receptors is a cornerstone of innate immunity. Toll-like receptors (TLRs) exert a key role in recognizing pathogen-assocd. mol. patterns (PAMPs) but have also been implicated in the recognition of damage-assocd. mol. patterns (DAMPs). As such, TLRs regulate a wide range of biol. responses including inflammatory and immune responses during carcinogenesis. The high expression of TLRs by antigen-presenting cells, including dendritic cells, and their ability to induce antitumor mediators such as type I interferon has led to efforts to utilize TLR agonists in tumor therapy in order to convert the often tolerant immune response toward antitumor responses. However, TLRs are also increasingly recognized as regulators of tumor-promoting inflammation and promoters of tumor survival signals. Here, we will review in detail the dichotomous role of TLRs in tumor biol., focusing on relevant TLR-dependent pro- and antitumor pathways, and discuss clin. applications of TLR-targeted therapies for tumor prevention and treatment.
- 172Schmidt, J.; Welsch, T.; Jäger, D.; Mühlradt, P. F.; Büchler, M. W.; Märten, A. Intratumoural Injection of the Toll-like Receptor-2/6 Agonist ‘Macrophage-Activating Lipopeptide-2′ in Patients with Pancreatic Carcinoma: A Phase I/II Trial. Br. J. Cancer 2007, 97 (5), 598– 604, DOI: 10.1038/sj.bjc.6603903[Crossref], [PubMed], [CAS], Google Scholar172https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2sXpsF2ksL4%253D&md5=56326a3573fe871171db05f5ae6a662aIntratumoral injection of the toll-like receptor-2/6 agonist 'macrophage-activating lipopeptide-2' in patients with pancreatic carcinoma: a phase I/II trialSchmidt, J.; Welsch, T.; Jaeger, D.; Muehlradt, P. F.; Buechler, M. W.; Maerten, A.British Journal of Cancer (2007), 97 (5), 598-604CODEN: BJCAAI; ISSN:0007-0920. (Nature Publishing Group)This phase I/II trial examd. safety and efficacy of the toll-like receptor 2/6 agonist MALP-2 in combination with gemcitabine in patients with incompletely resectable pancreas carcinomas. MALP-2 is a toll-like receptor 2/6 agonist, acts as an immunol. adjuvant, and has been described recently to prolong survival in a mouse model of an orthotopic, syngeneic pancreas tumor. Male and female patients with incompletely resectable pancreas carcinomas were eligible while those with R0 or R1 resections or with peritoneal carcinosis were excluded. Ten patients were injected intratumorally during surgery with 20-30 μg MALP-2 followed by postoperative chemotherapy. Samples were taken from peripheral blood and wound secretion, and assayed for cell content, cytokine and CRP levels, and NK activity. An MALP-2 dose of 20 μg was well tolerated. Clear signs of local MALP-2 effects were presented by the influx of lymphocytes and monocytes in wound secretions, and abolishment of inhibition of NK activity. The actual mean survival is 17.1 ± 4.2 mo; the median survival being 9.3 mo. Two patients are still alive after 31 mo. Up to 20 μg MALP-2 was well tolerated, and no systemic side effects were noted. The mean survival of 17.1 mo is remarkably high.
- 173Ingale, S.; Wolfert, M. A.; Buskas, T.; Boons, G. J. Increasing the Antigenicity of Synthetic Tumor-Associated Carbohydrate Antigens by Targeting Toll-like Receptors. ChemBioChem 2009, 10 (3), 455– 463, DOI: 10.1002/cbic.200800596[Crossref], [PubMed], [CAS], Google Scholar173https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1MXis1amsL4%253D&md5=d5fc76855b718ae347d13f2dbd484d52Increasing the antigenicity of synthetic tumor-associated carbohydrate antigens by targeting Toll-like receptorsIngale, Sampat; Wolfert, Margreet A.; Buskas, Therese; Boons, Geert-JanChemBioChem (2009), 10 (3), 455-463CODEN: CBCHFX; ISSN:1439-4227. (Wiley-VCH Verlag GmbH & Co. KGaA)Epithelial cancer cells often overexpress mucins that are aberrantly glycosylated. Although it has been realized that these compds. offer exciting opportunities for the development of immunotherapy for cancer, their use is hampered by the low antigenicity of classical immunogens composed of a glycopeptide derived from a mucin conjugated to a foreign carrier protein. We have designed, chem. synthesized, and immunol. evaluated a no. of fully synthetic vaccine candidates to establish a strategy to overcome the poor immunogenicity of tumor-assocd. carbohydrates and glycopeptides. The compds. were also designed to allow study of the importance of Toll-like receptor (TLR) engagement for these antigenic responses in detail. We have found that covalent attachment of a TLR2 agonist, a promiscuous peptide T-helper epitope, and a tumor-assocd. glycopeptide gives a compd. (1) that elicits in mice exceptionally high titers of IgG antibodies that recognize MCF7 cancer cells expressing the tumor-assocd. carbohydrate. Immunizations with glycolipopeptide 2, which contains lipidated amino acids instead of a TLR2 ligand, gave significantly lower titers of IgG antibodies; this demonstrates that TLR engagement is crit. for optimum antigenic responses. Although mixts. of compd. 2 with Pam3CysSK4 (3) or monophosphoryl lipid A (4) elicited titers of IgG antibodies similar to those seen with 1, the resulting antisera had impaired ability to recognize cancer cells. It was also found that covalent linkage of the helper T-epitope to the B-epitope is essential, probably because internalization of the helper T-epitope by B-cells requires assistance of the B-epitope. The results presented here show that synthetic vaccine development is amenable to structure-activity relationship studies for successful optimization of carbohydrate-based cancer vaccines.
- 174Abdel-Aal, A. B. M.; Lakshminarayanan, V.; Thompson, P.; Supekar, N.; Bradley, J. M.; Wolfert, M. A.; Cohen, P. A.; Gendler, S. J.; Boons, G. J. Immune and Anticancer Responses Elicited by Fully Synthetic Aberrantly Glycosylated MUC1 Tripartite Vaccines Modified by a TLR2 or TLR9 Agonist. ChemBioChem 2014, 15 (10), 1508– 1513, DOI: 10.1002/cbic.201402077[Crossref], [PubMed], [CAS], Google Scholar174https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXovVegs70%253D&md5=f1a1a19319a0e4f48557e73ef2e83624Immune and Anticancer Responses Elicited by Fully Synthetic Aberrantly Glycosylated MUC1 Tripartite Vaccines Modified by a TLR2 or TLR9 AgonistAbdel-Aal, Abu-Baker M.; Lakshminarayanan, Vani; Thompson, Pamela; Supekar, Nitin; Bradley, Judy M.; Wolfert, Margreet A.; Cohen, Peter A.; Gendler, Sandra J.; Boons, Geert-JanChemBioChem (2014), 15 (10), 1508-1513CODEN: CBCHFX; ISSN:1439-4227. (Wiley-VCH Verlag GmbH & Co. KGaA)The mucin MUC1 is overexpressed and aberrantly glycosylated by many epithelial cancer cells manifested by truncated O-linked saccharides. Although tumor-assocd. MUC1 has generated considerable attention because of its potential for the development of a therapeutic cancer vaccine, it has been difficult to design constructs that consistently induce cytotoxic T-lymphocytes (CTLs) and ADCC-mediating antibodies specific for the tumor form of MUC1. The authors have designed, chem. synthesized, and immunol. examd. vaccine candidates each composed of a glycopeptide derived from MUC1, a promiscuous Thelper peptide, and a TLR2 (Pam3CysSK4) or TLR9 (CpG-ODN 1826) agonist. It was found that the Pam3CysSK4-contg. compd. elicits more potent antigenic and cellular immune responses, resulting in a therapeutic effect in a mouse model of mammary cancer. It is thus shown, for the first time, that the nature of an inbuilt adjuvant of a tripartite vaccine can significantly impact the quality of immune responses elicited against a tumor-assocd. glycopeptide. The unique adjuvant properties of Pam3CysSK4, which can reduce the suppressive function of regulatory T cells and enhance the cytotoxicity of tumor-specific CTLs, are likely responsible for the superior properties of the vaccine candidate 1.
- 175Shi, L.; Cai, H.; Huang, Z. H.; Sun, Z. Y.; Chen, Y. X.; Zhao, Y. F.; Kunz, H.; Li, Y. M. Synthetic MUC1 Antitumor Vaccine Candidates with Varied Glycosylation Pattern Bearing R/S-Configured Pam3CysSerLys4. ChemBioChem 2016, 17, 1412– 1415, DOI: 10.1002/cbic.201600206[Crossref], [PubMed], [CAS], Google Scholar175https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XpvFeqtrk%253D&md5=05b43ca881281de75651738cf0b1ba79Synthetic MUC1 Antitumor Vaccine Candidates with Varied Glycosylation Pattern Bearing R/S-configured Pam3CysSerLys4Shi, Lei; Cai, Hui; Huang, Zhi-Hua; Sun, Zhan-Yi; Chen, Yong-Xiang; Zhao, Yu-Fen; Kunz, Horst; Li, Yan-MeiChemBioChem (2016), 17 (15), 1412-1415CODEN: CBCHFX; ISSN:1439-4227. (Wiley-VCH Verlag GmbH & Co. KGaA)The Toll-like receptor 2 ligand Pam3CysSer is of particular interest for the construction synthetic vaccines because of its ability to stimulate of the innate immune system. Such vaccines usually comprise Pam3CysSer with the natural R-configuration at the glycerol 2-position. Pam3CysSer peptide vaccines with natural configuration have been shown to be more efficient than the corresponding R/S diastereomers. In order to clarify whether the effect of the configuration of Pam3Cys on the immune response also applies to glycopeptide vaccines, MUC1 glycopeptide-lipopeptide vaccines bearing either R- or R/S-configured Pam3CysSerLys4 were compared for their immunol. effects. In order to find out whether glycosylated MUC1 tandem repeat domains comprise not only B-cell epitopes but also T-cell epitopes, two-component vaccines contg. the Pam3CysSerLys4 lipopeptide and MUC1 glycopeptides with various glycosylation patterns were synthesized, and their immune reactions in mice were studied.
- 176Willems, M. M. J. H. P.; Zom, G. G.; Khan, S.; Meeuwenoord, N.; Melief, C. J. M.; Van Der Stelt, M.; Overkleeft, H. S.; Codée, J. D. C.; Van Der Marel, G. A.; Ossendorp, F.; Filippov, D. V. N-Tetradecylcarbamyl Lipopeptides as Novel Agonists for Toll-like Receptor 2. J. Med. Chem. 2014, 57 (15), 6873– 6878, DOI: 10.1021/jm500722p[ACS Full Text], [CAS], Google Scholar176https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXhtFCrt7bI&md5=39c3431ac3e0a49da9cba3561c8c4606N-Tetradecylcarbamyl Lipopeptides as Novel Agonists for Toll-like Receptor 2Willems, Marian M. J. H. P.; Zom, Gijs G.; Khan, Selina; Meeuwenoord, Nico; Melief, Cornelis J. M.; van der Stelt, Mario; Overkleeft, Herman S.; Codee, Jeroen D. C.; van der Marel, Gijsbert A.; Ossendorp, Ferry; Filippov, Dmitri V.Journal of Medicinal Chemistry (2014), 57 (15), 6873-6878CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)New analogs (UPam) of triacylated lipopeptide Pam3CysSK4, a popular agonist of Toll-like receptor 2 (TLR2), were designed making use of the cocrystal structure of a TLR2 heterodimer (with TLR1) with Pam3CysSK4. Twenty-two UPam derivs. that feature an N-tetradecylcarbamyl chain to mimic the native N-palmitoyl moiety and various small amino acids residues at the penultimate N-terminal position were prepd. via solid-phase synthesis. In vitro evaluation of immunostimulatory properties revealed new potent TLR2 ligands.
- 177Zom, G. G.; Willems, M. M. J. H. P.; Khan, S.; Van Der Sluis, T. C.; Kleinovink, J. W.; Camps, M. G. M.; Van Der Marel, G. A.; Filippov, D. V.; Melief, C. J. M.; Ossendorp, F. Novel TLR2-Binding Adjuvant Induces Enhanced T Cell Responses and Tumor Eradication. J. Immunother. Cancer 2018, 6, 146, DOI: 10.1186/s40425-018-0455-2[Crossref], [PubMed], [CAS], Google Scholar177https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB3cnht1WitA%253D%253D&md5=17a28bf91b230c2e8524b79acb03e8b0Novel TLR2-binding adjuvant induces enhanced T cell responses and tumor eradicationZom Gijs G; Khan Selina; van der Sluis Tetje C; Kleinovink Jan Willem; Camps Marcel G M; Melief Cornelis J M; Ossendorp Ferry; Willems Marian M J H P; van der Marel Gijsbert A; Filippov Dmitri V; Melief Cornelis J MJournal for immunotherapy of cancer (2018), 6 (1), 146 ISSN:.BACKGROUND: Ligands for the Toll-like receptor (TLR) family can induce activation of cells of the innate immune system and are widely studied for their potential to enhance adaptive immunity. Conjugation of TLR2-ligand Pam3CSK4 to synthetic long peptides (SLPs) was shown to strongly enhance the induction of antitumor immunity. To further improve cancer vaccination, we have previously shown that the novel TLR2-L Amplivant (AV), a modified Pam3CSK4, potentiates the maturation effects on murine DCs. In the current study, we further assessed the immunological properties of AV. METHODS: Naive mice were vaccinated with a conjugate of either Pam3CSK4 or AV and an SLP to assess specific T cell priming efficiency in vivo. The potency of AV and Pam3CSK4, either as free compounds or conjugated to different SLPs, to mature murine DCs was compared by stimulating murine dendritic cells overnight followed by ELISA and flow cytometry analysis. Murine tumor experiments were carried out by vaccinating mice carrying established HPV16 E6 and E7-expressing tumors and subsequently analyzing myeloid and lymphoid cells infiltrating the tumor microenvironment. Furthermore, tumor outgrowth after vaccination was monitored to enable comparison of the efficiency to induce antitumor immunity by Pam3CSK-SLP and AV-SLP conjugates. To enhance therapeutic efficacy, AV-SLP conjugate vaccination was combined with ablative therapies to assess whether synergism between such therapies would occur. RESULTS: SLPs conjugated to AV induce stronger DC maturation, in vivo T cell priming and antitumor immunity compared to conjugates with Pam3CSK4. Interestingly, AV-SLP conjugates modulate the macrophage populations in the tumor microenvironment, correlating with a therapeutic effect in an aggressive murine tumor model. The potency of AV-SLP conjugates in cancer vaccination operates optimally in combination with chemotherapy or photodynamic therapy. CONCLUSION: These data allow further optimization of vaccination-based immunotherapy of cancer by use of the improved TLR2-ligand Amplivant.
- 178Huynh, A. S.; Chung, W. J.; Cho, H. Il; Moberg, V. E.; Celis, E.; Morse, D. L.; Vagner, J. Novel Toll-like Receptor 2 Ligands for Targeted Pancreatic Cancer Imaging and Immunotherapy. J. Med. Chem. 2012, 55 (22), 9751– 9762, DOI: 10.1021/jm301002f[ACS Full Text], [CAS], Google Scholar178https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC38XhsFOlsbrF&md5=7a2659deb3a203a9a836c040b7df0ce3Novel Toll-like Receptor 2 Ligands for Targeted Pancreatic Cancer Imaging and ImmunotherapyHuynh, Amanda Shanks; Chung, Woo Jin; Cho, Hyun-Il; Moberg, Valerie E.; Celis, Esteban; Morse, David L.; Vagner, JosefJournal of Medicinal Chemistry (2012), 55 (22), 9751-9762CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)Toll-like receptor 2 (TLR2) is a target for immune system stimulation during cancer immunotherapy and a cell-surface marker for pancreatic cancer. To develop targeted agents for cancer imaging and therapy, we designed, synthesized, and characterized 13 novel, fully synthetic high affinity TLR2 agonists. Analog 10 had the highest agonist activity (NF-κB functional assay, EC50 = 20 nM) and binding affinity (competitive binding assay, Ki = 25 nM). As an immune adjuvant, compd. 10 stimulated the immune system in vivo by generation and persistence of antigen-specific CD8+ T cells indicating its potential use in cancer immunotherapy. After conjugation of near-IR dye to 10, agonist activity (EC50 = 34 nM) and binding affinity (Ki = 11 nM) were retained in 13. Fluorescence signal was present in TLR2 expressing pancreatic tumor xenografts 24 h after injection of 13, while an excess of unlabeled ligand blocked 13 from binding to the tumor, resulting in significantly decreased signal (p < 0.001) demonstrating in vivo selectivity.
- 179Bowdish, D. M. E.; Sakamoto, K.; Kim, M.-J.; Kroos, M.; Mukhopadhyay, S.; Leifer, C. A.; Tryggvason, K.; Gordon, S.; Russell, D. G. MARCO, TLR2, and CD14 Are Required for Macrophage Cytokine Responses to Mycobacterial Trehalose Dimycolate and Mycobacterium Tuberculosis. PLoS Pathog. 2009, 5 (6), e1000474, DOI: 10.1371/journal.ppat.1000474
- 180Yamamoto, H.; Oda, M.; Nakano, M.; Watanabe, N.; Yabiku, K.; Shibutani, M.; Inoue, M.; Imagawa, H.; Nagahama, M.; Himeno, S.; Setsu, K.; Sakurai, J.; Nishizawa, M. Development of Vizantin, a Safe Immunostimulant, Based on the Structure-Activity Relationship of Trehalose-6,6′-Dicorynomycolate. J. Med. Chem. 2013, 56 (1), 381– 385, DOI: 10.1021/jm3016443[ACS Full Text], [CAS], Google Scholar180https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC38XhslOls7rN&md5=6b9a2a5fa533d54e1d054f44b428e431Development of Vizantin, a Safe Immunostimulant, Based on the Structure-Activity Relationship of Trehalose-6,6'-dicorynomycolateYamamoto, Hirofumi; Oda, Masataka; Nakano, Mayo; Watanabe, Naoyuki; Yabiku, Kenta; Shibutani, Masahiro; Inoue, Masahisa; Imagawa, Hiroshi; Nagahama, Masahiro; Himeno, Seiichiro; Setsu, Kojun; Sakurai, Jun; Nishizawa, MugioJournal of Medicinal Chemistry (2013), 56 (1), 381-385CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)Vizantin, 6,6'-bis-O-(3-nonyldodecanoyl)-α,α'-trehalose, was developed as a safe immunostimulator on the basis of a structure-activity relation (SAR) study with trehalose 6,6'-dicorynomycolate (TDCM). It was possible to synthesize vizantin on a large scale more easily than in the case of TDCM, and the compd. exhibited more potent prophylactic effect on exptl. lung metastasis of B16-F0 melanoma cells. Because vizantin stimulated human macrophages, it is a promising candidate for clin. application.
- 181Morin, M. D.; Wang, Y.; Jones, B. T.; Mifune, Y.; Su, L.; Shi, H.; Moresco, E. M. Y.; Zhang, H.; Beutler, B.; Boger, D. L. Diprovocims: A New and Exceptionally Potent Class of Toll-like Receptor Agonists. J. Am. Chem. Soc. 2018, 140 (43), 14440– 14454, DOI: 10.1021/jacs.8b09223[ACS Full Text], [CAS], Google Scholar181https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhvVaqt7jE&md5=fb281c2f27781a593bab1ba13e7950beDiprovocims: A New and Exceptionally Potent Class of Toll-like Receptor AgonistsMorin, Matthew D.; Wang, Ying; Jones, Brian T.; Mifune, Yuto; Su, Lijing; Shi, Hexin; Moresco, Eva Marie Y.; Zhang, Hong; Beutler, Bruce; Boger, Dale L.Journal of the American Chemical Society (2018), 140 (43), 14440-14454CODEN: JACSAT; ISSN:0002-7863. (American Chemical Society)A screen conducted with nearly 100000 compds. and a surrogate functional assay for stimulation of an immune response that measured the release of TNF-α from treated human THP-1 myeloid cells differentiated along the macrophage line led to the discovery of the diprovocims. Unique to these efforts and of special interest, the screening leads for this new class of activators of an immune response came from a compd. library designed to promote cell-surface receptor dimerization. Subsequent comprehensive structure-activity relationship studies improved the potency 800-fold over that of the screening leads, providing diprovocim-1 and diprovocim-2. The diprovocims act by inducing cell-surface toll-like receptor (TLR)-2 dimerization and activation with TLR1 (TLR1/TLR2 agonist), bear no structural similarity to any known natural or synthetic TLR agonist, and are easy to prep. and synthetically modify, and selected members are active in both human and murine systems. The most potent diprovocim (3, diprovocim-1) elicits full agonist activity at extraordinarily low concns. (EC50 = 110 pM) in human THP-1 cells, being more potent than the naturally derived TLR1/TLR2 agonist Pam3CSK4 or any other known small mol. TLR agonist.
- 182Wang, Y.; Su, L.; Morin, M. D.; Jones, B. T.; Mifune, Y.; Shi, H.; Wang, K.-w.; Zhan, X.; Liu, A.; Wang, J.; Li, X.; Tang, M.; Ludwig, S.; Hildebrand, S.; Zhou, K.; Siegwart, D. J.; Moresco, E. M. Y.; Zhang, H.; Boger, D. L.; Beutler, B. Adjuvant Effect of the Novel TLR1/TLR2 Agonist Diprovocim Synergizes with Anti–PD-L1 to Eliminate Melanoma in Mice. Proc. Natl. Acad. Sci. U. S. A. 2018, 115 (37), E8698– E8706, DOI: 10.1073/pnas.1809232115[Crossref], [PubMed], [CAS], Google Scholar182https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXitVKhurrE&md5=bcb753f35bc5fb5bd54c4a7570cd5771Adjuvant effect of the novel TLR1/TLR2 agonist Diprovocim synergizes with anti-PD-L1 to eliminate melanoma in miceWang, Ying; Su, Lijing; Morin, Matthew D.; Jones, Brian T.; Mifune, Yuto; Shi, Hexin; Wang, Kuan-wen; Zhan, Xiaoming; Liu, Aijie; Wang, Jianhui; Li, Xiaohong; Tang, Miao; Ludwig, Sara; Hildebrand, Sara; Zhou, Kejin; Siegwart, Daniel J.; Y. Moresco, Eva Marie; Zhang, Hong; Boger, Dale L.; Beutler, BruceProceedings of the National Academy of Sciences of the United States of America (2018), 115 (37), E8698-E8706CODEN: PNASA6; ISSN:0027-8424. (National Academy of Sciences)Successful cancer immunotherapy entails activation of innate immune receptors to promote dendritic cell (DC) maturation, antigen presentation, up-regulation of costimulatory mols., and cytokine secretion, leading to activation of tumor antigen-specific cytotoxic T lymphocytes (CTLs). Here we screened a synthetic library of 100,000 compds. for innate immune activators using TNF prodn. by THP-1 cells as a readout. We identified and optimized a potent human and mouse Toll-like receptor (TLR)1/TLR2 agonist, Diprovocim, which exhibited an EC50 of 110 pM in human THP-1 cells and 1.3 nM in primary mouse peritoneal macrophages. In mice, Diprovocim-adjuvanted ovalbumin immunization promoted antigen-specific humoral and CTL responses and synergized with anti-PD-L1 treatment to inhibit tumor growth, generating long-term antitumor memory, curing or prolonging survival of mice engrafted with the murine melanoma B16-OVA. Diprovocim induced greater frequencies of tumor-infiltrating leukocytes than alum, of which CD8 T cells were necessary for the antitumor effect of immunization plus anti-PD-L1 treatment.
- 183Su, L.; Wang, Y.; Wang, J.; Mifune, Y.; Morin, M. D.; Jones, B. T.; Moresco, E. M. Y.; Boger, D. L.; Beutler, B.; Zhang, H. Structural Basis of TLR2/TLR1 Activation by the Synthetic Agonist Diprovocim. J. Med. Chem. 2019, 62 (6), 2938– 2949, DOI: 10.1021/acs.jmedchem.8b01583[ACS Full Text], [CAS], Google Scholar183https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXktV2mt70%253D&md5=4477d4c8261961e4cc5b68849946094dStructural Basis of TLR2/TLR1 Activation by the Synthetic Agonist DiprovocimSu, Lijing; Wang, Ying; Wang, Junmei; Mifune, Yuto; Morin, Matthew D.; Jones, Brian T.; Moresco, Eva Marie Y.; Boger, Dale L.; Beutler, Bruce; Zhang, HongJournal of Medicinal Chemistry (2019), 62 (6), 2938-2949CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)Diprovocim is a recently discovered exceptionally potent, synthetic small mol. agonist of TLR2/TLR1 and has shown significant adjuvant activity in anticancer vaccination against murine melanoma. Since Diprovocim bears no structural similarity to the canonical lipopeptide ligands of TLR2/TLR1, we investigated how Diprovocim interacts with TLR2/TLR1 through in vitro biophys., structural, and computational approaches. We found that Diprovocim induced the formation of TLR2/TLR1 heterodimers as well as TLR2 homodimers in vitro. We detd. the crystal structure of Diprovocim in a complex with a TLR2 ectodomain, which revealed, unexpectedly, two Diprovocim mols. bound to the ligand binding pocket formed between two TLR2 ectodomains. Extensive hydrophobic interactions and a hydrogen-bonding network between the protein and Diprovocim mols. are obsd. within the defined ligand binding pocket and likely underlie the high potency of Diprovocim. Our work shed first light into the activation mechanism of TLR2/TLR1 by a noncanonical agonist. The structural information obtained here may be exploited to manipulate TLR2/TLR1-dependent signaling.
- 184Cen, X.; Zhu, G.; Yang, J.; Yang, J.; Guo, J.; Jin, J.; Nandakumar, K. S.; Yang, W.; Yin, H.; Liu, S.; Cheng, K. TLR1/2 Specific Small-Molecule Agonist Suppresses Leukemia Cancer Cell Growth by Stimulating Cytotoxic T Lymphocytes. Adv. Sci. 2019, 6 (10), 1802042, DOI: 10.1002/advs.201802042[Crossref], [CAS], Google Scholar184https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB3M7pvF2nsQ%253D%253D&md5=47a770cd9148218f0a5ab7ff95dceb25TLR1/2 Specific Small-Molecule Agonist Suppresses Leukemia Cancer Cell Growth by Stimulating Cytotoxic T LymphocytesCen Xiaohong; Zhu Gengzhen; Yang Junjie; Guo Jiayin; Jin Jiabing; Nandakumar Kutty Selva; Liu Shuwen; Cheng Kui; Yang Jianjun; Yang Wei; Yin HangAdvanced science (Weinheim, Baden-Wurttemberg, Germany) (2019), 6 (10), 1802042 ISSN:2198-3844.Toll-like receptor 2 (TLR2) expressed on antigen presenting cells evokes a series of critical cytokines, which favor the development of tumor-specific cytotoxic T lymphocytes (CTLs). Therefore, TLR2 represents an attractive cancer immunotherapeutic target. Here, a synthetic library of 14 000 compounds together with a series of newly developed compounds for NF-κB activation using HEK-Blue hTLR2 cells is initially screened. Following further screening in a variety of cells including HEK-Blue hTLRs reporter cells, murine, and human macrophage cell lines, a potent small molecule agonist 23 (SMU-Z1) is identified, which specifically activates TLR2 through its association with TLR1, with a EC50 of 4.88 ± 0.79 × 10(-9) m. Toxicology studies, proinflammatory cytokines (e.g., TNF-α, IL-1β, IL-6, and nitric oxide) and target-protein based biophysical assays demonstrate the pharmacologically relevant characteristics of SMU-Z1. In addition, SMU-Z1 promotes murine splenocyte proliferation and upregulates the expression of CD8(+) T cells, NK cells and DCs, which results in a significant antitumor effect in a murine leukemia model. Finally, the induced tumors in three out of seven mice disappear after administration of SMU-Z1. Our studies thus identify a novel and potent TLR1/2 small molecule agonist, which displays promising immune adjuvant properties and antitumor immunity.
- 185Chen, Z.; Cen, X.; Yang, J.; Tang, X.; Cui, K.; Cheng, K. Structure-Based Discovery of a Specific TLR1-TLR2 Small Molecule Agonist from the ZINC Drug Library Database. Chem. Commun. 2018, 54 (81), 11411– 11414, DOI: 10.1039/C8CC06618C[Crossref], [PubMed], [CAS], Google Scholar185https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhslejtbnL&md5=75eccae65b738d00352291113f06a95fStructure-based discovery of a specific TLR1-TLR2 small molecule agonist from the ZINC drug library databaseChen, Zhipeng; Cen, Xiaohong; Yang, Junjie; Tang, Xiaoshan; Cui, Kai; Cheng, KuiChemical Communications (Cambridge, United Kingdom) (2018), 54 (81), 11411-11414CODEN: CHCOFS; ISSN:1359-7345. (Royal Society of Chemistry)We report herein the identification of urea structure-like small mols. by structure-based virtual screening of 10.5 million compds. Based on a variety of HEK-Blue hTLRs reporter cell assay results, we validated a TLR1/2-specific small mol. agonist, ZINC666243 (SMU127), with EC50 of 0.55±0.01 μM. SMU127 stimulates NF-κB activation and promotes TNFα secretion in human macrophages and mononuclear cells. Moreover, the in vivo assay indicated that SMU127 could inhibit the growth of breast cancer tumors in BABL/c mice. This work has shown for the first time that a small mol. TLR1/2 agonist can inhibit breast cancer in vivo.
- 186Kitada, S.; Leone, M.; Sareth, S.; Zhai, D.; Reed, J. C.; Pellecchia, M. Discovery, Characterization, and Structure - Activity Relationships Studies of Proapoptotic Polyphenols Targeting B-Cell Lymphocyte/Leukemia-2 Proteins. J. Med. Chem. 2003, 46 (20), 4259– 4264, DOI: 10.1021/jm030190z[ACS Full Text], [CAS], Google Scholar186https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD3sXmsFamsbo%253D&md5=6bd7d55afc614ba313ddec93fdd917c5Discovery, Characterization, and Structure-Activity Relationships Studies of Proapoptotic Polyphenols Targeting B-Cell Lymphocyte/Leukemia-2 ProteinsKitada, Shinichi; Leone, Marilisa; Sareth, Sina; Zhai, Dayong; Reed, John C.; Pellecchia, MaurizioJournal of Medicinal Chemistry (2003), 46 (20), 4259-4264CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)Among the most promising chemopreventive agents, certain natural polyphenols have recently received a great deal of attention because of their demonstrated inhibitory activity against tumorigenesis. In view of their anticancer properties, these compds. also hold great promise as potential chemotherapeutic agents. However, to translate these chemopreventive agents into chemotherapeutic compds., their exact mechanisms of action must be delineated. By using a multidisciplinary approach guided by modern NMR spectroscopy techniques, fluorescence polarization displacement assays, and cell-based assays, the authors have begun to unravel the mechanisms of actions of certain polyphenols such as Gossypol (a compd. from cotton seed exts.) and Purpurogallin (a natural compd. extd. from Quercus sp. nutgall) and their derivs. The authors findings suggest that these natural products bind and antagonize the antiapoptotic effects of B-cell lymphocyte/leukemia-2 (Bcl-2) family proteins such as Bcl-xL. The authors in vitro and in vivo data not only open a window of opportunities for the development of novel cancer treatments with these compds. but also provide structural information that can be used for the design and development of novel and more effective analogs.
- 187Cheng, K.; Wang, X.; Zhang, S.; Yin, H. Discovery of Small-Molecule Inhibitors of the TLR1/TLR2 Complex. Angew. Chem., Int. Ed. 2012, 51 (49), 12246– 12249, DOI: 10.1002/anie.201204910[Crossref], [CAS], Google Scholar187https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC38XhtlCqtbvP&md5=4feb4f19113c704e1a64c818a4bcf923Discovery of Small-Molecule Inhibitors of the TLR1/TLR2 ComplexCheng, Kui; Wang, Xiaohui; Zhang, Shuting; Yin, HangAngewandte Chemie, International Edition (2012), 51 (49), 12246-12249CODEN: ACIEF5; ISSN:1433-7851. (Wiley-VCH Verlag GmbH & Co. KGaA)A novel small mol., CU-CPT22 (I), that can compete with triacylated lipoprotein (Pam3CSK4) in binding to the TLR1/TLR2 complex with potency and specificity has been identified via structure-activity relationship studies. The down-stream signalling expts.further indicated that I suppresses the TLR1/TLR2-mediated inflammation response. This novel, small-mol. agent provides a much needed mol. probe for studying ligand interactions of the TLR1/TLR2 protein complex.
- 188Xu, Y. Y.; Chen, L.; Zhou, I. M.; Wu, Y. Y.; Zhu, Y. Y. Inhibitory Effect of DsRNA TLR3 Agonist in a Rat Hepatocellular Carcinoma Model. Mol. Med. Rep. 2013, 8 (4), 1037– 1042, DOI: 10.3892/mmr.2013.1646[Crossref], [PubMed], [CAS], Google Scholar188https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXhs1elsbzN&md5=61f84345c948e2e9ab3513bfdb5c65c2Inhibitory effect of dsRNA TLR3 agonist in a rat hepatocellular carcinoma modelXu, Yu-Yin; Chen, Li; Zhou, Jia-Ming; Wu, Yuan-Yuan; Zhu, Yuan-YuanMolecular Medicine Reports (2013), 8 (4), 1037-1042CODEN: MMROA5; ISSN:1791-2997. (Spandidos Publications Ltd.)Hepatocellular carcinoma (HCC) is one of the most common types of malignant tumor. Studies have demonstrated that the toll-like receptor 3 (TLR3)/interferon pathway is inhibitory in cancer cell proliferation, suggesting that the activation of this pathway may have therapeutic potential. In the present study, the inhibitory effects of BM-06, a double-stranded (ds)RNA TLR3 agonist, against HCC were studied in vivo. Using a 2-acetylaminofluorene-induced HCC rat model, histol. examn. and anal. of corresponding biomarkers following treatment with BM-06, showed a decrease in tumor growth and cell proliferation, and an increase in apoptosis compared with that in a phosphate-buffered saline control group. In addn., the obsd. antitumor effect of BM-06 in the HCC rat model was demonstrated to be superior to the known TLR3 agonist, polyinosinic-polycytidylic acid.
- 189Basith, S.; Manavalan, B.; Lee, G.; Kim, S. G.; Choi, S. Toll-like Receptor Modulators: A Patent Review (2006 - 2010). Expert Opin. Ther. Pat. 2011, 21 (6), 927– 944, DOI: 10.1517/13543776.2011.569494[Crossref], [PubMed], [CAS], Google Scholar189https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3MXmt1ymurs%253D&md5=21d288d66047cec245eb6a82a83c7baaToll-like receptor modulators: a patent review (2006 - 2010)Basith, Shaherin; Manavalan, Balachandran; Lee, Gwang; Kim, Sang Geon; Choi, SangdunExpert Opinion on Therapeutic Patents (2011), 21 (6), 927-944CODEN: EOTPEG; ISSN:1354-3776. (Informa Healthcare)A review. Introduction: The immune response is mediated via two parallel immune components, innate and adaptive, whose effector functions are highly integrated and coordinated for the protection of the human body against invading pathogens and transformed cells. The discovery of pathogen recognition receptors (PRRs), most notably toll-like receptors (TLRs), in innate immunity has evoked increased interest in the therapeutic handling of the innate immune system. TLRs are germ line-encoded receptors that play a potent role in the recognition of a diverse variety of ligands ranging from hydrophilic nucleic acids to lipopolysaccharide (LPS) or peptidoglycan (PGN) structures in pathogens. Areas covered: This review discusses recent updates (2006 - 2010) in completed, ongoing and planned clin. trials of TLR immunomodulator-based therapies for the treatment of infectious diseases, inflammatory disorders and cancer. Expert opinion: Since the discovery of human TLRs, modulating immune responses using TLR agonists or antagonists for therapeutic purposes has provoked intense activity in the pharmaceutical industry. The ability of TLRs to initiate and propagate inflammation makes them attractive therapeutic targets. We are now at the stage of evaluating such mols. in human diseases. Addnl., there is also extensive literature available on TLRs in diseased states. These data provide a basis for the identification of novel immunomodulators (agonists and antagonists) for the therapeutic targeting of TLRs.
- 190Matsumoto, M.; Takeda, Y.; Seya, T. Targeting Toll-like Receptor 3 in Dendritic Cells for Cancer Immunotherapy. Expert Opin. Biol. Ther. 2020, 20 (8), 937– 946, DOI: 10.1080/14712598.2020.1749260[Crossref], [PubMed], [CAS], Google Scholar190https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXnsVGjt7o%253D&md5=085157e98efdc7844a17d8acd288aae0Targeting Toll-like receptor 3 in dendritic cells for cancer immunotherapyMatsumoto, Misako; Takeda, Yohei; Seya, TsukasaExpert Opinion on Biological Therapy (2020), 20 (8), 937-946CODEN: EOBTA2; ISSN:1471-2598. (Taylor & Francis Ltd.)A review. : Activation of innate immune system is a key step to develop anti-tumor immunity. Antigen-presenting dendritic cells (DCs) cross-present tumor-assocd. antigens to cytotoxic CD8+ T cells (CTLs). Signaling from pattern-recognition receptors (PRRs) in DCs is required to induce tumor-specific CTLs.: This review summarizes the properties of PRRs expressed by antigen-presenting DCs, esp. TLR3, and provides the recent knowledge of their function in anti-tumor immunity. We also summarize the characteristics of newly-developed TLR3-specific agonist, ARNAX, which efficiently primes DCs to induce anti-tumor immunity without systemic inflammation in mice.: In cancer immunotherapy, the induction of tumor-specific CTLs is significant for tumor regression and to augment the efficacy of PD-1/PD-L1 blockade. Non-inflammatory TLR3 adjuvant ARNAX that can induce tumor-specific CTLs without inducing inflammation benefits cancer immunotherapy. Development of appropriate protocols for ARNAX vaccine therapy would be useful to overcome the PD-1/PD-L1 blockade resistance.
- 191Seya, T.; Takeda, Y.; Matsumoto, M. A Toll-like Receptor 3 (TLR3) Agonist ARNAX for Therapeutic Immunotherapy. Adv. Drug Delivery Rev. 2019, 147, 37– 43, DOI: 10.1016/j.addr.2019.07.008[Crossref], [PubMed], [CAS], Google Scholar191https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhsVOgtbjJ&md5=545569161cb2ef288443ca9cd67b4824A Toll-like receptor 3 (TLR3) agonist ARNAX for therapeutic immunotherapySeya, Tsukasa; Takeda, Yohei; Matsumoto, MisakoAdvanced Drug Delivery Reviews (2019), 147 (), 37-43CODEN: ADDREP; ISSN:0169-409X. (Elsevier B.V.)A review. Vaccine immunotherapy consisting of tumor antigens combined with an immune-enhancing adjuvant fosters cytotoxic T cell (CTL) proliferation. Clin., polyI:C has been used as an adjuvant to enhance cancer vaccine protocols. However, according to its long history, polyI:C promotes inflammation that causes cytokine toxicity. Although checkpoint inhibitor immunotherapy has improved the prognoses of patients with progressive cancer, over 75% of patients continue to experience resistance to antibody (Ab) against anti-programmed cell death-protein 1 (PD-1) or its ligand, PD-L1 therapy. In most cases, patients suffer from adverse events resulting from inflammation during anti-PD-1/L1 Ab therapy, which is a serious obstacle to patients' quality of life. We have studied the functional properties of double-stranded (ds)RNA and polyI:C, and developed a nucleic acid adjuvant that barely induces a significant increase in the level of serum inflammatory cytokines in mouse models. This adjuvant, termed ARNAX, consists of DNA-capped dsRNA that specifies the endosomal target for Toll-like receptor 3 (TLR3) in dendritic cells (DCs). We expect that this adjuvant is safe for administration in elderly patients with cancer receiving immunotherapy. Here, we summarize the properties of ARNAX for immunotherapy in mice. We suggest that DC-priming is essential to induce anti-tumor immunity; neither exogenous inflammation nor the administration of tumor antigens is always a prerequisite for DC-mediated CTL proliferation. If our mouse data can be extrapolated to humans, ARNAX and the liberated endogenous tumor antigens may facilitate effect of current therapies on patients with therapy-resistant tumors.
- 192Wang, Y.; Tu, Q.; Yan, W.; Xiao, D.; Zeng, Z.; Ouyang, Y.; Huang, L.; Cai, J.; Zeng, X.; Chen, Y. J.; Liu, A. CXC195 Suppresses Proliferation and Inflammatory Response in LPS-Induced Human Hepatocellular Carcinoma Cells via Regulating TLR4-MyD88-TAK1-Mediated NF-KB and MAPK Pathway. Biochem. Biophys. Res. Commun. 2015, 456 (1), 373– 379, DOI: 10.1016/j.bbrc.2014.11.090[Crossref], [PubMed], [CAS], Google Scholar192https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXitVeisrjJ&md5=2806c5aeed4c1bb6608f43dbd6fb5a91CXC195 suppresses proliferation and inflammatory response in LPS-induced human hepatocellular carcinoma cells via regulating TLR4-MyD88-TAK1-mediated NF-κB and MAPK pathwayWang, Yiting; Tu, Qunfei; Yan, Wei; Xiao, Dan; Zeng, Zhimin; Ouyang, Yuming; Huang, Long; Cai, Jing; Zeng, Xiaoli; Chen, Ya-Jie; Liu, AnwenBiochemical and Biophysical Research Communications (2015), 456 (1), 373-379CODEN: BBRCA9; ISSN:0006-291X. (Elsevier B.V.)CXC195 showed strong protective effects in neuronal apoptosis by exerting its antioxidant activity. However, the anti-cancer effects of CXC195 is still with limited acquaintance. Here, we investigated the role of CXC195 in lipopolysaccharide (LPS)-induced human hepatocellular carcinoma (HCC) cells lines (HepG2) and the possible signaling pathways. CXC195 exhibited significant anti-proliferative effect and induced cell cycle arrest in LPS-induced HepG2 cells. In addn., CXC195 suppressed the release of pro-inflammatory mediators in LPS-induced HepG2 cells, including TNF-α, iNOS, IL-1β, IL-6, CC chemokine ligand (CCL)-2, CCL-22 and epidermal growth factor receptor (EGFR). Moreover, CXC195 inhibited the expressions and interactions of TLR4, MyD88 and TAK1, NF-κB translocation to nucleus and its DNA binding activity, phosphorylation of ERK1/2, p38 and JNK. Our results suggested that treatment with CXC195 could attenuate the TLR4-mediated proliferation and inflammatory response in LPS-induced HepG2 cells, thus might be beneficial for the treatment of HCC.
- 193Liu, H.; Zhang, G.; Huang, J.; Ma, S.; Mi, K.; Cheng, J.; Zhu, Y.; Zha, X.; Huang, W. Atractylenolide I Modulates Ovarian Cancer Cell-Mediated Immunosuppression by Blocking MD-2/TLR4 Complex-Mediated MyD88/NF-KB Signaling in Vitro. J. Transl. Med. 2016, 14 (1), 4– 15, DOI: 10.1186/s12967-016-0845-5
- 194Zandi, Z.; Kashani, B.; Poursani, E. M.; Bashash, D.; Kabuli, M.; Momeny, M.; Mousavi-pak, S. H.; Sheikhsaran, F.; Alimoghaddam, K.; Mousavi, S. A.; Ghaffari, S. H. TLR4 Blockade Using TAK-242 Suppresses Ovarian and Breast Cancer Cells Invasion through the Inhibition of Extracellular Matrix Degradation and Epithelial-Mesenchymal Transition. Eur. J. Pharmacol. 2019, 853, 256– 263, DOI: 10.1016/j.ejphar.2019.03.046[Crossref], [PubMed], [CAS], Google Scholar194https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXms1Onu7Y%253D&md5=0ffd4dafc61d3b3916f38f4f59281176TLR4 blockade using TAK-242 suppresses ovarian and breast cancer cells invasion through the inhibition of extracellular matrix degradation and epithelial-mesenchymal transitionZandi, Zahra; Kashani, Bahareh; Poursani, Ensieh M.; Bashash, Davood; Kabuli, Majid; Momeny, Majid; Mousavi-pak, Seyedeh H.; Sheikhsaran, Fatemeh; Alimoghaddam, Kamran; Mousavi, Seyed A.; Ghaffari, Seyed H.European Journal of Pharmacology (2019), 853 (), 256-263CODEN: EJPHAZ; ISSN:0014-2999. (Elsevier B.V.)Numerous links exist between inflammation and tumor development. Toll-like receptor 4 (TLR4) expression by tumor cells can be a contributing factor that promotes tumor cell proliferation, survival, migration, and metastasis. In this study, we explored the impact of TLR4 inhibition using TAK-242, a specific inhibitor of TLR4, on the invasion properties of ovarian (A2780CP, 2008C13, SKOV3, and A2780S) and breast (MCF7, SKBR3, MDA-MB-231, and BT-474) cancer cell lines. Six out of eight cell lines expressed TLR4 and its downstream mediators (MyD88, NF-kB1, and RELB), indicating that these cell lines could be proper candidates for the TLR4 inhibition. TAK-242 induced a cytotoxic effect on all tested cell lines; however, a different cell sensitivity pattern was noticeable. Interestingly, in the TLR4-expressing cell lines, there was a significant correlation between the TLR4/MyD88 expressions and the cancer cell response to TAK-242: the higher the expression, the higher the IC50. To the best of our knowledge, no study has addressed the effects of TAK-242 on invasive abilities of cancer cells and our study suggests for the first time that TAK-242 could considerably decrease invasion properties of ovarian and breast cancer cell lines. We found that not only did TAK-242 reduce the enzymic activity of MMP2 and MMP9, but also down-regulated gene expressions of epithelial-mesenchymal transition (EMT)-related genes. In sum, it seems that targeting TLR4 using TAK-242 possesses novel promising potential in cancer treatment strategies and may prevent invasion in patients suffering from ovarian and breast cancers, esp. in those with over-expression of TLR4.
- 195Kashani, B.; Zandi, Z.; Karimzadeh, M. R.; Bashash, D.; Nasrollahzadeh, A.; Ghaffari, S. H. Blockade of TLR4 Using TAK-242 (Resatorvid) Enhances Anti-Cancer Effects of Chemotherapeutic Agents: A Novel Synergistic Approach for Breast and Ovarian Cancers. Immunol. Res. 2019, 67 (6), 505– 516, DOI: 10.1007/s12026-019-09113-8[Crossref], [PubMed], [CAS], Google Scholar195https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXlt1CqtL0%253D&md5=d7e6c23f754d23b88d622c6cf6533cc8Blockade of TLR4 using TAK-242 (resatorvid) enhances anti-cancer effects of chemotherapeutic agents: a novel synergistic approach for breast and ovarian cancersKashani, Bahareh; Zandi, Zahra; Karimzadeh, Mohammad Reza; Bashash, Davood; Nasrollahzadeh, Ali; Ghaffari, Seyed H.Immunologic Research (2019), 67 (6), 505-516CODEN: IMRSEB; ISSN:0257-277X. (Springer)Abstr.: It is believed that pathways of the immune system are responsible for eradicating cancer cells; however, their over-activation and also their ectopic expression in tumor cells and microenvironment are major contributors to tumor growth and chemoresistance. Toll-like receptor 4 (TLR4) pathway is an innate immune-related pathway which is usually overexpressed in tumor cells that leads to excessive pro-inflammatory cytokines and eventually results in tumor survival, drug resistance, and metastasis. In this study, we investigated whether TLR4 expression is affected upon the treatment of breast and ovarian cancer cells with common chemotherapeutics (paclitaxel, cisplatin, doxorubicin, and arsenic trioxide) and if TLR4 inhibition using its specific inhibitor TAK-242 could enhance cancer cells' response to the drugs. Both breast (MCF7) and ovarian (2008C13) cancer cells experienced an elevated expression of TLR4 after treatment with the drugs. The expression of this receptor was also upregulated in cisplatin-resistant 2008C13 cells; however, it was significantly higher upon short-term treatment with cisplatin. More importantly, the combination treatment of the drugs with TAK-242 intensified the chemosensitivity of six different breast and ovarian cancer cells to chemotherapeutic drugs. It was also identified that co-treatment of paclitaxel and TAK-242 not only led to enhanced G2/M arrest and apoptosis but also satisfactorily decreased the expression of TLR4 and different interleukins in these cells. Taken together, the results of the present study emphasize that chemotherapy may lead to chemoresistance through inducing TLR4 expression, and therefore inhibiting this receptor using TAK-242 could be a promising approach to improve the outcome of chemotherapy in foreseeable future.
- 196Kashani, B.; Zandi, Z.; Bashash, D.; Zaghal, A.; Momeny, M.; Poursani, E. M.; Pourbagheri-Sigaroodi, A.; Mousavi, S. A.; Ghaffari, S. H. Small Molecule Inhibitor of TLR4 Inhibits Ovarian Cancer Cell Proliferation: New Insight into the Anticancer Effect of TAK-242 (Resatorvid). Cancer Chemother. Pharmacol. 2020, 85 (1), 47– 59, DOI: 10.1007/s00280-019-03988-y[Crossref], [PubMed], [CAS], Google Scholar196https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXisVGhurvN&md5=c2796c6b52840c3ae9e8e3ab9e59473dSmall molecule inhibitor of TLR4 inhibits ovarian cancer cell proliferation: new insight into the anticancer effect of TAK-242 (Resatorvid)Kashani, Bahareh; Zandi, Zahra; Bashash, Davood; Zaghal, Azam; Momeny, Majid; Poursani, Ensieh M.; Pourbagheri-Sigaroodi, Atieh; Mousavi, Seyed A.; Ghaffari, Seyed H.Cancer Chemotherapy and Pharmacology (2020), 85 (1), 47-59CODEN: CCPHDZ; ISSN:0344-5704. (Springer)Background: Despite all advances in the treatment of ovarian cancer (OC), it remains the most lethal gynecol. malignancy worldwide. Therefore, Toll-like receptor 4 (TLR4), a mediator of inflammation in cancer cells, may be a proper anticancer target. Methods: The effects of TLR4 activation by LPS was studied using MTT, colony formation, staining, scratch, and qRT-PCR assays as the first step. Then the same assays, in addn. to anoikis resistance, cell cycle and annexin V/PI apoptosis tests, were used to investigate whether the inhibition of TLR4 using a small mol. inhibitor, TAK-242, could suppress the proliferation of various OC cell lines: A2780CP, 2008C13, SKOV3, and A2780S. Results: The activation of TLR4 using LPS showed enhanced proliferation and invasion in the TLR4-expressing cell line (SKOV3). Next, treatment with the inhibitor revealed that TAK-242 suppressed the inflammatory condition of ovarian cancer cells, as evident by the down-regulation of IL-6 gene expression. We also found that TAK-242 halted cancer cell proliferation by inducing cell cycle arrest and apoptosis through the modulation of genes involved in these processes. Overexpression of TLR4 contributes to drug resistance, it was tempting to investigate the effect of TAK-242 in a combined-modality strategy. Conclusion: TAK-242 serves as an appealing therapeutic strategy in the TLR4-expressing OC cells, either in the context of monotherapy or in combination with a chemotherapeutic drug.
- 197Premkumar, V.; Dey, M.; Dorn, R.; Raskin, I. MyD88-Dependent and Independent Pathways of Toll-Like Receptors Are Engaged in Biological Activity of Triptolide in Ligand-Stimulated Macrophages. BMC Chem. Biol. 2010, 10, 3, DOI: 10.1186/1472-6769-10-3[Crossref], [PubMed], [CAS], Google Scholar197https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC3czksVymug%253D%253D&md5=4a21fa2416aedfab5b281af25b31d659MyD88-dependent and independent pathways of Toll-Like Receptors are engaged in biological activity of Triptolide in ligand-stimulated macrophagesPremkumar Vummidigiridhar; Dey Moul; Dorn Ruth; Raskin IlyaBMC chemical biology (2010), 10 (), 3 ISSN:.BACKGROUND: Triptolide is a diterpene triepoxide from the Chinese medicinal plant Tripterygium wilfordii Hook F., with known anti-inflammatory, immunosuppressive and anti-cancer properties. RESULTS: Here we report the expression profile of immune signaling genes modulated by triptolide in LPS induced mouse macrophages. In an array study triptolide treatment modulated expression of 22.5% of one hundred and ninety five immune signaling genes that included Toll-like receptors (TLRs). TLRs elicit immune responses through their coupling with intracellular adaptor molecules, MyD88 and TRIF. Although it is known that triptolide inhibits NFkappaB activation and other signaling pathways downstream of TLRs, involvement of TLR cascade in triptolide activity was not reported. In this study, we show that triptolide suppresses expression of proinflammatory downstream effectors induced specifically by different TLR agonists. Also, the suppressive effect of triptolide on TLR-induced NFkappaB activation was observed when either MyD88 or TRIF was knocked out, confirming that both MyD88 and TRIF mediated NFkappaB activation may be inhibited by triptolide. Within the TLR cascade triptolide downregulates TLR4 and TRIF proteins. CONCLUSIONS: This study reveals involvement of TLR signaling in triptolide activity and further increases understanding of how triptolide activity may downregulate NFkappaB activation during inflammatory conditions.
- 198Ma, J. X.; Sun, Y. L.; Yu, Y.; Zhang, J.; Wu, H. Y.; Yu, X. F. Triptolide Enhances the Sensitivity of Pancreatic Cancer PANC-1 Cells to Gemcitabine by Inhibiting TLR4/NF-KB Signaling. Am. J. Transl. Res. 2019, 11 (6), 3750– 3760[PubMed], [CAS], Google Scholar198https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXktF2mtL4%253D&md5=965b664622a41414f31735bca66d19ccTriptolide enhances the sensitivity of pancreatic cancer PANC-1 cells to gemcitabine by inhibiting TLR4/NF-κB signalingMa, Jian-Xia; Sun, Yun-Liang; Yu, Yang; Zhang, Jian; Wu, Hong-Yu; Yu, Xiao-FengAmerican Journal of Translational Research (2019), 11 (6), 3750-3760CODEN: AJTRA7; ISSN:1943-8141. (e-Century Publishing Corp.)Background: This study aimed to investigate roles of Toll-like receptor 4 (TLR4)/nuclear factor (NF)-κB signaling in triptolide (TPL)-induced sensitivity of pancreatic cancer cells to gemcitabine (GEM). Methods: In vitro, pancreatic cancer PANC-1 cells were treated with lipopolysaccharide (LPS) to activate TLR4, TLR4-siRNA, GEM alone, or GEM plus TPL. In vivo, nude mice bearing PANC-1 cell xenografts were treated with GEM, TPL, or both. Cell proliferation was detected by MTT assay and Ki-67 staining. Apoptosis was assessed by flow cytometry and TUNEL assay. A double luciferase reporter gene was used to detect NF-κB activity. Results: The sensitivity of PANC-1 cells to GEM was reduced by LPS but enhanced by TLR4-siRNA. TPL inhibited expression of TLR4/NF-κB signaling components, which was reversed by LPS. The TPL+GEM group showed more apoptosis than the LPS+TPL+GEM group. Moreover, the activity of NF-κB and the expression of TLR4, p-p65 Survivin, CyclinD1 and Bcl-2 in the TPL+GEM group were lower than in the LPS+TPL+GEM group, whereas Bax expression was higher. The vol. of transplanted tumors in the TPL+GEM group was lower than that in the TPL or GEM group. Phospho-p65, Survivin, CyclinD1 and Bcl-2 expression in transplanted tumors was lower in TPL+GEM group than in either single drug group. The Ki-67 staining score of the TPL+GEM group was lower and tumor cells apoptosis rate was increased when compared with TPL or GEM alone. Conclusions: TPL enhances the sensitivity of pancreatic cancer PANC-1 cells to GEM by inhibiting TLR4/NF-κB signaling.
- 199Zhou, J.; Liu, Q.; Qian, R.; Liu, S.; Hu, W.; Liu, Z. Paeonol Antagonizes Oncogenesis of Osteosarcoma by Inhibiting the Function of TLR4/MAPK/NF-KB Pathway. Acta Histochem. 2020, 122 (1), 151455, DOI: 10.1016/j.acthis.2019.151455[Crossref], [PubMed], [CAS], Google Scholar199https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhvFSntrbE&md5=4694eab7e9e4427bce6f14f571080fdcPaeonol antagonizes oncogenesis of osteosarcoma by inhibiting the function of TLR4/MAPK/NF-κB pathwayZhou, Jianguo; Liu, Qinglin; Qian, Rui; Liu, Shiwei; Hu, Weiquan; Liu, ZhenyuActa Histochemica (2020), 122 (1), 151455CODEN: AHISA9; ISSN:0065-1281. (Elsevier GmbH)As the the major functional component of Paeonia suffruticosa, paeonol (PAE) has shown its potential to inhibit the progression of multiple cancer types. In the current study, the mechanism driving the effect of PAE on osteosarcoma (OS) was investigated by focusing on its influence on TLR4-mediated MAPK/NF-κB pathway. Human OS cells were firstly administrated with PAE of different concns. to assess its effect on the proliferation, apoptosis, metastasis, and TLR4/MAPK/NF-κB pathway in OS cells. Thereafter, the level of TLR4 was induced in OS cells before PAE administration to explore the role of the mol. in the anti-OS function of PAE. The results of in vitro assays were further validated with xenograft mice models. The administration of PAE of two doses both suppressed the proliferation and induced apoptosis in OS cells in a dose-dependent manner. Regarding the effect on the metastasis potential of OS cells, PAE inhibited the migration and invasion potential of the cells, but the effect did not change with concns. The administration of PAE also inhibited the expression of TLR4 and deactivated MAPK/NF-κB pathway. Moreover, the induced expression of TLR4 counteracted the anti-OS function of PAE. Further validation with xenograft models also showed that PAE inhibited solid tumor growth and TLR4 expression in OS mice. In conclusion, it was inferred that the anti-OS function of PAE depended on the inhibition of TLR4 and its downstream MAPK/NF-κB pathway.
- 200Wu, H. C.; Ge, H. M.; Zang, L. Y.; Bei, Y. C.; Niu, Z. Y.; Wei, W.; Feng, X. J.; Ding, S.; Ng, S. W.; Shen, P. P.; Tan, R. X. Diaporine, a Novel Endophyte-Derived Regulator of Macrophage Differentiation. Org. Biomol. Chem. 2014, 12 (34), 6545– 6548, DOI: 10.1039/C4OB01123F[Crossref], [PubMed], [CAS], Google Scholar200https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXhtFOnsrvN&md5=dd6aa6dad6fbe332e6d380f3fa76281cDiaporine, a novel endophyte-derived regulator of macrophage differentiationWu, Hao Chen; Ge, Hui Ming; Zang, Le Yun; Bei, Yun Cheng; Niu, Zhi Yuan; Wei, Wei; Feng, Xiu Jing; Ding, Sen; Ng, Seik Weng; Shen, Ping Ping; Tan, Ren XiangOrganic & Biomolecular Chemistry (2014), 12 (34), 6545-6548CODEN: OBCRAK; ISSN:1477-0520. (Royal Society of Chemistry)Diaporine (I), an unprecedented sym. polyketide, was characterized from an endophytic fungus. The structure of I was detd. by extensive spectroscopic analyses. I can inhibit significantly the differentiation of macrophages and has potential to induce conversion from the M2 to the M1 phenotype, in addn. to regulation of the TLR4-MAPK signal pathway and PPARγ activity.
- 201Zhuang, H.; Dai, X.; Zhang, X.; Mao, Z.; Huang, H. Sophoridine Suppresses Macrophage-Mediated Immunosuppression through TLR4/IRF3 Pathway and Subsequently Upregulates CD8+ T Cytotoxic Function against Gastric Cancer. Biomed. Pharmacother. 2020, 121, 109636, DOI: 10.1016/j.biopha.2019.109636[Crossref], [PubMed], [CAS], Google Scholar201https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXitFKitrfP&md5=0e06331e567ac23700456fd1d17ac5c5Sophoridine suppresses macrophage-mediated immunosuppression through TLR4/IRF3 pathway and subsequently upregulates CD8+ T cytotoxic function against gastric cancerZhuang, Haiwen; Dai, Xudong; Zhang, Xiaoyu; Mao, Zhongqi; Huang, HaijinBiomedicine & Pharmacotherapy (2020), 121 (), 109636CODEN: BIPHEX; ISSN:0753-3322. (Elsevier Masson SAS)Gastric cancer is one of the most common and deadly neoplasms with limited effective treatments. The emergence of the immunotherapy has brought great expectations for cancer patients. Sophoridine is extd. from the seeds of sophora alopecuroides and has various pharmacol. actions including anti-tumor, anti-inflammatory, anti- arrhythmia and anti-virus. However, the effect of Sophoridine on gastric cancer microenvironment immunity and its underling mechanism remains poorly known. This study was aimed to investigate the effect of Sophoridine on the polarization status of gastric tumor-assocd. macrophages (TAMs) and its underlying mechanism. We isolated primary bone marrow-derived macrophages (BMDMs) and primary CD8+ T cells to perform coculture assay. Sophoridine educated TAMs polarize to M1-TAMs and suppressed M2-TAMs polarization through TLR4/IRF3 axis. Sophoridine-treated TAMs exhibited stronger pro-inflammatory function through upregulation the expression of INOS, IFN-β and IL-12α, and downregulation the expression of Arg-1, CD206 and IL-10. Sophoridine -primed TAMs increased the proliferation and cytotoxic function of CD8+ T by upregulating the expression of Granzyme-B, TNF-α and Perforin, and downregulated the expression of CD8+ T cells function exhaustion markers PD-1, Tim-3 and Lag-3. Furthermore, Sophoridine inhibited the migration ability of macrophage by decrease the CCR2 expression. Thus, Sophoridine acted on macrophages and CD8+ T cells to reshape gastric cancer immune microenvironment. Our studies provided preclin. basis for clin. application of Sophoridine.
- 202Xie, X.; Ma, L.; Zhou, Y.; Shen, W.; Xu, D.; Dou, J.; Shen, B.; Zhou, C. Polysaccharide Enhanced NK Cell Cytotoxicity against Pancreatic Cancer via TLR4/MAPKs/NF-KB Pathway in Vitro/Vivo. Carbohydr. Polym. 2019, 225, 115223, DOI: 10.1016/j.carbpol.2019.115223[Crossref], [PubMed], [CAS], Google Scholar202https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhs1Kku7vJ&md5=a55edb8b29bd2c1a12b87654c157b94aPolysaccharide enhanced NK cell cytotoxicity against pancreatic cancer via TLR4/MAPKs/NF-κB pathway in vitro/vivoXie, Xin; Ma, Lingman; Zhou, Yiran; Shen, Wen; Xu, Duiyue; Dou, Jie; Shen, Baiyong; Zhou, ChanglinCarbohydrate Polymers (2019), 225 (), 115223CODEN: CAPOD8; ISSN:0144-8617. (Elsevier Ltd.)A polysaccharide isolated from Strongylocentrotus nudus eggs (SEP) reportedly displays immune activity in vivo. Here, its effect and underlying mechanism in the treatment of pancreatic cancer were investigated. SEP obviously inhibited pancreatic cancer growth by activating NK cells in vitro/vivo via TLR4/MAPKs/NF-κB signaling pathway, The tumor inhibitory rate achieved to 44.5% and 50.8% at a dose of 40 mg/kg in Bxpc-3 and SW1990 nude mice, resp. Moreover, SEP obviously augmented the Gemcitabine (GEM) antitumor effect by upregulating NKG2D, which improved the sensitivity of NK cells targeting to its ligand MICA; meanwhile, the antitumor inhibitory rate was 68.6% in BxPC-3 tumor-bearing mice. Moreover, SEP reversed GEM-induced apoptosis and atrophy in both spleen and bone marrow via suppressing ROS secretion in vivo. These results suggested that pancreatic cancer was effectively inhibited by SEP-enhanced NK cytotoxicity mediated primarily through TLR4/MAPKs/NF-κB signaling pathway, representing a potential immunotherapy candidate for the treatment of pancreatic cancer.
- 203Xia, Y.; Wang, M.; Demaria, O.; Tang, J.; Rocchi, P.; Qu, F.; Iovanna, J. L.; Alexopoulou, L.; Peng, L. A Novel Bitriazolyl Acyclonucleoside Endowed with Dual Antiproliferative and Immunomodulatory Activity. J. Med. Chem. 2012, 55 (11), 5642– 5646, DOI: 10.1021/jm300534u[ACS Full Text], [CAS], Google Scholar203https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC38XmvV2msbs%253D&md5=3157b3784449b8a713076a48e114e639A Novel Bitriazolyl Acyclonucleoside Endowed with Dual Antiproliferative and Immunomodulatory ActivityXia, Yi; Wang, Menghua; Demaria, Olivier; Tang, Jingjie; Rocchi, Palma; Qu, Fanqi; Iovanna, Juan L.; Alexopoulou, Lena; Peng, LingJournal of Medicinal Chemistry (2012), 55 (11), 5642-5646CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)A novel bitriazolyl acyclonucleoside I was discovered to exhibit powerful antiproliferative effects on different cancer cell lines through caspase-dependent apoptosis and at the same time stimulate the immune response in dendritic cells via Toll-like receptor 7 (TLR7) signaling. This promising compd. with dual anticancer and immunomodulatory activity may represent a new generation of highly efficacious drug candidates for use in cancer therapy.
- 204Zhang, L.; Shi, L.; Soars, S. M.; Kamps, J.; Yin, H. Discovery of Novel Small-Molecule Inhibitors of NF-KB Signaling with Antiinflammatory and Anticancer Properties. J. Med. Chem. 2018, 61 (14), 5881– 5899, DOI: 10.1021/acs.jmedchem.7b01557[ACS Full Text], [CAS], Google Scholar204https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhtVOmsLvK&md5=302513488d34faabe2ff128ac2c4c44cDiscovery of Novel Small-Molecule Inhibitors of NF-κB Signaling with Antiinflammatory and Anticancer PropertiesZhang, Lei; Shi, Lei; Soars, Shafer Myers; Kamps, Joshua; Yin, HangJournal of Medicinal Chemistry (2018), 61 (14), 5881-5899CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)Excessive NF-κB activation contributes to the pathogenesis of numerous diseases. Small-mol. inhibitors of NF-κB signaling have significant therapeutic potential esp. in treating inflammatory diseases and cancers. In this study, we performed a cell-based high-throughput screening to discover novel agents capable of inhibiting NF-κB signaling. On the basis of two hit scaffolds from the screening, we synthesized 69 derivs. to optimize the potency for inhibition of NF-κB activation, leading to successful discovery of the most potent compd. Z9j with over 170-fold enhancement of inhibitory activity. Preliminary mechanistic studies revealed that Z9j inhibited NF-κB signaling via suppression of Src/Syk, PI3K/Akt, and IKK/IκB pathways. This novel compd. also demonstrated antiinflammatory and anticancer activities, warranting its further development as a potential multifunctional agent to treat inflammatory diseases and cancers.
- 205Krieg, A. M. Toll-like Receptor 9 (TLR9) Agonists in the Treatment of Cancer. Oncogene 2008, 27 (2), 161– 167, DOI: 10.1038/sj.onc.1210911[Crossref], [PubMed], [CAS], Google Scholar205https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1cXitl2hsg%253D%253D&md5=d192b643f161616a6b982b8b5043cd4eToll-like receptor 9 (TLR9) agonists in the treatment of cancerKrieg, A. M.Oncogene (2008), 27 (2), 161-167CODEN: ONCNES; ISSN:0950-9232. (Nature Publishing Group)A review. Although still early in clin. development, agonists of Toll-like receptor 9 (TLR9) have demonstrated potential for the treatment of cancer. TLR9 agonists directly induce activation and maturation of plasmacytoid dendritic cells and enhance differentiation of B cells into antibody-secreting plasma cells. Preclin. and early clin. data support the use of TLR9 agonists in patients with solid tumors and hematol. malignancies. In preclin. studies, TLR9 agonists have shown activity not only as monotherapy, but also in combination with multiple other therapies, including vaccines, antibodies, cellular therapies, other immunotherapies, antiangiogenic agents, radiotherapy, cryotherapy and some chemotherapies. Phase I and II clin. trials have indicated that these agents have antitumor activity as single agents and enhance the development of antitumor T-cell responses when used as therapeutic vaccine adjuvants. The activity and safety of these novel anticancer agents are being explored in a wide range of tumor types as part of a variety of therapeutic strategies with the goal of harnessing the immune response to fight cancer.
- 206Lim, K.-H. TLR9. Cancer Ther. Targets 2017, 1–2, 495– 502, DOI: 10.1007/978-1-4419-0717-2_70
- 207Cho, H. C.; Kim, B. H.; Kim, K.; Park, J. Y.; Chang, J. H.; Kim, S. K. Cancer Immunotherapeutic Effects of Novel CpG ODN in Murine Tumor Model. Int. Immunopharmacol. 2008, 8 (10), 1401– 1407, DOI: 10.1016/j.intimp.2008.05.010[Crossref], [PubMed], [CAS], Google Scholar207https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1cXps1Ggsrk%253D&md5=10d5b7291eb9dda151cf70a58535d0bfCancer immunotherapeutic effects of novel CpG ODN in murine tumor modelCho, Hyeon Cheol; Kim, Bo Hwan; Kim, Kyunghoon; Park, Ju Youn; Chang, Jae-Ho; Kim, Soo-KiInternational Immunopharmacology (2008), 8 (10), 1401-1407CODEN: IINMBA; ISSN:1567-5769. (Elsevier B.V.)While CpG oligodeoxynucleotides (ODN) are excellent candidates for cancer immunotherapeutics, the nos. of usable CpG ODNs are limited in current clin. settings. To resolve this, we investigated whether novel CpG ODN (KSK-CpG) would be an effective immunotherapeutic in a murine tumor model by affecting in vivo and in vitro parameters, such as survival span, the no. of tumor nodules, natural killer (NK) cell and cytotoxic T lymphocyte (CTL) activity and interleukin (IL)-6 or IL-12 cytokine release in splenocytes. We found that KSK-CpG was effective in the murine cancer model by way of prolonging survival span, reducing the no. of tumor nodules, augmenting NK cell and CTL cytotoxicity, as well as evoking IL-6 and IL-12 cytokine release in splenocytes. Collectively, these data demonstrate that KSK-CpG is active against the highly malignant B16BL6 and EL4 tumor mouse model via innate immune augmentation.
- 208Qi, X. F.; Zheng, L.; Kim, C. S.; Lee, K. J.; Kim, D. H.; Cai, D. Q.; Qin, J. W.; Yu, Y. H.; Wu, Z.; Kim, S. K. CpG Oligodeoxynucleotide Induces Apoptosis and Cell Cycle Arrest in A20 Lymphoma Cells via TLR9-Mediated Pathways. Mol. Immunol. 2013, 54 (3–4), 327– 337, DOI: 10.1016/j.molimm.2013.01.001[Crossref], [PubMed], [CAS], Google Scholar208https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXjvFahs7c%253D&md5=727549908743f4102fe36fee44829afeCpG oligodeoxynucleotide induces apoptosis and cell cycle arrest in A20 lymphoma cells via TLR9-mediated pathwaysQi, Xu-Feng; Zheng, Li; Kim, Cheol-Su; Lee, Kyu-Jae; Kim, Dong-Heui; Cai, Dong-Qing; Qin, Jun-Wen; Yu, Yan-Hong; Wu, Zheng; Kim, Soo-KiMolecular Immunology (2013), 54 (3-4), 327-337CODEN: MOIMD5; ISSN:0161-5890. (Elsevier)Recent studies have suggested that the anti-cancer activity of CpG-oligodeoxynucleotides (CpG-ODNs) is owing to their immunomodulatory effects in tumor-bearing host. The purpose of this study is to investigate the directly cytotoxic activity of KSK-CpG, a novel CpG-ODN with an alternative CpG motif, against A20 and EL4 lymphoma cells in comparison with previously used murine CpG motif (1826-CpG). To evaluate the potential cytotoxic effects of KSK-CpG on lymphoma cells, cell viability assay, confocal microscopy, flow cytometry, DNA fragmentation, Western blotting, and reverse transcription-polymerase chain reaction (RT-PCR) anal. were used. We found that KSK-CpG induced direct cytotoxicity in A20 lymphoma cells, but not in EL4 lymphoma cells, at least in part via TLR9-mediated pathways. Apoptotic cell death was demonstrated to play an important role in CpG-ODNs-induced cytotoxicity. In addn., both mitochondrial membrane potential decrease and G1-phase arrest were involved in KSK-CpG-induced apoptosis in A20 cells. The activities of apoptotic mols. such as caspase-3, PARP, and Bax were increased, but the activation of p27 Kip1 and ERK were decreased in KSK-CpG-treated A20 cells. Furthermore, autocrine IFN-γ partially contributed to apoptotic cell death in KSK-CpG-treated A20 cells. Collectively, our findings suggest that KSK-CpG induces apoptotic cell death in A20 lymphoma cells at least in part by inducing G1-phase arrest and autocrine IFN-γ via increasing TLR9 expression, without the need for immune system of tumor-bearing host. This new understanding supports the development of TLR9-targeted therapy with CpG-ODN as a direct therapeutic agent for treating B lymphoma.
- 209Zhang, Y.; Lin, A.; Zhang, C.; Tian, Z.; Zhang, J. Phosphorothioate-Modified CpG Oligodeoxynucleotide (CpG ODN) Induces Apoptosis of Human Hepatocellular Carcinoma Cells Independent of TLR9. Cancer Immunol. Immunother. 2014, 63 (4), 357– 367, DOI: 10.1007/s00262-014-1518-y[Crossref], [PubMed], [CAS], Google Scholar209https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXhsFCltbc%253D&md5=68a40c2862354a9b7dfd3d74c6c8f538Phosphorothioate-modified CpG oligodeoxynucleotide (CpG ODN) induces apoptosis of human hepatocellular carcinoma cells independent of TLR9Zhang, Yuyi; Lin, Ang; Zhang, Cai; Tian, Zhigang; Zhang, JianCancer Immunology Immunotherapy (2014), 63 (4), 357-367CODEN: CIIMDN; ISSN:0340-7004. (Springer)Toll-like receptors (TLRs) expressed on cancer cells are closely assocd. with tumor development. In this study, we investigated the biol. functions of the TLR9 ligand, CpG oligodeoxynucleotide (CpG ODN), on TLR9 expressed in the cytoplasm of hepatocellular carcinoma (HCC) cells. In vitro, human HCC cell lines were transfected with phosphorothioate-modified oligodeoxynucleotides TLR9 agonist OND M362 and its neg. control ODN M362 ctrl, which inhibited the proliferation of HCC cells by inducing apoptosis without altering the cell cycle. Interestingly, ODN M362 and ODN M362 Ctrl displayed a similar proapoptotic effect on HCC, possibly related to phosphorothioate modification of the structure of CpG ODN. Although both of them resulted in the upregulation of the TLR9 receptor, their effect on HCC apoptosis was independent of TLR9. They also upregulated inflammatory cytokines, but did not activate the NF-κB signaling pathway. Finally, the activities of ODN M362 and ODN M362 Ctrl were demonstrated in nude mice inoculated with HCC cells. These findings suggest that the phosphorothioate-modified TLR9 agonist ODN M362, and its control, elicit antitumor activity in HCC cells and may serve as a novel therapeutic target for HCC therapy.
- 210Yang, L.; Sun, L.; Wu, X.; Wang, L.; Wei, H.; Wan, M.; Zhang, P.; Yu, Y.; Wang, L. Therapeutic Injection of C-Class CpG ODN in Draining Lymph Node Area Induces Potent Activation of Immune Cells and Rejection of Established Breast Cancer in Mice. Clin. Immunol. 2009, 131 (3), 426– 437, DOI: 10.1016/j.clim.2009.01.011[Crossref], [PubMed], [CAS], Google Scholar210https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1MXmtVKksbk%253D&md5=2b0f07cabde72bc64053713422485cd7Therapeutic injection of C-class CpG ODN in draining lymph node area induces potent activation of immune cells and rejection of established breast cancer in miceYang, Liang; Sun, Luguo; Wu, Xiuli; Wang, Li; Wei, Hongfei; Wan, Min; Zhang, Peiyin; Yu, Yongli; Wang, LiyingClinical Immunology (Amsterdam, Netherlands) (2009), 131 (3), 426-437CODEN: CLIIFY; ISSN:1521-6616. (Elsevier B.V.)To develop novel CpG ODNs for the treatment of breast cancer, the authors have designed a series of CpG ODNs and evaluated their anti-tumor activity in a breast cancer mouse model. Interestingly, a C-class CpG ODN, designated as YW002, showed a vigorous activity on the inhibition of tumor growth in mice and completely cured some of the tumor-bearing mice through injection at tumor draining lymph node (TDLN) area. The expansion of immune cells in the TDLN and tumor and the generation of tumor specific immune memory were found assocd. with YW002-induced anti-tumor activity in mice. These results indicate that C-class CpG ODN could be developed into a medicament in a monotherapeutic regimen for the treatment of breast cancer through injection at TDLN area in clinic.
- 211Yang, M.; Yan, Y.; Fang, M.; Wan, M.; Wu, X.; Zhang, X.; Zhao, T.; Wei, H.; Song, D.; Wang, L.; Yu, Y. MF59 Formulated with CpG ODN as a Potent Adjuvant of Recombinant HSP65-MUC1 for Inducing Anti-MUC1 + Tumor Immunity in Mice. Int. Immunopharmacol. 2012, 13 (4), 408– 416, DOI: 10.1016/j.intimp.2012.05.003[Crossref], [PubMed], [CAS], Google Scholar211https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC38XpsV2ktLg%253D&md5=9c628366b2ff0b2d1bf01c6e551b2399MF59 formulated with CpG ODN as a potent adjuvant of recombinant HSP65-MUC1 for inducing anti-MUC1+ tumor immunity in miceYang, Ming; Yan, Youyou; Fang, Mingli; Wan, Min; Wu, Xiuli; Zhang, Xiaoling; Zhao, Tiesuo; Wei, Hongfei; Song, Dandan; Wang, Liying; Yu, YongliInternational Immunopharmacology (2012), 13 (4), 408-416CODEN: IINMBA; ISSN:1567-5769. (Elsevier B.V.)MF59 is an oil-in-water emulsion adjuvant approved for influenza vaccines for human use in Europe. Due to its Th2 inducing properties, MF59 is seldom tested for cancer vaccines. In this study, MF59 formulated with a C-type CpG oligodeoxynucleotide (YW002) was tested for its Th1 adjuvant activity to induce immune responses to HSP65-MUC1, a recombinant fusion protein incorporating a mycobacterial heat shock protein (HSP65) and mucin 1, cell surface assocd. (MUC1) derived peptide. Combination of YW002 with MF59 (MF59-YW002) could confer a potent Th1 biasing property to the adjuvant, which enhanced the immunogenicity of HSP65-MUC1 to induce significantly higher levels of specific IgG2c, increased IFN-γ mRNA expression in splenocytes and the generation of antigen-specific cytotoxic T lymphocytes in mice. When prophylactically applied, MF59-YW002 adjuvant contg. HSP65-MUC1 inhibited the growth of MUC1+ B16 melanoma and prolonged the survival of tumor-bearing mice. In contrast, adjuvant contg. MF59 with HSP65-MUC1 in the absence of YW002, promoted the growth of MUC1+ B16 melanoma in mice. These results suggest that MF59 plus CpG oligodeoxynucleotide might be developed as an efficient adjuvant for tumor vaccines against melanoma, and possibly other tumors.
- 212Jordan, M.; Waxman, D. J. CpG-1826 Immunotherapy Potentiates Chemotherapeutic and Anti-Tumor Immune Responses to Metronomic Cyclophosphamide in a Preclinical Glioma Model. Cancer Lett. 2016, 373 (1), 88– 96, DOI: 10.1016/j.canlet.2015.11.029[Crossref], [PubMed], [CAS], Google Scholar212https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXhvFOqtrzE&md5=d3c11200f7abccf7edaec363ed9ad61eCpG-1826 immunotherapy potentiates chemotherapeutic and anti-tumor immune responses to metronomic cyclophosphamide in a preclinical glioma modelJordan, Marie; Waxman, David J.Cancer Letters (New York, NY, United States) (2016), 373 (1), 88-96CODEN: CALEDQ; ISSN:0304-3835. (Elsevier)Cyclophosphamide administered on an intermittent metronomic schedule induces strong immune-dependent regression in several glioma models. Here we investigate whether this immunogenic chemotherapy can be potentiated by combination with the immune stimulatory TLR9 agonist CpG-1826. CpG-1826 treatment of GL261 gliomas implanted in immune competent mice induced tumor growth delay assocd. with increased tumor recruitment of macrophages and B cells. Anti-tumor responses varied between individuals, with CpG-1826 inducing robust tumor growth delay in ∼50% of treated mice. Both high and low CpG-1826-responsive mice showed striking improvements when CpG-1826 was combined with cyclophosphamide treatment. Tumor-assocd. macrophages, B cells, dendritic cells, and cytotoxic T cells were increased, T regulatory cells were not induced, and long-term GL261 glioma regression with immune memory was achieved when CpG-1826 was combined with either single cyclophosphamide dosing (90 mg/kg) or metronomic cyclophosphamide treatment (two cycles at 45 mg/kg, spaced 12-days apart). B16F10 melanoma, a low immunogenic tumor model, also showed enhanced immune and anti-tumor responses to cyclophosphamide/CpG-1826 chemoimmunotherapy, but unlike GL261 tumors, did not regress. TLR9-based immunotherapy can thus be effectively combined with immunogenic cyclophosphamide treatment to enhance immune-based anti-tumor responses, even in poorly immunogenic cancer models.
- 213Xu, A.; Zhang, L.; Yuan, J.; Babikr, F.; Freywald, A.; Chibbar, R.; Moser, M.; Zhang, W.; Zhang, B.; Fu, Z.; Xiang, J. TLR9 Agonist Enhances Radiofrequency Ablation-Induced CTL Responses, Leading to the Potent Inhibition of Primary Tumor Growth and Lung Metastasis. Cell. Mol. Immunol. 2019, 16 (10), 820– 832, DOI: 10.1038/s41423-018-0184-y[Crossref], [PubMed], [CAS], Google Scholar213https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhsVOgtrvF&md5=891ae89dd6f7c7f9f78a99f3ef1e9c71TLR9 agonist enhances radiofrequency ablation-induced CTL responses, leading to the potent inhibition of primary tumor growth and lung metastasisXu, Aizhang; Zhang, Lifeng; Yuan, Jingying; Babikr, Fatma; Freywald, Andrew; Chibbar, Rajni; Moser, Michael; Zhang, Wenjun; Zhang, Bing; Fu, Zhaoying; Xiang, JimCellular & Molecular Immunology (2019), 16 (10), 820-832CODEN: CMIEAO; ISSN:1672-7681. (Nature Research)Radiofrequency ablation (RFA) is the most common approach to thermal ablation for cancer therapy. Unfortunately, its efficacy is limited by incomplete ablation, and further optimization of RFA is required. Here, we demonstrate that incubation at 65°C triggers more EG7 tumor cell death by necrosis than treatment at 45°C, and the 65°C-treated cells are more effective at inducing antigen-specific CD8+ cytotoxic T lymphocyte (CTL) responses after injection in mice than the 45°C-treated ones. Dendritic cells (DCs) that phagocytose 65°C-treated EG7 cells become mature with upregulated MHCII and CD80 expression and are capable of efficiently inducing effector CTLs in mouse tumor models. RFA (65°C) therapy of EG7 tumors induces large areas of tumor necrosis and stimulates CTL responses. This leads to complete regression of small (∼100 mm3) tumors but fails to suppress the growth of larger (∼350 mm3) tumors. The administration of the Toll-like receptor-9 (TLR9) agonist unmethylated cytosine-phosphorothioate-guanine oligonucleotide (CpG) to DCs phagocytosing 65°C-treated EG7 cells enhances the expression of MHCII and CD40 on DCs as well as DC-induced stimulation of CTL responses. Importantly, the intratumoral administration of CpG following RFA also increases the frequencies of tumor-assocd. immunogenic CD11b-CD11c+CD103+ DC2 and CD11b+F4/80+MHCII+ M1 macrophages and increases CD4+ and CD8+ T-cell tumor infiltration, leading to enhanced CD4+ T cell-dependent CTL responses and potent inhibition of primary RFA-treated or distant untreated tumor growth as well as tumor lung metastasis in mice bearing larger tumors. Overall, our data indicate that CpG administration, which enhances RFA-induced CTL responses and ultimately potentiates the inhibition of primary tumor growth and lung metastasis, is a promising strategy for improving RFA treatment, which may assist in optimizing this important cancer therapy.
- 214Babaer, D.; Amara, S.; McAdory, B. S.; Johnson, O.; Myles, E. L.; Zent, R.; Rathmell, J. C.; Tiriveedhi, V. Oligodeoxynucleotides ODN 2006 and M362 Exert Potent Adjuvant Effect through TLR-9/-6 Synergy to Exaggerate Mammaglobin-a Peptide Specific Cytotoxic CD8+T Lymphocyte Responses against Breast Cancer Cells. Cancers 2019, 11 (5), 672, DOI: 10.3390/cancers11050672[Crossref], [CAS], Google Scholar214https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXitV2mu7w%253D&md5=a612f4e388a95962dafc62303d5fc543Oligodeoxynucleotides ODN 2006 and M362 exert potent adjuvant effect through TLR-9/-6 synergy to exaggerate mammaglobin-a peptide specific cytotoxic CD8+T lymphocyte responses against breast cancer cellsBabaer, Duaa; Amara, Suneetha; McAdory, Brenda S.; Johnson, Owen; Myles, Elbert L.; Zent, Roy; Rathmell, Jeffrey C.; Tiriveedhi, VenkataswarupCancers (2019), 11 (5), 672CODEN: CANCCT; ISSN:2072-6694. (MDPI AG)Mammaglobin-A (MamA) is overexpressed in 40-80% of all human breast cancers. Recent phase I clin. trials of the MamA DNA vaccine showed encouraging safety outcomes. However, this vaccine elicited only a modest increase in MamA specific CD8+T lymphocyte (CTL) activation. As vaccine adjuvants play a crit. role in enhancing the immunotherapeutic efficiency of vaccines, we tested the potential role of three synthetic CpG oligodeoxynucleotides (ODN2216-class A ODN, ODN2006-class B ODN, and ODN M362-class C ODN) to further enhance MamA specific CTL responses. Towards this, na.ovrddot.ive CD8+T cells were obtained from healthy HLA-A2+ human donors. The HLA-A2 specific immunodominant epitope of MamA, MamA2.1 (LIYDSSLCDL), was utilized to activate na.ovrddot.ive CD8+T cells. The THP-1 (HLA-A2+) cells were used as antigen presenting cells to stimulate na.ovrddot.ive CD8+T cells along with (or without) co-treatment of various ODNs mentioned above. Activation of na.ovrddot.ive CD8+T cells with the MamA2.1 peptide along with ODNs demonstrated enhanced MamA specific CTL mediated cytotoxicity on AU565 (HLA-A+/MamA+) breast cancer cells following co-treatment with ODN2006 and M362 compared to ODN2216 or MamA2.1 peptide alone. However, no significant cytotoxicity was noted upon treatment of MamA2.1 activated CTLs on MCF7 (HLA-A+/MamA -) cells, suggesting that the activation of CTLs is specific to the MamA antigen. Functional characterization studies demonstrated specific IL-12 mediated cross-talk between TLR-6 and -9 in THP-1 cells following stimulation with ODN2006 and M362, which was crit. for the final cytotoxic activation of CD8+T lymphocytes. Based on these data, we conclude that ODN2006 and ODN M362 exerted a strong adjuvant effect through induction of the initial innate immune response through TLR9 upregulation followed by enhanced MamA specific CTL dependent adaptive immune responses. Our current data provide evidence for the application of Class-B/-C-CpG-ODNs as potential vaccine adjuvants towards enhancing the success of MamA based breast cancer vaccination.
- 215Kapp, K.; Volz, B.; Curran, M. A.; Oswald, D.; Wittig, B.; Schmidt, M. EnanDIM - a Novel Family of L-Nucleotide-Protected TLR9 Agonists for Cancer Immunotherapy. J. Immunother. Cancer 2019, 7, 5, DOI: 10.1186/s40425-018-0470-3[Crossref], [PubMed], [CAS], Google Scholar215https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB3cnpt1yjtA%253D%253D&md5=78d49bee02a7adf9a313eabf56fb4e30EnanDIM - a novel family of L-nucleotide-protected TLR9 agonists for cancer immunotherapyKapp Kerstin; Volz Barbara; Oswald Detlef; Schmidt Manuel; Curran Michael A; Wittig BurghardtJournal for immunotherapy of cancer (2019), 7 (1), 5 ISSN:.BACKGROUND: Toll-like receptor 9 agonists are potent activators of the immune system. Their clinical potential in immunotherapy against metastatic cancers is being evaluated across a number of clinical trials. TLR9 agonists are DNA-based molecules that contain several non-methylated CG-motifs for TLR9 recognition. Chemical modifications of DNA backbones are usually employed to prevent degradation by nucleases. These, however, can promote undesirable off-target effects and therapeutic restrictions. METHODS: Within the EnanDIM® family members of TLR9 agonists described here, D-deoxyribose nucleotides at the nuclease-accessible 3'-ends are replaced by nuclease-resistant L-deoxyribose nucleotides. EnanDIM® molecules with varying sequences were screened for their activation of human peripheral blood mononuclear cells based on secretion of IFN-alpha and IP-10 as well as activation of immune cells. Selected molecules were evaluated in mice in a maximum feasible dose study and for analysis of immune activation. The ability to modulate the tumor-microenvironment and anti-tumor responses after EnanDIM® administration was analyzed in syngeneic murine tumor models. RESULTS: The presence of L-deoxyribose containing nucleotides at their 3'-ends is sufficient to prevent EnanDIM® molecules from nucleolytic degradation. EnanDIM® molecules show broad immune activation targeting specific components of both the innate and adaptive immune systems. Activation was strictly dependent on the presence of CG-motifs, known to be recognized by TLR9. The absence of off-target effects may enable a wide therapeutic window. This advantageous anti-tumoral immune profile also promotes increased T cell infiltration into CT26 colon carcinoma tumors, which translates into reduced tumor growth. EnanDIM® molecules also drove regression of multiple other murine syngeneic tumors including MC38 colon carcinoma, B16 melanoma, A20 lymphoma, and EMT-6 breast cancer. In A20 and EMT-6, EnanDIM® immunotherapy cured a majority of mice and established persistent anti-tumor immune memory as evidenced by the complete immunity of these mice to subsequent tumor re-challenge. CONCLUSIONS: In summary, EnanDIM® comprise a novel family of TLR9 agonists that facilitate an efficacious activation of both innate and adaptive immunity. Their proven potential in onco-immunotherapy, as shown by cytotoxic activity, beneficial modulation of the tumor microenvironment, inhibition of tumor growth, and induction of long-lasting, tumor-specific memory, supports EnanDIM® molecules for further preclinical and clinical development.
- 216Jia, H.; Guo, J.; Wang, P.; Sun, K.; Chen, J.; Ren, W.; Wei, T.; Yang, Y.; Li, J.; Liu, X.; Li, R.; Zhong, J.; Wang, M.; Tian, Z.; Feng, Z.; Zhao, T. A Self-Designed CpG ODN Enhanced the Anti-Melanoma Effect of Pimozide. Int. Immunopharmacol. 2020, 83, 106397, DOI: 10.1016/j.intimp.2020.106397[Crossref], [PubMed], [CAS], Google Scholar216https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXls1Glsr4%253D&md5=3639d1766249901088e4d5ce2c5e857cA self-designed CpG ODN enhanced the anti-melanoma effect of pimozideJia, Huijie; Guo, Jing; Wang, Pingping; Sun, Ke; Chen, Jian; Ren, Wenjing; Wei, Tian; Yang, Yunfan; Li, Jie; Liu, Xiaoming; Li, Ruipeng; Zhong, Jiateng; Wang, Mingyong; Tian, Zhongwei; Feng, Zhiwei; Zhao, TiesuoInternational Immunopharmacology (2020), 83 (), 106397CODEN: IINMBA; ISSN:1567-5769. (Elsevier B.V.)Melanomas represent the deadliest form of skin cancers. Due to the intricacy of tumorigenesis, it is emergent to find effective therapies for melanomas. Researches have proved that pimozide inhibits the growth of melanoma, but the limited curing effect needs to be further improved. Nowadays, tumor immunotherapy has been widely recognized as the sole therapy that can eradicate cancers. Cytosine-phosphate-guanine oligodeoxynucleotide (CpG ODN), TLR9 receptor agonist, can significantly enhance anti-tumor immune responses. This study explored the therapeutic effect of pimozide combined with CpG ODN on melanoma-bearing mice. The results showed that pimozide combined with CpG ODN effectively inhibited the growth of melanoma and prolonged the survival of melanoma-bearing mice, inhibited the expression of MMP2 and p-Stat5, increased the infiltration of CD4+ and CD8+ T cells in tumor, raised the ratios of CD4+, CD8+ T cells and NK cells. These all indicated that the combination treatment improved the anti-tumor effect of pimozide on mice. The anti-tumor mechanism might be attributed to cell apoptosis induction, invasion inhibition, and immune regulation. A more effective combination treatment concerning with pimozide is being under investigation.
- 217Zhang, L.; Dewan, V.; Yin, H. Discovery of Small Molecules as Multi-Toll-like Receptor Agonists with Proinflammatory and Anticancer Activities. J. Med. Chem. 2017, 60 (12), 5029– 5044, DOI: 10.1021/acs.jmedchem.7b00419[ACS Full Text], [CAS], Google Scholar217https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXot1ymtrY%253D&md5=420e72a8bb3556e9e98f7a5f9f63f58eDiscovery of Small Molecules as Multi-Toll-like Receptor Agonists with Proinflammatory and Anticancer ActivitiesZhang, Lei; Dewan, Varun; Yin, HangJournal of Medicinal Chemistry (2017), 60 (12), 5029-5044CODEN: JMCMAR; ISSN:0022-2623. (American Chemical Society)Therapies based on activation of multiple Toll-like receptors (TLRs) may offer superior therapeutic profiles than that of single TLR activation. To discover new small mols. that could activate multiple TLRs, the authors performed a cell-based high-throughput screening of a small-mol. library based on TLR3-mediated NF-κB activation. Subsequent structural optimization and counter-screening of other TLRs produced the first small mol. I capable of simultaneously activating TLRs 3, 8, and 9. Biochem. studies demonstrated that I could induce a strong immune response via the prodn. of various cytokines in human monocytic THP-1 cells. Furthermore, I inhibited the proliferation of HeLa cancer cells by triggering apoptosis and arresting the cell cycle at the S phase. These results showcase potential therapeutic applications of I in both vaccine adjuvants and anticancer therapies based on multi-TLR activation.
- 218Davidson, A.; Diamond, B. Autoimmune Diseases. N. Engl. J. Med. 2001, 345 (5), 340– 350, DOI: 10.1056/NEJM200108023450506[Crossref], [PubMed], [CAS], Google Scholar218https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD3MXmtVGqs7c%253D&md5=89ca13f68ee34072a70f28266ae82aa6Autoimmune diseasesDavidson, Anne; Diamond, BettyNew England Journal of Medicine (2001), 345 (5), 340-350CODEN: NEJMAG; ISSN:0028-4793. (Massachusetts Medical Society)A review discussing autoimmune diseases, which is defined as a clin. syndrome caused by the activation of T cells or B cells, or both, in the absence of an ongoing infection or other discernible cause. The classification of autoimmune disease that distinguishes diseases caused by generalized defects in lymphocyte selection or homeostasis from those caused by aberrant responses to particular antigens is discussed. The genetic susceptibility to autoimmune disease, environmental and internal triggers of autoreactivity, changes in pathol. processes as the disease progresses, multiple mechanisms of tissue injury, as well as the survey of new therapeutic approaches are also considered.
- 219Liu, Y.; Yin, H.; Zhao, M.; Lu, Q. TLR2 and TLR4 in Autoimmune Diseases: A Comprehensive Review. Clin. Rev. Allergy Immunol. 2014, 47 (2), 136– 147, DOI: 10.1007/s12016-013-8402-y[Crossref], [PubMed], [CAS], Google Scholar219https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXhsFKrt7zL&md5=d69c2e90e53688b3b9e7dcfb9c1ba726TLR2 and TLR4 in Autoimmune Diseases: a Comprehensive ReviewLiu, Yu; Yin, Heng; Zhao, Ming; Lu, QianjinClinical Reviews in Allergy & Immunology (2014), 47 (2), 136-147CODEN: CRAIF2; ISSN:1080-0549. (Springer)Autoimmune diseases are immune disorders characterized by T cell hyperactivity and B cell overstimulation leading to overprodn. of autoantibodies. Although the pathogenesis of various autoimmune diseases remains to be elucidated, environmental factors have been thought to contribute to the initiation and maintenance of auto-respond inflammation. Toll-like receptors (TLRs) are pattern recognition receptors belonging to innate immunity that recognize and defend invading microorganisms. Besides these exogenous pathogen-assocd. mol. patterns, TLRs can also bind with damage-assocd. mol. patterns produced under strike or by tissue damage or cells apoptosis. It is believed that TLRs build a bridge between innate immunity and autoimmunity. There are five adaptors to TLRs including MyD88, TRIF, TIRAP/MAL, TRAM, and SARM. Upon activation, TLRs recruit specific adaptors to initiate the downstream signaling pathways leading to the prodn. of inflammatory cytokines and chemokines. Under certain circumstances, ligation of TLRs drives to aberrant activation and unrestricted inflammatory responses, thereby contributing to the perpetuation of inflammation in autoimmune diseases. In the past, most studies focused on the intracellular TLRs, such as TLR3, TLR7, and TLR9, but recent studies reveal that cell surface TLRs, esp. TLR2 and TLR4, also play an essential role in the development of autoimmune diseases and afford multiple therapeutic targets. In this review, we summarized the biol. characteristics, signaling mechanisms of TLR2/4, the neg. regulators of TLR2/4 pathway, and the pivotal function of TLR2/4 in the pathogenesis of autoimmune diseases including rheumatoid arthritis, systemic lupus erythematosus, systemic sclerosis, Sjogren's syndrome, psoriasis, multiple sclerosis, and autoimmune diabetes.
- 220Joosten, L. A. B.; Abdollahi-Roodsaz, S.; Dinarello, C. A.; O’Neill, L.; Netea, M. G. Toll-like Receptors and Chronic Inflammation in Rheumatic Diseases: New Developments. Nat. Rev. Rheumatol. 2016, 12 (6), 344– 357, DOI: 10.1038/nrrheum.2016.61[Crossref], [PubMed], [CAS], Google Scholar220https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XnvV2ntb8%253D&md5=a561bbe778204e8e57d599efdbec093aToll-like receptors and chronic inflammation in rheumatic diseases: new developmentsJoosten, Leo A. B.; Abdollahi-Roodsaz, Shahla; Dinarello, Charles A.; O'Neill, Luke; Netea, Mihai G.Nature Reviews Rheumatology (2016), 12 (6), 344-357CODEN: NRRACB; ISSN:1759-4790. (Nature Publishing Group)In the past few years, new developments have been reported on the role of Toll-like receptors (TLRs) in chronic inflammation in rheumatic diseases. The inhibitory function of TLR10 has been demonstrated. Receptors that enhance the function of TLRs, and several TLR inhibitors, have been identified. In addn., the role of the microbiome and TLRs in the onset of rheumatic diseases has been reported. We review novel insights on the role of TLRs in several inflammatory joint diseases, including rheumatoid arthritis, systemic lupus erythematosus, gout and Lyme arthritis, with a focus on the signalling mechanisms mediated by the Toll-IL-1 receptor (TIR) domain, the exogenous and endogenous ligands of TLRs, and the current and future therapeutic strategies to target TLR signalling in rheumatic diseases.
- 221Minagar, A. Multiple Sclerosis: An Overview of Clinical Features, Pathophysiology, Neuroimaging, and Treatment Options. Colloq. Ser. Integr. Syst. Physiol. From Mol. to Funct. 2014, 6, 1– 117, DOI: 10.4199/C00116ED1V01Y201408ISP055
- 222Kumar, V. Toll-like Receptors in the Pathogenesis of Neuroinflammation. J. Neuroimmunol. 2019, 332, 16– 30, DOI: 10.1016/j.jneuroim.2019.03.012[Crossref], [PubMed], [CAS], Google Scholar222https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXmtlOms7s%253D&md5=3d8a80280856b6cea3d95d19ac195a04Toll-like receptors in the pathogenesis of neuroinflammationKumar, V.Journal of Neuroimmunology (2019), 332 (), 16-30CODEN: JNRIDW; ISSN:0165-5728. (Elsevier B.V.)Toll-like receptors (TLRs) are discovered as crucial pattern recognition receptors (PRRs) involved in the recognition of pathogen-assocd. mol. patterns (PAMPs). Later studies showed their involvement in the recognition of various damage/danger-assocd. mol. patterns (DAMPs) generated by host itself. Thus, TLRs are capable of recognizing wide-array of patterns/mols. derived from pathogens and host as well and initiating a proinflammatory immune response through the activation of NF-κB and other transcription factors causing synthesis of proinflammatory mols. The process of neuroinflammation is seen under both sterile and infectious inflammatory diseases of the central nervous system (CNS) and may lead to the development of neurodegeneration. The present article is designed to highlight the importance of TLRs in the pathogenesis of neuroinflammation under diverse conditions. TLRs are expressed by various immune cells present in CNS along with neurons. However out of thirteen TLRs described in mammals, some are present and active in these cells, while some are absent and are described in detail in main text. The role of various immune cells present in the brain and their role in the pathogenesis of neuroinflammation depending on the type of TLR expressed is described. Thereafter the role of TLRs in bacterial meningitis, viral encephalitis, stroke, Alzheimer's disease (AD), Parkinson's disease (PD), and autoimmune disease including multiple sclerosis (MS) is described. The article is designed for both neuroscientists needing information regarding TLRs in neuroinflammation and TLR biologists or immunologists interested in neuroinflammation.
- 223Hansen, B. S.; Hussain, R. Z.; Lovett-Racke, A. E.; Thomas, J. A.; Racke, M. K. Multiple Toll-like Receptor Agonists Act as Potent Adjuvants in the Induction of Autoimmunity. J. Neuroimmunol. 2006, 172 (1–2), 94– 103, DOI: 10.1016/j.jneuroim.2005.11.006[Crossref], [PubMed], [CAS], Google Scholar223https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD28XhvVWgs78%253D&md5=f224f1c0dc3fc4f84b80ae2aae3855cdMultiple toll-like receptor agonists act as potent adjuvants in the induction of autoimmunityHansen, Baranda S.; Hussain, Rehana Z.; Lovett-Racke, Amy E.; Thomas, James A.; Racke, Michael K.Journal of Neuroimmunology (2006), 172 (1-2), 94-103CODEN: JNRIDW; ISSN:0165-5728. (Elsevier B.V.)Infections can trigger or exacerbate the course of Multiple Sclerosis, and both bacterial and viral agents have been implicated. These agents are recognized by host cells via pathogen-assocd. mol. patterns activating TLRs. We investigated the role that PAMPs play in the animal model Exptl. Autoimmune Encephalomyelitis, and found various MyD88-dependent PAMPs can participate as the adjuvant to induce EAE. Studies with IRAK1-deficient mice suggest that signaling through TLRs is not required in the target organ to develop disease. This suggests that PAMPs play an important role in priming of autoreactive T cells in EAE and potentially MS.
- 224Clements, M. TLR2 and TLR4 Cascade Involved in the Multifaceted Symptoms of Experimental Autoimmune Encephalomyelitis (EAE), a Model of Multiple Sclerosis, Thesis, University of Colorado at Boulder, Boulder, CO, 2019.
- 225Touil, T.; Fitzgerald, D.; Zhang, G.-X.; Rostami, A.; Gran, B. Cutting Edge: TLR3 Stimulation Suppresses Experimental Autoimmune Encephalomyelitis by Inducing Endogenous IFN-β. J. Immunol. 2006, 177 (11), 7505– 7509, DOI: 10.4049/jimmunol.177.11.7505[Crossref], [PubMed], [CAS], Google Scholar225https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD28Xht1Wrs7fK&md5=09a4bf2fca12fb63310224ff295e50a3Cutting Edge: TLR3 Stimulation Suppresses Experimental Autoimmune Encephalomyelitis by Inducing Endogenous IFN-βTouil, Tarik; Fitzgerald, Denise; Zhang, Guang-Xian; Rostami, Abdolmohamad; Gran, BrunoJournal of Immunology (2006), 177 (11), 7505-7509CODEN: JOIMA3; ISSN:0022-1767. (American Association of Immunologists)Exptl. autoimmune encephalomyelitis is a well-characterized model of cell-mediated autoimmunity. TLRs expressed on APCs recognize microbial components and induce innate immune responses, leading to the elimination of invading infectious agents. Certain TLR agonists have been reported to have adjuvant properties in CNS autoimmune inflammatory demyelination. The authors report in this study that TLR3 stimulation by polyinosinic-polycytidylic acid, a double-stranded RNA analog, suppresses relapsing demyelination in a murine exptl. autoimmune encephalomyelitis model. Disease suppression is assocd. with the induction of endogenous IFN-β and the peripheral induction of the CC chemokine CCL2. These data indicate that a preferential activation of the MyD88-independent, type I IFN-inducing TLR pathway has immunoregulatory potential in this organ-specific autoimmune disease.
- 226Hirotani, M.; Niino, M.; Fukazawa, T.; Kikuchi, S.; Yabe, I.; Hamada, S.; Tajima, Y.; Sasaki, H. Decreased IL-10 Production Mediated by Toll-like Receptor 9 in B Cells in Multiple Sclerosis. J. Neuroimmunol. 2010, 221 (1–2), 95– 100, DOI: 10.1016/j.jneuroim.2010.02.012[Crossref], [PubMed], [CAS], Google Scholar226https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3cXks1Sjsrc%253D&md5=e0bca7d50d37aa9655731485488047eeDecreased IL-10 production mediated by Toll-like receptor 9 in B cells in multiple sclerosisHirotani, Makoto; Niino, Masaaki; Fukazawa, Toshiyuki; Kikuchi, Seiji; Yabe, Ichiro; Hamada, Shinsuke; Tajima, Yasutaka; Sasaki, HidenaoJournal of Neuroimmunology (2010), 221 (1-2), 95-100CODEN: JNRIDW; ISSN:0165-5728. (Elsevier B.V.)The complexity of the roles of Toll-like receptors (TLRs) is attributable to their ability to promote or suppress autoimmune diseases. Recent studies have demonstrated that B cells regulate autoimmune diseases, including multiple sclerosis (MS), by producing interleukin (IL)-10. By using CpG DNA as a TLR9 agonist, we investigated the immunoregulatory functions of B cell via TLR9 in MS. Our results indicate that TLR9-mediated IL-10 prodn. by B cells was significantly decreased in MS, and this decrease is likely due to decreased TLR9 expression in memory B cells, suggesting a role of TLR9 in immunoregulation in MS.
- 227Dishon, S.; Schumacher, A.; Fanous, J.; Talhami, A.; Kassis, I.; Karussis, D.; Gilon, C.; Hoffman, A.; Nussbaum, G. Development of a Novel Backbone Cyclic Peptide Inhibitor of the Innate Immune TLR/IL1R Signaling Protein MyD88. Sci. Rep. 2018, 8, 9476, DOI: 10.1038/s41598-018-27773-8[Crossref], [PubMed], [CAS], Google Scholar227https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB3c%252FgsF2itA%253D%253D&md5=8132ad8c29a425e40a973bd13d574668Development of a Novel Backbone Cyclic Peptide Inhibitor of the Innate Immune TLR/IL1R Signaling Protein MyD88Dishon Shira; Nussbaum Gabriel; Schumacher Adi; Fanous Joseph; Hoffman Amnon; Talhami Alaa; Gilon Chaim; Kassis Ibrahim; Karussis DimitriosScientific reports (2018), 8 (1), 9476 ISSN:.MyD88 is a cytoplasmic adaptor protein that plays a central role in signaling downstream of the TLRs and the IL1R superfamily. We previously demonstrated that MyD88 plays a critical role in EAE, the murine model of multiple sclerosis, and showed that the MyD88 BB-loop decoy peptide RDVLPGT ameliorates EAE. We now designed and screened a library of backbone cyclized peptides based on the linear BB loop peptide, to identify a metabolically stable inhibitor of MyD88 that retains the binding properties of the linear peptide. We identified a novel cyclic peptide protein mimetic that inhibits inflammatory responses to TLR ligands, and NFκB activation in response to IL-1 activation. The inhibitor, c(MyD 4-4), is metabolically stable in comparison to the linear peptide, blocks MyD88 in a specific manner, and inhibits MyD88 function by preventing MyD88 dimerization. Finally, treatment of mice with c(MyD 4-4) reduced the severity of clinical disease in the murine EAE model of multiple sclerosis. Thus, modulation of MyD88-dependent signaling using c(MyD 4-4) is a potential therapeutic strategy to lower innate immune inflammation in autoimmune CNS disease.
- 228Hultqvist, M.; Nandakumar, K. S.; Björklund, U.; Holmdahl, R. The Novel Small Molecule Drug Rabeximod Is Effective in Reducing Disease Severity of Mouse Models of Autoimmune Disorders. Ann. Rheum. Dis. 2009, 68 (1), 130– 135, DOI: 10.1136/ard.2007.085241[Crossref], [PubMed], [CAS], Google Scholar228https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1MXhslOlt7k%253D&md5=a82112d3c1bb173e9e2d0b2a0a071256The novel small molecule drug rabeximod is effective in reducing disease severity of mouse models of autoimmune disordersHultqvist, M.; Nandakumar, K. S.; Bjoerklund, U.; Holmdahl, R.Annals of the Rheumatic Diseases (2009), 68 (1), 130-135CODEN: ARDIAO; ISSN:0003-4967. (BMJ Publishing Group)Objectives: Autoimmune diseases such as rheumatoid arthritis (RA) and multiple sclerosis (MS) affect a relatively large portion of the population, leading to severe disability if left untreated. Even though pharmaceutics targeting the immune system have revolutionized the therapy of these diseases, there is still a need for novel, more effective therapeutic substances. One such substance is the new chem. entity 9-chloro-2,3 dimethyl-6-(N,N-dimthylamino-2-oxoethyl)-6H-indolo [2,3-b] quionoxaline, Rabeximod, currently being investigated for efficiency in treatment of human RA. In this study we aimed to evaluate Rabeximod as a treatment for autoimmune diseases, using animal models. Methods: In the present investigation we have evaluated Rabeximod as a treatment for autoimmune diseases using mouse models of RA and MS, ie, collagen-induced arthritis, collagen antibody induced arthritis and exptl. autoimmune encephalomyelitis. Results: Rabeximod efficiently prevented arthritis and encephalomyelitis in mice. In addn., this effect correlated to the timepoint when cells migrate into the joints. Conclusions: We conclude that Rabeximod reduces disease severity in animal models of autoimmunity and should be considered as a new therapeutic substance for MS and RA.
- 229Crowley, T.; Fitzpatrick, J. M.; Kuijper, T.; Cryan, J. F.; O’Toole, O.; O’Leary, O. F.; Downer, E. J. Modulation of TLR3/TLR4 Inflammatory Signaling by the GABAB Receptor Agonist Baclofen in Glia and Immune Cells: Relevance to Therapeutic Effects in Multiple Sclerosis. Front. Cell. Neurosci. 2015, 9, 284, DOI: 10.3389/fncel.2015.00284[Crossref], [PubMed], [CAS], Google Scholar229https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXlsVOrtbY%253D&md5=acfde6e98a70c0b4d73e919d9de3a8b1Modulation of TLR3/TLR4 inflammatory signaling by the GABAB receptor agonist baclofen in glia and immune cells: relevance to therapeutic effects in multiple sclerosisCrowley, Tadhg; Fitzpatrick, John-Mark; Kuijper, Teun; Cryan, John F.; O'Toole, Orna; O'Leary, Olivia F.; Downer, Eric J.Frontiers in Cellular Neuroscience (2015), 9 (), 284/1-284/12CODEN: FCNRAH; ISSN:1662-5102. (Frontiers Media S.A.)The GABAB receptor agonist, baclofen, is used to treat muscle tightness and cramping caused by spasticity in a no. of disorders including multiple sclerosis (MS), but its precise mechanism of action is unknown. Neuroinflammation drives the central pathol. in MS and is mediated by both immunoreactive glial cells and invading lymphocytes. Furthermore, a body of data indicates that the Toll-like receptor (TLR) family of innate immune receptors is implicated in MS progression. In the present study we investigated whether modulation of GABAB receptors using baclofen can exert anti-inflammatory effects by targeting TLR3 and(or) TLR4-induced inflammatory signaling in murine glial cells and human peripheral blood mononuclear cells (PBMCs) isolated from healthy control individuals and patients with the relapse-remitting (RR) form of MS. TLR3 and TLR4 stimulation promoted the nuclear sequestration of NF-κB and pro-inflammatory cytokine expression in murine glia, while TLR4, but not TLR3, promoted pro-inflammatory cytokine expression in PBMCs isolated from both healthy donors and RR-MS patients. Importantly, this effect was exacerbated in RR-MS patient immune cells. We present further evidence that baclofen dose-dependently attenuated TLR3- and TLR4-induced inflammatory signaling in primary glial cells. Pre-exposure of PBMCs isolated from healthy donors to baclofen attenuated TLR4-induced TNF-α expression, but did not affect TLR4-induced TNF-α expression in RR-MS patient PBMCs. Interestingly, mRNA expression of the GABAB receptor was reduced in PBMCs from RR-MS donors when compared to healthy controls, an effect that might contribute to the differential sensitivity to baclofen seen in healthy and RR-MS patient cells. Overall these findings indicate that baclofen differentially regulates TLR3 and TLR4 signaling in glia and immune cells, and offers insight on the role of baclofen in the treatment of neuroinflammatory disease states including MS.
- 230Li, X.; Li, T. T.; Zhang, X. H.; Hou, L. F.; Yang, X. Q.; Zhu, F. H.; Tang, W.; Zuo, J. P. Artemisinin Analogue SM934 Ameliorates Murine Experimental Autoimmune Encephalomyelitis through Enhancing the Expansion and Functions of Regulatory T Cell. PLoS One 2013, 8 (8), e74108, DOI: 10.1371/journal.pone.0074108[Crossref], [PubMed], [CAS], Google Scholar230https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXhsVWht73O&md5=282a41e6d6b1eb459bd0890a327155e7Artemisinin analogue SM934 ameliorates murine experimental autoimmune encephalomyelitis through enhancing the expansion and functions of regulatory T cellLi, Xin; Li, Tian-Tian; Zhang, Xiao-Hui; Hou, Li-Fei; Yang, Xiao-Qian; Zhu, Feng-Hua; Tang, Wei; Zuo, Jian-PingPLoS One (2013), 8 (8), e74108CODEN: POLNCL; ISSN:1932-6203. (Public Library of Science)Background: Artemisinin analog SM934 was previously reported to possess immunosuppressive properties. The aim of this study was to det. the effects and the underlying mechanisms of SM934 in murine exptl. autoimmune encephalomyelitis (EAE). Methods: Female C57BL/6 mice immunized with MOG35-55 were treated with or without SM934, then the clin. scores and other relevant parameters were assessed. Th1, Th17 and regulatory T (Treg) cell profiles were detd. through ELISA, qRT-PCR, flow cytometry and BrdU incorporation assay. The effects of SM934 on Th1, Th17 and Treg cells differentiation were explored through intracellular staining and flow cytometry examn. Results: In vivo, administration of SM934 significantly inhibited the development of EAE and suppressed the elevation of serum IL-17. Ex vivo, upon antigen-recall stimulation, IL-2, IFN-γ, IL-17 and IL-6 prodn. were decreased, whereas IL-10 and TGF-β prodn. were increased from the splenocytes isolated from SM934-treated mice. Consistently, both flow cytometry and qRT-PCR results showed that SM934 treatment significantly increased the Treg, while strongly suppressed the Th17 and Th1, responses in the peripheral. Furthermore, in the spinal lesion, SM934 treatment dramatically decreased the infiltration of CD4+ T cells, within which the Treg cells percentage was enlarged, whereas the Th17, but not Th1 percentage, was significantly decreased comparing with the vehicle-treated groups. Finally, both BrdU incorporation and in vitro Treg differentiation assays revealed that SM934 treatment could directly promote the expansion of Treg cells in vivo and in vitro. Conclusion: Taken together, this study demonstrated that SM934 treatment could ameliorate the murine EAE disease, which might be mediated by inducing Treg differentiation and expansion.
- 231Angelotti, F.; Parma, A.; Cafaro, G.; Capecchi, R.; Alunno, A.; Puxeddu, I. One Year in Review 2017: Pathogenesis of Rheumatoid Arthritis. Clin. Exp. Rheumatol. 2017, 35 (3), 368– 378[PubMed], [CAS], Google Scholar231https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC1cnpvFOmuw%253D%253D&md5=1884205970f8d572625264816ed3298bOne year in review 2017: pathogenesis of rheumatoid arthritisAngelotti Francesca; Capecchi Riccardo; Puxeddu Ilaria; Parma Alice; Cafaro Giacomo; Alunno AlessiaClinical and experimental rheumatology (2017), 35 (3), 368-378 ISSN:0392-856X.Rheumatoid arthritis (RA) is a chronic inflammatory autoimmune disease influenced by both genetic and environmental factors. It has been postulated that a high-risk genetic background, in combination with epigenetic marks and environmental exposures, leads to a cascade of events inducing synovitis and consequent destructive arthritis. The clinical picture of joint involvement in RA is the result of chronic inflammation of the synovium, characterised by interactions of resident cells such as fibroblast-like synoviocytes (FLS) with cells of the innate (e.g. macrophages, dendritic cells, mast cells and NK cells, neutrophils) and adaptive immune system (e.g. B and T lymphocytes). Currently, our understanding of the role of innate and adaptive immunity in the pathogenesis of RA is expanding. The concept of how immune responses contribute to the disease has dramatically evolved over the last 50 years. Shedding some light on the different aspects of RA pathogenesis will help to identify new targets for the development of disease-modifying therapies. Thus, in this review we report new insights in RA pathogenesis, resulting from a literature research date published in the last year.
- 232McInnes, I. B.; Schett, G. The Pathogenesis of Rheumatoid Arthritis. N. Engl. J. Med. 2011, 365 (23), 2205– 2219, DOI: 10.1056/NEJMra1004965[Crossref], [PubMed], [CAS], Google Scholar232https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3MXhs1ajsrrM&md5=31a79ccb05bca03f207b15f934b2d52dThe pathogenesis of rheumatoid arthritisMcInnes, Lain B.; Schett, GeorgNew England Journal of Medicine (2011), 365 (23), 2205-2219CODEN: NEJMAG; ISSN:0028-4793. (Massachusetts Medical Society)A review discusses key pathogenic advances in rheumatoid arthritis, genetics, environmental factors, immunol. processes, inflammation, and structural damage.
- 233Seibl, R.; Birchler, T.; Loeliger, S.; Hossle, J. P.; Gay, R. E.; Saurenmann, T.; Michel, B. A.; Seger, R. A.; Gay, S.; Lauener, R. P. Expression and Regulation of Toll-like Receptor 2 in Rheumatoid Arthritis Synovium. Am. J. Pathol. 2003, 162 (4), 1221– 1227, DOI: 10.1016/S0002-9440(10)63918-1[Crossref], [PubMed], [CAS], Google Scholar233https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD3sXjtVemtLY%253D&md5=998706b53f46d7d61408b3712edc9456Expression and regulation of Toll-like receptor 2 in rheumatoid arthritis synoviumSeibl, Reinhart; Birchler, Thomas; Loeliger, Susanne; Hossle, Johann Peter; Gay, Renate E.; Saurenmann, Traudl; Michel, Beat A.; Seger, Reinhard A.; Gay, Steffen; Lauener, Roger P.American Journal of Pathology (2003), 162 (4), 1221-1227CODEN: AJPAA4; ISSN:0002-9440. (American Society for Investigative Pathology)Toll-like receptors (TLRs) are involved in mediating cell activation on stimulation with microbial constituents. The authors investigated the role for TLRs in synovial fibroblast (SF) activation in rheumatoid arthritis (RA). The authors analyzed whether stimulation with interleukin-1β and tumor necrosis factor-α, cytokines present in RA synovium, influences expression of TLR genes in SFs. The effects were compared with those of treatment with lipopolysaccharide and a synthetic lipopeptide (sBLP). Gene expression was examd. using quant. polymerase chain reaction. TLR2-mediated cell activation was investigated by electromobility shift assay for nuclear factor-.vkappa.B. To localize TLR2 expression in joint tissue sections of RA patients were stained using in situ hybridization. Expression of TLR2 in RA SFs was increased after treatment with interleukin-1β, tumor necrosis factor-α, lipopolysaccharide, and sBLP. Nuclear factor-.vkappa.B translocation in SFs was triggered by TLR2-mediated cell stimulation. Synovial tissues from RA joints expressed TLR2 predominantly at sites of attachment and invasion into cartilage and bone. The obsd. elevated expression of TLR2 in RA SFs could be a consequence of direct exposure to microbial compds. or of the presence of inflammatory mediators in the joint. TLR-assocd. signaling pathways may contribute to the pathogenesis of RA, either by initiating or perpetuating activation of SFs.
- 234Huang, Q. Q.; Ma, Y.; Adebayo, A.; Pope, R. M. Increased Macrophage Activation Mediated through Toll-like Receptors in Rheumatoid Arthritis. Arthritis Rheum. 2007, 56 (7), 2192– 2201, DOI: 10.1002/art.22707[Crossref], [PubMed], [CAS], Google Scholar234https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2sXovFSgtrk%253D&md5=b77bc498d424d14e73b9a99dd7df0beeIncreased macrophage activation mediated through Toll-like receptors in rheumatoid arthritisHuang, QiQuan; Ma, Yingyu; Adebayo, Adedamola; Pope, Richard M.Arthritis & Rheumatism (2007), 56 (7), 2192-2201CODEN: ARHEAW; ISSN:0004-3591. (John Wiley & Sons, Inc.)Macrophages are the major source of inflammation mediators that are important in the pathogenesis of rheumatoid arthritis (RA). This study was undertaken to analyze macrophages obtained from the joints of RA patients in order to characterize the expression of Toll-like receptor 2 (TLR-2) and TLR-4 and the responses to TLR ligation. Cells were isolated from the synovial fluid (SF) of RA patients or patients with other forms of inflammatory arthritis. Cell surface TLR-2 and TLR-4 expression and intracellular tumor necrosis factor α (TNFα) and interleukin-8 (IL-8) expression by CD14+ macrophages were detd. by flow cytometry. Peptidoglycan (PG) and lipopolysaccharide (LPS) were used as ligands for TLR-2 and TLR-4, resp. The expression of TLR-2 and TLR-4 was increased on CD14+ macrophages from the joints of RA patients compared with that on control in vitro-differentiated macrophages or control peripheral blood monocytes. Neither TLR-2 expression nor TLR-4 expression differed between RA and other forms of inflammatory arthritis. However, PG- and LPS-induced TNFα expression and IL-8 expression were greater with RA SF macrophages than with those obtained from the joints of patients with other forms of inflammatory arthritis or with control macrophages. PG-induced TNFα expression and IL-8 expression were highly correlated with TLR-2 expression in normal macrophages, but not with that in macrophages obtained from joints of RA patients or patients with other forms of inflammatory arthritis. TLR-2 and TLR-4 ligation resulted in increased activation of RA synovial macrophages compared with those from patients with other forms of inflammatory arthritis or compared with control macrophages. Factors other than the level of TLR-2 and TLR-4 expression contributed to the increased activation of RA SF macrophages. These observations support the notion of a potential role for activation through TLR-2 and TLR-4 in the inflammation and joint destruction of RA.
- 235Ospelt, C.; Brentano, F.; Rengel, Y.; Stanczyk, J.; Kolling, C.; Tak, P. P.; Gay, R. E.; Gay, S.; Kyburz, D. Overexpression of Toll-like Receptors 3 and 4 in Synovial Tissue from Patients with Early Rheumatoid Arthritis: Toll-like Receptor Expression in Early and Longstanding Arthritis. Arthritis Rheum. 2008, 58 (12), 3684– 3692, DOI: 10.1002/art.24140[Crossref], [PubMed], [CAS], Google Scholar235https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1MXmt1ymsg%253D%253D&md5=c075b4c3a5fe9241ddcb77a0efc57a1dOverexpression of toll-like receptors 3 and 4 in synovial tissue from patients with early rheumatoid arthritis: toll-like receptor expression in early and longstanding arthritisOspelt, Caroline; Brentano, Fabia; Rengel, Yvonne; Stanczyk, Joanna; Kolling, Christoph; Tak, Paul P.; Gay, Renate E.; Gay, Steffen; Kyburz, DiegoArthritis & Rheumatism (2008), 58 (12), 3684-3692CODEN: ARHEAW; ISSN:0004-3591. (John Wiley & Sons, Inc.)To analyze the expression, regulation, and biol. relevance of Toll-like receptors (TLRs) 1-10 in synovial and skin fibroblasts and to det. the expression levels of TLRs 2, 3, and 4 in synovial tissues from patients with early rheumatoid arthritis (RA), longstanding RA, and osteoarthritis (OA). Expression of TLRs 1-10 in RA synovial fibroblasts (RASFs), OASFs, and skin fibroblasts was analyzed by real-time polymerase chain reaction (PCR). Fibroblasts were stimulated with tumor necrosis factor α, interleukin-1β (IL-1β), bacterial lipopeptide, poly(I-C), lipopolysaccharide, and flagellin. Prodn. of IL-6 was detd. by ELISA and induction of TLRs 2-5, matrix metalloproteinases (MMPs) 3 and 13 mRNA by real-time PCR. Expression of TLRs 2-4 in synovial tissues was analyzed by immunohistochem. Synovial fibroblasts expressed TLRs 1-6, but not TLRs 7-10. Among the expressed TLRs, TLR-3 and TLR-4 were the most abundant in synovial fibroblasts, and stimulation of synovial fibroblasts with the TLR-3 ligand poly(I-C) led to the most pronounced increase in IL-6, MMP-3, and MMP-13. In contrast, skin fibroblasts did not up-regulate MMP-3 or MMP-13 after stimulation with any of the tested stimuli. In synovial tissues from patients with early RA, TLR-3 and TLR-4 were highly expressed and were comparable to the levels of patients with longstanding RA. These expression levels were elevated as compared with those in OA. Our findings of high expression of TLRs, particularly TLRs 3 and 4, at an early stage of RA and the reactivity of synovial fibroblasts in vitro to TLR ligands suggest that TLR signaling pathways resulting in persistent inflammation and joint destruction are activated early in the disease process.
- 236Roelofs, M. F.; Joosten, L. A. B.; Abdollahi-Roodsaz, S.; Van Lieshout, A. W. T.; Sprong, T.; Van Den Hoogen, F. H.; Van Den Berg, W. B.; Radstake, T. R. D. J. The Expression of Toll-like Receptors 3 and 7 in Rheumatoid Arthritis Synovium Is Increased and Costimulation of Toll-like Receptors 3, 4, and 7/8 Results in Synergistic Cytokine Production by Dendritic Cells. Arthritis Rheum. 2005, 52 (8), 2313– 2322, DOI: 10.1002/art.21278[Crossref], [PubMed], [CAS], Google Scholar236https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2MXpslGhtro%253D&md5=77c89e1c04a3e4cffcbccb27c052ec86The expression of Toll-like receptors 3 and 7 in rheumatoid arthritis synovium is increased and costimulation of Toll-like receptors 3, 4 and 7/8 results in synergistic cytokine production by dendritic cellsRoelofs, M. F.; Joosten, L. A. B.; Abdollahi-Roodsaz, S.; van Lieshout, A. W. T.; Sprong, T.; van den Hoogen, F. H.; van den Berg, W. B.; Radstake, T. R. D. J.Arthritis & Rheumatism (2005), 52 (8), 2313-2322CODEN: ARHEAW; ISSN:0004-3591. (John Wiley & Sons, Inc.)Objective. To evaluate the expression of Toll-like receptors (TLRs) 3 and 7 in synovium and to study potential differences in the maturation and cytokine prodn. mediated by TLR-2, TLR-3, TLR-4, and TLR-7/8 by dendritic cells (DCs) from rheumatoid arthritis (RA) patients and DCs from healthy controls. Methods. Synovial expression of TLR-3 and TLR-7 in RA was studied using immunohistochem. Monocyte-derived DCs from RA patients and healthy controls were cultured for 6 days and subsequently stimulated for 48 h via TLR-mediated pathways (lipoteichoic acid, Pam3Cys, and fibroblast-stimulating lipopeptide 1 for TLR-2, poly[I-C] for TLR-3, lipopolysaccharide and extra domain A for TLR-4, and R848 for TLR-7/8). Phenotypic DC maturation was measured using flow cytometry. The secretion of tumor necrosis factor α (TNFα), interleukin-6 (IL-6), IL-10, and IL-12 was measured using the Bio-Plex system. Cell lines expressing TLR-2 and TLR-4 were used for the detection of TLR-2 and TLR-4 ligands in serum and synovial fluid from RA patients. Results. TLR-3 and TLR-7 were highly expressed in RA synovium. All TLR ligands elicited phenotypic DC maturation equally between DCs from RA patients and those from healthy controls. TLR-2- and TLR-4-mediated stimulation of DCs from RA patients resulted in markedly higher prodn. of inflammatory mediators (TNFα and IL-6) compared with DCs from healthy controls. In contrast, upon stimulation of TLR-3 and TLR-7/8, the level of cytokine prodn. was equal between DCs from RA patients and those from healthy controls. Remarkably, both TLR-3 and TLR-7/8 stimulation resulted in a skewed balance toward IL-12. Intriguingly, the combined stimulation of TLR-4 and TLR-3-7/8 resulted in a marked synergy with respect to the prodn. of inflammatory mediators. As a proof of concept, TLR-4 ligands were increased in the serum and synovial fluid of RA patients. Conclusion. TLRs are involved in the regulation of DC activation and cytokine prodn. The authors hypothesize that various TLR ligands in the joint trigger multiple TLRs simultaneously, favoring the breakthrough of tolerance in RA.
- 237Hayashi, T.; Gray, C. S.; Chan, M.; Tawatao, R. I.; Ronacher, L.; McGargill, M. A.; Datta, S. K.; Carson, D. A.; Corr, M. Prevention of Autoimmune Disease by Induction of Tolerance to Toll-like Receptor 7. Proc. Natl. Acad. Sci. U. S. A. 2009, 106 (8), 2764– 2769, DOI: 10.1073/pnas.0813037106[Crossref], [PubMed], [CAS], Google Scholar237https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1MXislahtrg%253D&md5=eb595d350e90fc374113c0c1e13d2a89Prevention of autoimmune disease by induction of tolerance to Toll-like receptor 7Hayashi, Tomoko; Gray, Christine S.; Chan, Michael; Tawatao, Rommel I.; Ronacher, Lisa; McGargill, Maureen A.; Datta, Sandip K.; Carson, Dennis A.; Corr, MaripatProceedings of the National Academy of Sciences of the United States of America (2009), 106 (8), 2764-2769CODEN: PNASA6; ISSN:0027-8424. (National Academy of Sciences)Activation of Toll-like receptors (TLR) contributes to the initiation and maintenance of chronic inflammation in autoimmune diseases, yet repeated exposure to a TLR agonist can induce hyporesponsiveness to subsequent TLR stimulation. Here, the authors used a synthetic TLR7 agonist, 9-benzyl-8-hydroxy-2-(2-methoxyethoxy) adenine (SM360320, 1V136) to study TLR7 induced attenuation of inflammatory responses and its application to autoimmune diseases. Repeated low dose administration of this TLR7 agonist induced hyporesponsiveness or tolerance to TLR2, -7, and -9 activators and limited the course of neural inflammation in an exptl. allergic encephalomyelitis model. The hyporesponsiveness did not depend on T or B lymphocytes, but did require bone marrow derived cells. In addn., TLR7 tolerance reduced inflammation in a passive antibody mediated arthritis model. TLR7 tolerance did not cause global immunosuppression, because susceptibility to Listeria monocytogenes infection was not altered. The mechanism of TLR7 tolerance involved the up-regulation of 2 inhibitors of TLR signaling: interleukin 1 receptor assocd. kinase (IRAK) M, and Src homol. 2 domain-contg. inositol polyphosphate phosphatase (SHIP)-1. These findings suggest that induction of TLR7 tolerance might be a new therapeutic approach to subdue inflammation in autoimmune diseases.
- 238Sacre, S. M.; Lo, A.; Gregory, B.; Simmonds, R. E.; Williams, L.; Feldmann, M.; Brennan, F. M.; Foxwell, B. M. Inhibitors of TLR8 Reduce TNF Production from Human Rheumatoid Synovial Membrane Cultures. J. Immunol. 2008, 181 (11), 8002– 8009, DOI: 10.4049/jimmunol.181.11.8002[Crossref], [PubMed], [CAS], Google Scholar238https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1cXhtl2gsLzF&md5=216674863649d4b20a20caa8d46b1206Inhibitors of TLR8 Reduce TNF Production from Human Rheumatoid Synovial Membrane CulturesSacre, Sandra M.; Lo, Alexandra; Gregory, Bernard; Simmonds, Rachel E.; Williams, Lynn; Feldmann, Marc; Brennan, Fionula M.; Foxwell, Brian M.Journal of Immunology (2008), 181 (11), 8002-8009CODEN: JOIMA3; ISSN:0022-1767. (American Association of Immunologists)The advent of anti-TNF biologicals has been a seminal advance in the treatment of rheumatoid arthritis (RA) and has confirmed the important role of TNF in disease pathogenesis. However, it is unknown what sustains the chronic prodn. of TNF. In this study, we have investigated the anti-inflammatory properties of mianserin, a serotonin receptor antagonist. We discovered mianserin was able to inhibit the endosomal TLRs 3, 7, 8, and 9 in primary human cells and inhibited the spontaneous release of TNF and IL-6 from RA synovial membrane cultures. This suggested a role for these TLRs in prodn. of TNF and IL-6 from RA which was supported by data from chloroquine, an inhibitor of endosomal acidification (a prerequisite for TLRs 3, 7, 8, and 9 activation) which also inhibited prodn. of these cytokines from RA synovial cultures. Only stimulation of TLR 3 or 8 induced TNF from these cultures, indicating that TLR7 and TLR9 were of less consequence in this model. The key observation that indicated the importance of TLR8 was the inhibition of spontaneous TNF prodn. by imiquimod, which we discovered to be an inhibitor of TLR8. Together, these data suggest that TLR8 may play a role in driving TNF prodn. in RA. Because this receptor can be inhibited by small m.w. mols., it may prove to be an important therapeutic target.
- 239Lacerte, P.; Brunet, A.; Egarnes, B.; Duchêne, B.; Brown, J. P.; Gosselin, J. Overexpression of TLR2 and TLR9 on Monocyte Subsets of Active Rheumatoid Arthritis Patients Contributes to Enhance Responsiveness to TLR Agonists. Arthritis Res. Ther. 2016, 18, 10, DOI: 10.1186/s13075-015-0901-1[Crossref], [PubMed], [CAS], Google Scholar239https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XitVOis7nJ&md5=b7aa7530a2e3f72909cb5edcb52fb798Overexpression of TLR2 and TLR9 on monocyte subsets of active rheumatoid arthritis patients contributes to enhance responsiveness to TLR agonistsLacerte, Patricia; Brunet, Alexandre; Egarnes, Benoit; Duchene, Benjamin; Brown, Jacques P.; Gosselin, JeanArthritis Research & Therapy (2016), 18 (), 10/1-10/14CODEN: ARTRCV; ISSN:1478-6362. (BioMed Central Ltd.)Background: Synovial infiltration of monocytes is commonly assocd. with inflammation in rheumatoid arthritis (RA). Toll-like receptors (TLRs) are innate sensors that recognize cell debris and microbial components in host, a process contributing to maintain chronic inflammation in RA. We assessed the expression levels of TLR2 and TLR9 in monocyte subsets of active RA patients and characterized their cytokine profiles in response to synthetic and viral TLR2 and TLR9 agonists, including Epstein-Barr virus (EBV) which is suspected to contribute to RA symptoms. Methods: Prevalence of monocyte subsets CD14 CD16 , CD14 CD16 and CD14low CD16 was evaluated in blood and synovial fluids of active RA patients and levels of TLR2 and TLR9 in monocyte subsets were measured by flow cytometry. Enriched monocytes derived from RA patients and healthy donors were stimulated in vitro with synthetic TLR2 and TLR9 agonists and with EBV particles or viral DNA. Intracellular cytokine profiles were detd. in resp. monocyte subsets. Finally, the presence of EBV genome was evaluated by real-time PCR in blood and synovial monocytes of RA patients. Results: Nos. of CD14 CD16 and CD14low CD16 were found to increase in blood of RA patients compared to healthy controls, while all three subsets were detected in synovial fluids. TLR2 is abundantly expressed on blood and synovial CD14 CD16 and CD14 CD16 monocytes from RA patients. Levels of TLR9 were increased on all three subsets of blood monocytes but markedly enhanced in monocytes isolated from synovial fluids. Compared to healthy controls, CD14 CD16 monocytes of RA patients displayed an enlarged capacity to produce proinflammatory cytokines after stimulation with synthetic TLR2 and TLR9 agonists while both CD14 CD16 and CD14 CD16 monocytes showed increased response to EBV stimulation. The presence of EBV genome was also detected in monocytes and neutrophils of a significant proportion of patients. Conclusion: Patients with active RA show an increased expression of TLR2 and TLR9 on monocyte subsets and display higher prodn. of inflammatory cytokines in response to TLR agonists. The presence of EBV genome in monocytes and neutrophils reinforces the suspected role of the virus in the exacerbation of RA symptoms.
- 240Nic An Ultaigh, S.; Saber, T. P.; McCormick, J.; Connolly, M.; Dellacasagrande, J.; Keogh, B.; McCormack, W.; Reilly, M.; O’Neill, L. A.; McGuirk, P.; Fearon, U.; Veale, D. J. Blockade of Toll-like Receptor 2 Prevents Spontaneous Cytokine Release from Rheumatoid Arthritis Ex Vivo Synovial Explant Cultures. Arthritis Res. Ther. 2011, 13, R33, DOI: 10.1186/ar3261
- 241Monnet, E.; Choy, E. H.; McInnes, I.; Kobakhidze, T.; De Graaf, K.; Jacqmin, P.; Lapeyre, G.; De Min, C. Efficacy and Safety of NI-0101, an Anti-Toll-like Receptor 4 Monoclonal Antibody, in Patients with Rheumatoid Arthritis after Inadequate Response to Methotrexate: A Phase II Study. Ann. Rheum. Dis. 2020, 79, 316– 323, DOI: 10.1136/annrheumdis-2019-216487[Crossref], [PubMed], [CAS], Google Scholar241https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXhslGgsb%252FM&md5=3c6f20c3b076daa62889b6b7e26705c6Efficacy and safety of NI-0101, an anti-toll-like receptor 4 monoclonal antibody, in patients with rheumatoid arthritis after inadequate response to methotrexate: a phase II studyMonnet, Emmanuel; Choy, Ernest H.; Mcinnes, Iain; Kobakhidze, Tamta; de Graaf, Kathy; Jacqmin, Philippe; Lapeyre, Genevieve; de Min, CristinaAnnals of the Rheumatic Diseases (2020), 79 (3), 316-323CODEN: ARDIAO; ISSN:0003-4967. (BMJ)Anti-citrullinated protein antibodies (ACPAs) form immune complexes with citrullinated proteins binding toll-like receptor (TLR) 4, which has been proposed as a mediator of rheumatoid arthritis (RA). NI-0101 is a first-in-class humanised monoclonal antibody blocking TLR4, as confirmed by inhibition of in vivo lipopolysaccharide-induced cytokine release in healthy volunteers. This study was design to confirm preclin. investigations supporting a biomarker-driven approach for treatment of patients with RA who present pos. for these immune complexes. Methods Placebo-controlled, double-blind, randomised (2:1) trial of the tolerability and efficacy of NI-0101 (5mg/kg, every 2 wk for 12 wk) vs. placebo in ACPA-pos. RA patients with inadequate response to methotrexate. Efficacy measures included Disease Activity Score (28-joint count) with C reactive protein (DAS28-CRP), European League Against Rheumatism (EULAR) good and moderate responses, and American College of Rheumatol. (ACR) 20, ACR50 and ACR70 responses. Subgroup analyses defined on biomarkers were conducted. Pharmacokinetics, pharmacodynamics and safety were reported. Results 90 patients were randomised (NI-0101 (61) and placebo (29)); 86 completed the study. No significant between-group difference was obsd. for any of the efficacy endpoints. Subgroup analyses using baseline parameters as covariants did not reveal any population responding to NI-0101. Treatment-emergent adverse events occurred in 51.7% of patients who received placebo vs. 52.5% for NI-0101. Conclusions We demonstrate for the first time that in RA, a human immune-mediated inflammatory disease, blocking the TLR4 pathway alone does not improve disease parameters. Successful targeting of innate immune pathways in RA may require broader and/or earlier inhibitory approaches.
- 242Monnet, E.; Shang, L.; Lapeyre, G.; DeGraaf, K.; Hatterer, E.; Buatois, V.; Elson, G.; Ferlin, W.; Gabay, C.; Sokolove, J.; Jones, S. A.; Choy, E. H.; McInnes, I. B.; Kosco-Vilbois, M.; de Min, C. AB0451 NI-0101, a Monoclonal Antibody Targeting Toll Like Receptor 4 (TLR4) Being Developed for Rheumatoid Arthritis (RA) Treatment with a Potential for Personalized Medicine. Ann. Rheum. Dis. 2015, 74, 1046, DOI: 10.1136/annrheumdis-2015-eular.3801
- 243Park, S. J.; Lee, A. N.; Youn, H. S. TBK1-Targeted Suppression of TRIF-Dependent Signaling Pathway of Toll-like Receptor 3 by Auranofin. Arch. Pharmacal Res. 2010, 33 (6), 939– 945, DOI: 10.1007/s12272-010-0618-2[Crossref], [PubMed], [CAS], Google Scholar243https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3cXosVWks7Y%253D&md5=e117c172b506aa93dd79bb69e3bf2838TBK1-targeted suppression of TRIF-dependent signaling pathway of toll-like receptor 3 by auranofinPark, Se-Jeong; Lee, A-Neum; Youn, Hyung-SunArchives of Pharmacal Research (2010), 33 (6), 939-945CODEN: APHRDQ; ISSN:0253-6269. (Pharmaceutical Society of Korea)Toll-like receptors (TLRs) play an important role in induction of innate immune responses. The stimulation of TLRs by microbial components triggers two branches of downstream signaling pathways: myeloid differential factor 88 (MyD88)- and toll-interleukin-1 receptor domain-contg. adapter inducing interferon-β (TRIF)-dependent signaling pathways. Auranofin, a sulfur-contg. gold compd. (Au[I]), has been widely used for the treatment of rheumatoid arthritis. Since dysregulation of TLRs can lead to severe systemic inflammatory and joint destructive process in rheumatoid arthritis, auranofin-mediated modulation of TLR activation may have therapeutic potential against such diseases. Previously, we demonstrated that auranofin suppressed TLR4 signaling pathway by inhibiting TLR4 dimerization induced by LPS. Here, we examd. the effect of auranofin on signal transduction via the TRIF-dependent pathway induced by a TLR3 agonist. Auranofin inhibited nuclear factor-κB and interferon (IFN) regulatory factor 3 (IRF3) activation induced by polyinosinic-polycytidylic acid (poly[I:C]). Auranofin inhibited poly[I:C]-induced phosphorylation of IRF3 as well as IFN-inducible genes such as IFN inducible protein-10. Furthermore, auranofin inhibited TBK1 kinase activity in vitro. All the results suggest that auranofin suppress TLR signaling at multiple steps.
- 244Hultqvist, M.; Nandakumar, K. S.; Björklund, U.; Holmdahl, R. Rabeximod Reduces Arthritis Severity in Mice by Decreasing Activation of Inflammatory Cells. Ann. Rheum. Dis. 2010, 69 (8), 1527– 1532, DOI: 10.1136/ard.2009.121178[Crossref], [PubMed], [CAS], Google Scholar244https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3cXhtVyktL7J&md5=04be5860a67307a3bb4ea98af0df3d92Rabeximod reduces arthritis severity in mice by decreasing activation of inflammatory cellsHultqvist, Malin; Nandakumar, Kutty Selva; Bjoerklund, Ulf; Holmdahl, RikardAnnals of the Rheumatic Diseases (2010), 69 (8), 1527-1532CODEN: ARDIAO; ISSN:0003-4967. (BMJ Publishing Group)Objectives: The novel small mol. 9-chloro-2,3-dimethyl-6-(N,N-dimethylaminoethylamino-2-oxoethyl)-6H-indolo[2,3-b] quinoxaline (Rabeximod) reduces severity of arthritis in rodent models of rheumatoid arthritis (RA) and multiple sclerosis (MS). This study aimed to investigate the cellular target in vivo. Methods: Collagen antibody-induced arthritis (CAIA) is induced by monoclonal collagen type II antibodies and enhanced by lipopolysaccharide. It was investigated how and when Rabeximod operates on inflammatory cells after stimulation of either Toll-like receptor (TLR)4 (lipopolysaccharide) or TLR2 (lipomannan) in mice lacking functional signalling through TLR4 due to a spontaneous deletion of the Tlr4 gene. Results: Rabeximod efficiently prevented arthritis during the time window when TLR2 or TLR4 ligands activate inflammatory macrophages. The effect operated downstream of TLR activation as Rabeximod was highly therapeutic in CAIA enhanced through TLR2 stimuli in TLR4 deficient mice. In addn., it was found that the arthritis ameliorating effect of Rabeximod was time dependent, since inhibition of tumor necrosis factor α prodn. from macrophages in vitro was more-pronounced if administered close to stimulation. Conclusions: Rabeximod suppresses arthritis by preventing activation of inflammatory cells, most likely macrophages, in a time dependent fashion, downstream of TLR2 and TLR4 stimulation.
- 245Samarpita, S.; Kim, J. Y.; Rasool, M. K.; Kim, K. S. Investigation of Toll-like Receptor (TLR) 4 Inhibitor TAK-242 as a New Potential Anti-Rheumatoid Arthritis Drug. Arthritis Res. Ther. 2020, 22, 16, DOI: 10.1186/s13075-020-2097-2[Crossref], [PubMed], [CAS], Google Scholar245https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXkvVGhsL4%253D&md5=448f59784a2d776c09aba7f339319496Investigation of toll-like receptor (TLR) 4 inhibitor TAK-242 as a new potential anti-rheumatoid arthritis drugSamarpita, Snigdha; Kim, Joo Young; Rasool, Mahaboob Khan; Kim, Kyoung SooArthritis Research & Therapy (2020), 22 (1), 16CODEN: ARTRCV; ISSN:1478-6362. (BioMed Central Ltd.)Abstr.: Background: Proper blocking of toll-like receptor (TLR) activation during disease progression has been reported to have inhibitory effect on the pathogenesis of rheumatoid arthritis (RA). We tested whether the TLR4 inhibitor TAK-242 had potential as a remedy for rheumatoid arthritis. Methods: The therapeutic effect of TAK-242 was tested in vitro using the human rheumatoid fibroblast-like synoviocyte (FLS) line MH7A or primary human FLS and in an adjuvant-induced arthritis (AIA) rat model. Results: TAK-242 dose dependently inhibited the increased expression of IL-6, IL-8, MMP-1, and VEGF in LPS-stimulated MH7A cells. It also inhibited the expression of IL-6 and IL-8 in poly(I:C), TLR3 activator-stimulated primary FLS, but not in IL-1β-stimulated primary FLS. These findings suggest that TAK-242 blocks a specific signaling pathway to some degree. Further, TAK-242 slightly inhibited mobilization of NF-κB into nuclei. In the AIA rat model, TAK-242 significantly reversed the body wt. and paw thickness of AIA rats to the normal state at a dose of 5 mg/kg, but not at 3 mg/kg, and reduced the increased serum level of IL-6 and VEGF in AIA rats. It also significantly ameliorated inflammatory symptoms of joint tissues at day 21 of treatment, according to histol. and RT-PCR. Conclusions: Based on the drug repositioning concept, TAK-242, which is used for the treatment of TLR4-mediated inflammatory diseases, shows potential for cost-effective development as a remedy for rheumatoid arthritis or to control the progression of RA.
- 246Danto, S. I.; Shojaee, N.; Singh, R. S. P.; Li, C.; Gilbert, S. A.; Manukyan, Z.; Kilty, I. Safety, Tolerability, Pharmacokinetics, and Pharmacodynamics of PF-06650833, a Selective Interleukin-1 Receptor-Associated Kinase 4 (IRAK4) Inhibitor, in Single and Multiple Ascending Dose Randomized Phase 1 Studies in Healthy Subjects. Arthritis Res. Ther. 2019, 21, 269, DOI: 10.1186/s13075-019-2008-6[Crossref], [PubMed], [CAS], Google Scholar246https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXitl2ltrzP&md5=599d00ecb52c094cea8e8322fd957f98Safety, tolerability, pharmacokinetics, and pharmacodynamics of PF-06650833, a selective interleukin-1 receptor-associated kinase 4 (IRAK4) inhibitor, in single and multiple ascending dose randomized phase 1 studies in healthy subjectsDanto, Spencer I.; Shojaee, Negin; Singh, Ravi Shankar P.; Li, Cheryl; Gilbert, Steven A.; Manukyan, Zorayr; Kilty, IainArthritis Research & Therapy (2019), 21 (1), 269CODEN: ARTRCV; ISSN:1478-6362. (BioMed Central Ltd.)Background: PF-06650833 is a potent, selective inhibitor of interleukin-1 receptor-assocd. kinase 4 (IRAK4). Two randomized, double-blind, sponsor-open phase 1 studies evaluated the safety, pharmacokinetics, and pharmacodynamics of single (SAD) and multiple ascending doses (MAD) of PF-06650833 immediate-release (IR) and modified-release (MR) oral formulations in healthy adult subjects. Methods: Study 1 (NCT02224651) was a 96-day, placebo-substitution, SAD study of once-daily (QD) oral PF-06650833 IR 1 to 6000 mg and MR 30 to 300 mg in fasted and fed states. Study 2 (NCT02485769) was a 14-day, placebo-controlled, MAD study of PF-06650833 IR 25 to 750 mg twice daily, IR 1000 mg four times per day, IR 330 mg three times per day, and MR 300 mg QD. Results: PF-06650833 was generally well tolerated, with no dose-limiting treatment-emergent adverse events (TEAEs) identified in either study. TEAEs were generally mild in severity, with headache, gastrointestinal disorders, and acne most commonly reported. No serious AEs or deaths were reported. A max. tolerated dose was not established in either study. In the SAD study, food intake delayed absorption of IR 30 mg and increased total exposure by 33%. Delayed absorption was achieved with the MR formulation (Tmax of 1 h vs. 8 h for IR 100 mg and MR 100 mg formulations, resp.). Food had no effect on total exposure for MR 30 mg, but reduced half-life 1.8-fold and increased Cmax by 62%. In the MAD study, accumulation ranged from 0.9-fold to 1.4-fold for AUCtau and 0.9-fold to 1.3-fold for Cmax. Less than 1% of the dose was recovered unchanged in urine for all dose groups, with renal clearance ranging from 14 to 23 mL/min for IR < 750 mg and MR 300 mg. There was a sustained decrease in serum high-sensitivity C-reactive protein for IR ≥ 250 mg and MR 300 mg. Based on the cholesterol/hydroxycholesterol ratio, no apparent CYP3A induction or inhibition was obsd. Conclusions: PF-06650833, the first IRAK4 inhibitor to enter clin. development, has a favorable safety and pharmacokinetic profile and has shown evidence of pharmacol. effect. The data support continued evaluation in human clin. trials for the treatment of rheumatic and autoimmune diseases. Trial registration: Clinicaltrials.gov, NCT02224651, registered 25 August 2014; NCT02485769, registered 30 June 2015.
- 247Zhang, S.; Hu, Z.; Tanji, H.; Jiang, S.; Das, N.; Li, J.; Sakaniwa, K.; Jin, J.; Bian, Y.; Ohto, U.; Shimizu, T.; Yin, H. Small-Molecule Inhibition of TLR8 through Stabilization of Its Resting State. Nat. Chem. Biol. 2018, 14 (1), 58– 64, DOI: 10.1038/nchembio.2518[Crossref], [PubMed], [CAS], Google Scholar247https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXhvVaksrjN&md5=1b43da16d6670324d77bb5e2c417cfe6Small-molecule inhibition of TLR8 through stabilization of its resting stateZhang, Shuting; Hu, Zhenyi; Tanji, Hiromi; Jiang, Shuangshuang; Das, Nabanita; Li, Jing; Sakaniwa, Kentaro; Jin, Jin; Bian, Yanyan; Ohto, Umeharu; Shimizu, Toshiyuki; Yin, HangNature Chemical Biology (2018), 14 (1), 58-64CODEN: NCBABT; ISSN:1552-4450. (Nature Research)Endosomal Toll-like receptors (TLR3, TLR7, TLR8, and TLR9) are highly analogous sensors for various viral or bacterial RNA and DNA mol. patterns. Nonetheless, few small mols. can selectively modulate these TLRs. In this manuscript, we identified the first human TLR8-specific small-mol. antagonists via a novel inhibition mechanism. Crystal structures of two distinct TLR8-ligand complexes validated a unique binding site on the protein-protein interface of the TLR8 homodimer. Upon binding to this new site, the small-mol. ligands stabilize the preformed TLR8 dimer in its resting state, preventing activation. As a proof of concept of their therapeutic potential, we have demonstrated that these drug-like inhibitors are able to suppress TLR8-mediated proinflammatory signaling in various cell lines, human primary cells, and patient specimens. These results not only suggest a novel strategy for TLR inhibitor design, but also shed crit. mechanistic insight into these clin. important immune receptors.
- 248Schrezenmeier, E.; Dörner, T. Mechanisms of Action of Hydroxychloroquine and Chloroquine: Implications for Rheumatology. Nat. Rev. Rheumatol. 2020, 16 (3), 155– 166, DOI: 10.1038/s41584-020-0372-x[Crossref], [PubMed], [CAS], Google Scholar248https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXjs12lt7o%253D&md5=ff48f9141342d1007f5a633ba01f0c51Mechanisms of action of hydroxychloroquine and chloroquine: implications for rheumatologySchrezenmeier, Eva; Doerner, ThomasNature Reviews Rheumatology (2020), 16 (3), 155-166CODEN: NRRACB; ISSN:1759-4790. (Nature Research)A review. Abstr.: Despite widespread clin. use of antimalarial drugs such as hydroxychloroquine and chloroquine in the treatment of rheumatoid arthritis (RA), systemic lupus erythematosus (SLE) and other inflammatory rheumatic diseases, insights into the mechanism of action of these drugs are still emerging. Hydroxychloroquine and chloroquine are weak bases and have a characteristic 'deep' vol. of distribution and a half-life of around 50 days. These modes of action, together with the drug's chem. properties, might explain the clin. efficacy and well-known adverse effects (such as retinopathy) of these drugs. The unknown dose-response relationships of these drugs and the lack of definitions of the min. dose needed for clin. efficacy and what doses are toxic pose challenges to clin. practice. Further challenges include patient non-adherence and possible context-dependent variations in blood drug levels. Available mechanistic data give insights into the immunomodulatory potency of hydroxychloroquine and provide the rationale to search for more potent and/or selective inhibitors.
- 249Crispín, J. C.; Liossis, S. N. C.; Kis-Toth, K.; Lieberman, L. A.; Kyttaris, V. C.; Juang, Y. T.; Tsokos, G. C. Pathogenesis of Human Systemic Lupus Erythematosus: Recent Advances. Trends Mol. Med. 2010, 16 (2), 47– 57, DOI: 10.1016/j.molmed.2009.12.005[Crossref], [PubMed], [CAS], Google Scholar249https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3cXitVKgsbg%253D&md5=fc33acf6d94ca93ecd6181d71a71dd13Pathogenesis of human systemic lupus erythematosus: recent advancesCrispin, Jose C.; Liossis, Stamatis-Nick C.; Kis-Toth, Katalin; Lieberman, Linda A.; Kyttaris, Vasileios C.; Juang, Yuang-Taung; Tsokos, George C.Trends in Molecular Medicine (2010), 16 (2), 47-57CODEN: TMMRCY; ISSN:1471-4914. (Elsevier B.V.)A review. Systemic lupus erythematosus (SLE) is an autoimmune disease with manifestations derived from the involvement of multiple organs including the kidneys, joints, nervous system and hematopoietic organs. Immune system aberrations, as well as heritable, hormonal and environmental factors interplay in the expression of organ damage. Recent contributions from different fields have developed our understanding of SLE and reshaped current pathogenic models. Here, we review recent findings that deal with (i) genes assocd. with disease expression; (ii) immune cell mol. abnormalities that lead to autoimmune pathol.; (iii) the role of hormones and sex chromosomes in the development of disease; and (iv) environmental and epigenetic factors thought to contribute to the expression of SLE. Finally, we highlight mol. defects intimately assocd. with the disease process of SLE that might represent ideal therapeutic targets and disease biomarkers.
- 250Berden, J. H. M. Lupus Nephritis. Kidney Int. 1997, 52 (2), 538– 558, DOI: 10.1038/ki.1997.365[Crossref], [PubMed], [CAS], Google Scholar250https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADyaK2svgvFKmsQ%253D%253D&md5=96cf334679e4ef09dd4622ed92bf7ea3Lupus nephritisBerden J HKidney international (1997), 52 (2), 538-58 ISSN:0085-2538.There is no expanded citation for this reference.
- 251Kruse, K.; Janko, C.; Urbonaviciute, V.; Mierke, C. T.; Winkler, T. H.; Voll, R. E.; Schett, G.; Muñoz, L. E.; Herrmann, M. Inefficient Clearance of Dying Cells in Patients with SLE: Anti-DsDNA Autoantibodies, MFG-E8, HMGB-1 and Other Players. Apoptosis 2010, 15 (9), 1098– 1113, DOI: 10.1007/s10495-010-0478-8[Crossref], [PubMed], [CAS], Google Scholar251https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3cXhtVyrurfK&md5=655157e3ce81245332a1d35304f1a17eInefficient clearance of dying cells in patients with SLE: anti-dsDNA autoantibodies, MFG-E8, HMGB-1 and other playersKruse, Kristin; Janko, Christina; Urbonaviciute, Vilma; Mierke, Claudia T.; Winkler, Thomas H.; Voll, Reinhard E.; Schett, Georg; Munoz, Luis E.; Herrmann, MartinApoptosis (2010), 15 (9), 1098-1113CODEN: APOPFN; ISSN:1360-8185. (Springer)A review. Systemic lupus erythematosus (SLE) is a complex disease resulting from inflammatory responses of the immune system against several autoantigens. Inflammation is conditioned by the continuous presence of autoantibodies and leaked autoantigens, e.g. from not properly cleared dying and dead cells. Various sol. mols. and biophys. properties of the surface of apoptotic cells play significant roles in the appropriate recognition and further processing of dying and dead cells. We exemplarily discuss how Milk fat globule epidermal growth factor 8 (MFG-E8), biophys. membrane alterations, High mobility group box 1 (HMGB1), C-reactive protein (CRP), and anti-nuclear autoantibodies may contribute to the etiopathogenesis of the disease. Up to date knowledge about these key elements may provide new insights that lead to the development of new treatment strategies of the disease.
- 252Lartigue, A.; Colliou, N.; Calbo, S.; François, A.; Jacquot, S.; Arnoult, C.; Tron, F.; Gilbert, D.; Musette, P. Critical Role of TLR2 and TLR4 in Autoantibody Production and Glomerulonephritis in Lpr Mutation-Induced Mouse Lupus. J. Immunol. 2009, 183 (10), 6207– 6216, DOI: 10.4049/jimmunol.0803219[Crossref], [PubMed], [CAS], Google Scholar252https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1MXhtlKhsbnM&md5=181eaee137dcdee345ca0592bba70a06Critical Role of TLR2 and TLR4 in Autoantibody Production and Glomerulonephritis in lpr Mutation-Induced Mouse LupusLartigue, Aurelia; Colliou, Natacha; Calbo, Sebastien; Francois, Arnault; Jacquot, Serge; Arnoult, Christophe; Tron, Francois; Gilbert, Daniele; Musette, PhilippeJournal of Immunology (2009), 183 (10), 6207-6216CODEN: JOIMA3; ISSN:0022-1767. (American Association of Immunologists)Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by pathogenic autoantibodies directed against nuclear Ags and immune complex deposits in damaged organs. Environmental factors have been thought to play a role in the onset of the disease. The recognition of these factors is mediated by TLRs, in particular TLR2 and TLR4 which bind pathogen-assocd. mol. patterns of Gram+ and Gram- bacteria, resp. The authors attempted to det. the role of these TLRs in SLE by creating TLR2- or TLR4-deficient C57BL/6lpr/lpr mice. These mice developed a less severe disease and fewer immunol. alterations. Indeed, in C57BL/6lpr/lpr-TLR2 or -TLR4-deficient mice, glomerular IgG deposits and mesangial cell proliferation were dramatically decreased and antinuclear, anti-dsDNA, and anti-cardiolipin autoantibody titers were significantly reduced. However, the response against nucleosome remained unaffected, indicating a role of TLR2 and TLR4 in the prodn. of Abs directed against only certain categories of SLE-related autoantigens. Anal. of B cell phenotype showed a significant redn. of marginal zone B cells, particularly in C57BL/6lpr/lpr-TLR4-deficient mice, suggesting an important role of TLR4 in the sustained activation of these cells likely involved in autoantibody prodn. Interestingly, the lack of TLR4 also affected the prodn. of cytokines involved in the development of lupus disease.
- 253Liu, B.; Yang, Y.; Dai, J.; Medzhitov, R.; Freudenberg, M. A.; Zhang, P. L.; Li, Z. TLR4 Up-Regulation at Protein or Gene Level Is Pathogenic for Lupus-Like Autoimmune Disease. J. Immunol. 2006, 177 (10), 6880– 6888, DOI: 10.4049/jimmunol.177.10.6880[Crossref], [PubMed], [CAS], Google Scholar253https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD28XhtFGrtr3P&md5=61a5b310bb7b26247f0cb419c825ccdbTLR4 Up-Regulation at Protein or Gene Level Is Pathogenic for Lupus-Like Autoimmune DiseaseLiu, Bei; Yang, Yi; Dai, Jie; Medzhitov, Ruslan; Freudenberg, Marina A.; Zhang, Ping L.; Li, ZihaiJournal of Immunology (2006), 177 (10), 6880-6888CODEN: JOIMA3; ISSN:0022-1767. (American Association of Immunologists)TLR4 is the receptor for the Gram-neg. bacterial cell wall component LPS. TLR4 signaling is controlled by both pos. and neg. regulators to balance optimal immune response and potential sepsis. Unchecked TLR4 activation might result in autoimmune diseases, a hypothesis that has not been formally resolved. In this study, we found that TLR4 signaling to LPS can be pos. enforced by expressing gp96 on cell surfaces through the chaperone function of, but not the direct signaling by, gp96; TLR4 as well as the commensal flora are essential for the prodn. of anti-dsDNA Ab and the immune complex-mediated glomerulonephritis in transgenic mice that express surface gp96. Moreover, a similar constellation of autoimmunity was evident in mice that encode multiple copies of tlr4 gene. Our study has revealed that increased TLR4 signaling alone without exogenous insult can break immunol. tolerance. It provides a strong exptl. evidence for TLR4 dysregulation as an etiol. of lupus-like renal disease.
- 254Patole, P. S.; Gröne, H. J.; Segerer, S.; Ciubar, R.; Belemezova, E.; Henger, A.; Kretzler, M.; Schlöndorff, D.; Anders, H. J. Viral Double-Stranded RNA Aggravates Lupus Nephritis through Toll-like Receptor 3 on Glomerular Mesangial Cells and Antigen-Presenting Cells. J. Am. Soc. Nephrol. 2005, 16 (5), 1326– 1338, DOI: 10.1681/ASN.2004100820[Crossref], [PubMed], [CAS], Google Scholar254https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD2MXksF2gsL0%253D&md5=e70cc091377dce345254dd13f9ddd839Viral double-stranded RNA aggravates lupus nephritis through Toll-like receptor 3 on glomerular mesangial cells and antigen-presenting cellsPatole, Prashant S.; Groene, Hermann-Josef; Segerer, Stephan; Ciubar, Raluca; Belemezova, Emilia; Henger, Anna; Kretzler, Matthias; Schloendorff, Detlef; Anders, Hans-JoachimJournal of the American Society of Nephrology (2005), 16 (5), 1326-1338CODEN: JASNEU; ISSN:1046-6673. (American Society of Nephrology)How viral infections trigger autoimmunity is poorly understood. A role for Toll-like receptor 3 (TLR3) was hypothesized in this context as viral double-stranded RNA (dsRNA) activates dendritic cells to secrete type I interferons and cytokines that are known to be assocd. with the disease activity in systemic lupus erythematosus (SLE). Immunostaining of nephritic kidney sections of autoimmune MRLlpr/lpr mice revealed TLR3 expression in infiltrating antigen-presenting cells as well as in glomerular mesangial cells. TLR3-pos. cultured mesangial cells that were exposed to synthetic polyinosinic-cytidylic acid (pI:C) RNA in vitro produced CCL2 and IL-6. PI:C RNA activated macrophages and dendritic cells, both isolated from MRLlpr/lpr mice, to secrete multiple proinflammatory factors. In vivo, a single injection of pI:C RNA increased serum IL-12p70, IL-6, and IFN-α levels. A course of 50 μg of pI:C RNA given every other day from weeks 16 to 18 of age aggravated lupus nephritis in pI:C-treated MRLlpr/lpr mice. Serum DNA autoantibody levels were unaltered upon systemic exposure to pI:C RNA in MRLlpr/lpr mice, as pI:C RNA, in contrast to CpG-DNA, failed to induce B cell activation. It therefore was concluded that viral dsRNA triggers disease activity of lupus nephritis by mechanisms that are different from those of bacterial DNA. In contrast to CpG-DNA/TLR9 interaction, pI:C RNA/TLR3-mediated disease activity is B cell independent, but activated intrinsic renal cells, e.g., glomerular mesangial cells, to produce cytokines and chemokines, factors that can aggravate autoimmune tissue injury, e.g., lupus nephritis.
- 255Kono, D. H.; Haraldsson, M. K.; Lawson, B. R.; Pollard, K. M.; Koh, Y. T.; Du, X.; Arnold, C. N.; Baccala, R.; Silverman, G. J.; Beutler, B. A.; Theofilopoulos, A. N. Endosomal TLR Signaling Is Required for Anti-Nucleic Acid and Rheumatoid Factor Autoantibodies in Lupus. Proc. Natl. Acad. Sci. U. S. A. 2009, 106 (29), 12061– 12066, DOI: 10.1073/pnas.0905441106[Crossref], [PubMed], [CAS], Google Scholar255https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BD1MXps1anu74%253D&md5=3812823416bb9e99967500d6ae3102ecEndosomal TLR signaling is required for anti-nucleic acid and rheumatoid factor autoantibodies in lupusKono, Dwight H.; Haraldsson, M. Katarina; Lawson, Brian R.; Pollard, K. Michael; Koh, Yi Ting; Du, Xin; Arnold, Carrie N.; Baccala, Roberto; Silverman, Gregg J.; Beutler, Bruce A.; Theofilopoulos, Argyrios N.Proceedings of the National Academy of Sciences of the United States of America (2009), 106 (29), 12061-12068, S12061/1-S12061/8CODEN: PNASA6; ISSN:0027-8424. (National Academy of Sciences)Using the Unc93b1 3d mutation that selectively abolishes nucleic acid-binding Toll-like receptor (TLR) (TLR3, -7, -9) signaling, the authors show these endosomal TLRs are required for optimal prodn. of IgG autoAbs, IgM rheumatoid factor, and other clin. parameters of disease in 2 lupus strains, B6-FasPrlpr and BXSB. Strikingly, treatment with lipid A, an autoAb-inducing TLR4 agonist, could not overcome this requirement. The 3d mutation slightly reduced complete Freund's adjuvant (CFA)-mediated antigen presentation, but did not affect T-independent type 1 or alum-mediated T-dependent humoral responses or TLR-independent IFN prodn. induced by cytoplasmic nucleic acids. These findings suggest that nucleic acid-sensing TLRs might act as an Achilles' heel in susceptible individuals by providing a crit. pathway by which relative tolerance for nucleic acid-contg. antigens is breached and systemic autoimmunity ensues. Importantly, this helps provide an explanation for the high frequency of anti-nucleic acid Abs in lupus-like systemic autoimmunity.
- 256Lyn-Cook, B. D.; Xie, C.; Oates, J.; Treadwell, E.; Word, B.; Hammons, G.; Wiley, K. Increased Expression of Toll-like Receptors (TLRs) 7 and 9 and Other Cytokines in Systemic Lupus Erythematosus (SLE) Patients: Ethnic Differences and Potential New Targets for Therapeutic Drugs. Mol. Immunol. 2014, 61 (1), 38– 43, DOI: 10.1016/j.molimm.2014.05.001[Crossref], [PubMed], [CAS], Google Scholar256https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXps12itrg%253D&md5=6ed3e427b3b6074c768ba3badce67f27Increased expression of Toll-like receptors (TLRs) 7 and 9 and other cytokines in systemic lupus erythematosus (SLE) patients: Ethnic differences and potential new targets for therapeutic drugsLyn-Cook, Beverly D.; Xie, Chenghui; Oates, Jarren; Treadwell, Edward; Word, Beverly; Hammons, George; Wiley, KennethMolecular Immunology (2014), 61 (1), 38-43CODEN: MOIMD5; ISSN:0161-5890. (Elsevier)Increased expression of pro-inflammatory cytokines such as interferon, tumor necrosis factors (TNFs) and specific interleukins (ILs) has been found in a no. of autoimmune diseases, including systemic lupus erythematosus (SLE). These cytokines are induced by toll-like receptors (TLRs). Toll-like receptors are activated in response to accumulation of apoptotic bodies. These receptors play crit. roles in innate immune systems. Increased levels of interferon-alpha (INF-α) have also been found in many SLE patients and often correlate with disease severity. The objectives of this study were to examine the expression of selected TLRs and cytokines that have been identified in animal models and some limited human studies in a group of African Americans (AA) and European Americans (EA) women with lupus in comparison to age-matched non-lupus women. Blood samples were consecutively obtained by informed consent from 286 patients, 153 lupus and 136 non-lupus, seen in the rheumatol. clinics at East Carolina University. Cytokines were analyzed from blood serum using enzyme linked immunoassay (ELISA) for IL-6 and INF-α. Total RNA was isolated, using a Paxgene kit, from peripheral blood mononuclear cells of African American and European American women blood samples. Quant. real-time PCR using the CFX real-time system was conducted on all samples to det. TLRs 7 and 9, as well as INF-α expression. Toll-like receptor 7 (p < 0.01) and 9 (p = 0.001) expression levels were significantly increased in lupus patients compared to age-matched controls. African American women with lupus had a 2-fold increase in TLR-9 expression level when compared to their healthy controls or European American lupus patients. However, there was no ethnic difference in expression of TLR-7 in lupus patients. INF-α expression was significantly higher in lupus patients (p < 0.0001) and also showed ethnic difference in expression. Serum levels revealed significant increases in expression of IL-6, IFN-γ and TNF-α in lupus patients compared to non-lupus patients. African American women with lupus had significantly higher serum levels of IL-6 and TNF-α. African American women with lupus demonstrated increased levels of specific pro-inflammatory cytokines and Toll-like receptors when compared to EA women. Increased expression in these lupus patients provides an opportunity for targeting with antagonist as a new therapy for systemic lupus erythematosus.
- 257Tran, N. L.; Manzin-Lorenzi, C.; Santiago-Raber, M. L. Toll-like Receptor 8 Deletion Accelerates Autoimmunity in a Mouse Model of Lupus through a Toll-like Receptor 7-Dependent Mechanism. Immunology 2015, 145 (1), 60– 70, DOI: 10.1111/imm.12426[Crossref], [PubMed], [CAS], Google Scholar257https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXmtlCltrg%253D&md5=f89e9fa89336cf8585ee60a99047dbf8Toll-like receptor 8 deletion accelerates autoimmunity in a mouse model of lupus through a Toll-like receptor 7-dependent mechanismTran, Ngoc Lan; Manzin-Lorenzi, Celine; Santiago-Raber, Marie-LaureImmunology (2015), 145 (1), 60-70CODEN: IMMUAM; ISSN:0019-2805. (Wiley-Blackwell)Summary : Systemic lupus erythematosus is an autoimmune disorder characterized by increased levels of lymphocyte activation, antigen presentation by dendritic cells, and the formation of autoantibodies. This leads to immune complex-mediated glomerulonephritis. Toll-like receptor 7 (T7) and TLR9 localize to the endosomal compartment and play important roles in the generation of autoantibodies against nuclear components, as they recognize RNA and DNA, resp. In contrast, very little is known about endogenous TLR8 activation in mice. We therefore tested whether TLR8 could affect autoimmune responses in a murine model of lupus. We introduced a Tlr8 null mutation into C57BL/6 mice congenic for the Nba2 (NZB autoimmunity 2) locus and bearing the Yaa (Y-linked autoimmune acceleration) mutation contg. a tlr8 duplicated gene, and monitored disease development, autoantibody prodn., and glomerulonephritis-assocd. mortality. Cellular responses were investigated in female Nba2.TLR8-/- mice bearing no copy of tlr8. The TLR8 deficiency accelerated disease progression and mortality, increased the no. of circulating antibodies and activated monocytes, and heightened cellular responses to TLR7 ligation. TLR8-deficient antigen-presenting cells exhibited increased levels of MHC class II expression. The ability of dendritic cells to present antigens to allogeneic T cells after TLR7 ligation was also improved by TLR8 deficiency. TLR8 deletion accelerated autoimmunity in lupus-prone mice in response to TLR7 activation. Antigen-presenting cell function seemed to play a key role in mediating the effects of TLR8 deficiency.
- 258Capolunghi, F.; Rosado, M. M.; Cascioli, S.; Girolami, E.; Bordasco, S.; Vivarelli, M.; Ruggiero, B.; Cortis, E.; Insalaco, A.; Fantò, N.; Gallo, G.; Nucera, E.; Loiarro, M.; Sette, C.; De santis, R.; Carsetti, R.; Ruggiero, V. Pharmacological Inhibition of TLR9 Activation Blocks Autoantibody Production in Human B Cells from SLE Patients. Rheumatology 2010, 49 (12), 2281– 2289, DOI: 10.1093/rheumatology/keq226[Crossref], [PubMed], [CAS], Google Scholar258https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3cXhsVejsbvL&md5=edc6431fd556925d261aef28885ce317Pharmacological inhibition of TLR9 activation blocks autoantibody production in human B cells from SLE patientsCapolunghi, Federica; Rosado, Maria M.; Cascioli, Simona; Girolami, Elia; Bordasco, Silvia; Vivarelli, Marina; Ruggiero, Barbara; Cortis, Elisabetta; Insalaco, Antonella; Fanto, Nicola; Gallo, Grazia; Nucera, Eleonora; Loiarro, Maria; Sette, Claudio; De Santis, Rita; Carsetti, Rita; Ruggiero, VitoRheumatology (Oxford, United Kingdom) (2010), 49 (12), 2281-2289CODEN: RUMAFK; ISSN:1462-0324. (Oxford University Press)Toll-like receptor 9 (TLR9), which recognizes hypomethylated DNA [cytosine-phosphate-guanine (CpG)], plays a role in the maintenance of serol. memory and has been recently implicated in the pathogenesis of SLE. We previously reported that in vitro TLR9 triggers memory B-cell differentiation into antibody-producing cells, and that the MyD88-inhibitor ST2825 blocks TLR9-induced plasma cell (PC) generation. Here, we investigated whether memory B cells produce autoantibodies in SLE patients with active disease or in clin. remission, and whether ST2825 could inhibit PC generation in SLE patients. Peripheral blood mononuclear cells from 10 SLE patients in clin. remission and 2 with active SLE were cultured in the presence of CpG with or without ST2825. Phenotypical anal. of CpG-stimulated cells was performed by flow cytometry. Supernatants were collected to measure antibody prodn. by ELISA and to detect autoantibodies by IF. CpG-induced TLR9 stimulation caused autoantibody secretion in patients with active disease and in the majority of patients in clin. remission. Inhibition of MyD88 completely blocked the de novo generation of PCs and the secretion of autoantibodies. Autoreactive B cells persist in SLE patients during disease remission in the circulating B-cell memory pool. TLR9-dependent activation of memory B cells by pathogens could be one of the mechanisms triggering relapses in SLE. Compds. targeting the TLR/MyD88 pathway may be used as novel therapeutic tools to treat acute disease and to prevent relapses in SLE patients.
- 259Li, B.; Xia, Y.; Hu, B. Infection and Atherosclerosis: TLR-Dependent Pathways. Cell. Mol. Life Sci. 2020, 77, 2751– 2769, DOI: 10.1007/s00018-020-03453-7[Crossref], [PubMed], [CAS], Google Scholar259https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXislertLg%253D&md5=07704c5f6e50f4ad7f71ca73ac4662acInfection and atherosclerosis: TLR-dependent pathwaysLi, Bowei; Xia, Yuanpeng; Hu, BoCellular and Molecular Life Sciences (2020), 77 (14), 2751-2769CODEN: CMLSFI; ISSN:1420-682X. (Birkhaeuser Basel)Abstr.: Atherosclerotic vascular disease (ASVD) is a chronic process, with a progressive course over many years, but it can cause acute clin. events, including acute coronary syndromes (ACS), myocardial infarction (MI) and stroke. In addn. to a series of typical risk factors for atherosclerosis, like hyperlipidemia, hypertension, smoking and obesity, emerging evidence suggests that atherosclerosis is a chronic inflammatory disease, suggesting that chronic infection plays an important role in the development of atherosclerosis. Toll-like receptors (TLRs) are the most characteristic members of pattern recognition receptors (PRRs), which play an important role in innate immune mechanism. TLRs play different roles in different stages of infection of atherosclerosis-related pathogens such as Chlamydia pneumoniae (C. pneumoniae), periodontal pathogens including Porphyromonas gingivalis (P. gingivalis), Helicobacter pylori (H. pylori) and human immunodeficiency virus (HIV). Overall, activation of TLR2 and 4 seems to have a profound impact on infection-related atherosclerosis. This article reviews the role of TLRs in the process of atherosclerosis after C. pneumoniae and other infections and the current status of treatment, with a view to providing a new direction and potential therapeutic targets for the study of ASVD.
- 260Zhou, Y.; Little, P. J.; Downey, L.; Afroz, R.; Wu, Y.; Ta, H. T.; Xu, S.; Kamato, D. The Role of Toll-like Receptors in Atherothrombotic Cardiovascular Disease. ACS Pharmacol. Transl. Sci. 2020, 3 (3), 457– 471, DOI: 10.1021/acsptsci.9b00100[ACS Full Text], [CAS], Google Scholar260https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXisVSgsrY%253D&md5=3c7a9c4c6f0599a63cf5dfd8f785d4b5The Role of Toll-like Receptors in Atherothrombotic Cardiovascular DiseaseZhou, Ying; Little, Peter J.; Downey, Liam; Afroz, Rizwana; Wu, Yuao; Ta, Hang T.; Xu, Suowen; Kamato, DanielleACS Pharmacology & Translational Science (2020), 3 (3), 457-471CODEN: APTSFN; ISSN:2575-9108. (American Chemical Society)A review. Toll-like receptors (TLRs) are dominant components of the innate immune system. Activated by both pathogen-assocd. mol. patterns and damage-assocd. mol. patterns, TLRs underpin the pathol. of numerous inflammation related diseases that include not only immune diseases, but also cardiovascular disease (CVD), diabetes, obesity, and cancers. Growing evidence has demonstrated that TLRs are involved in multiple cardiovascular pathophysiologies, such as atherosclerosis and hypertension. Specifically, a trial called the Canakinumab Anti-inflammatory Thrombosis Outcomes Study showed the use of an antibody that neutralizes interleukin-1β, reduces the recurrence of cardiovascular events, demonstrating inflammation as a therapeutic target and also the research value of targeting the TLR system in CVD. In this review, we provide an update of the interplay between TLR signaling, inflammatory mediators, and atherothrombosis, with an aim to identify new therapeutic targets for atherothrombotic CVD.
- 261Adamczak, D. M. The Role of Toll-like Receptors and Vitamin D in Cardiovascular Diseases—a Review. Int. J. Mol. Sci. 2017, 18 (11), 2252, DOI: 10.3390/ijms18112252[Crossref], [CAS], Google Scholar261https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXitVOgtb7P&md5=f78e0032068738867f154e85c55bee37The role of toll-like receptors and vitamin d in cardiovascular diseases-a reviewAdamczak, Daria M.International Journal of Molecular Sciences (2017), 18 (11), 2252/1-2252/23CODEN: IJMCFK; ISSN:1422-0067. (MDPI AG)Cardiovascular diseases are the leading cause of mortality worldwide. Therefore, a better understanding of their pathomechanisms and the subsequent implementation of optimal prophylactic and therapeutic strategies are of utmost importance. A growing body of evidence states that low-grade inflammation is a common feature for most of the cardiovascular diseases in which the contributing factors are the activation of toll-like receptors (TLRs) and vitamin D deficiency. In this article, available data concerning the assocn. of cardiovascular diseases with TLRs and vitamin D status are reviewed, followed by a discussion of new possible approaches to cardiovascular disease management.
- 262Balistreri, C. R.; Ruvolo, G.; Lio, D.; Madonna, R. Toll-like Receptor-4 Signaling Pathway in Aorta Aging and Diseases: “Its Double Nature.. J. Mol. Cell. Cardiol. 2017, 110, 38– 53, DOI: 10.1016/j.yjmcc.2017.06.011[Crossref], [PubMed], [CAS], Google Scholar262https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXht1Sjs7jP&md5=dae8d3f2bea57480c0918bd5074d2464Toll-like receptor-4 signaling pathway in aorta aging and diseases: "its double nature"Balistreri, Carmela Rita; Ruvolo, Giovanni; Lio, Domenico; Madonna, RosalindaJournal of Molecular and Cellular Cardiology (2017), 110 (), 38-53CODEN: JMCDAY; ISSN:0022-2828. (Elsevier B.V.)Recent advances in the field of innate immunity have revealed a complex role of innate immune signaling pathways in both tissue homeostasis and disease. Among them, the Toll-like receptor 4 (TLR-4) pathways has been linked to various pathophysiol. conditions, such as cardiovascular diseases (CVDs). This has been interrogated by developing multiple lab. tools that have shown in animal models and clin. conditions, the involvement of the TLR-4 signaling pathway in the pathophysiol. of different CVDs, such as atherosclerosis, ischemic heart disease, heart failure, ischemia-reperfusion injury and aorta aneurysm. Among these, aorta aneurysm, a very complex pathol. condition with uncertain etiol. and fatal complications (i.e. dissection and rupture), has been assocd. with the occurrence of high risk cardiovascular conditions, including thrombosis and embolism. In this review, we discuss the possible role of TLR-4 signaling pathway in the development of aorta aneurysm, considering the emerging evidence from ongoing investigations. Our message is that emphasizing the role of TLR-4 signaling pathway in aorta aneurysm may serve as a starting point for future studies, leading to a better understanding of the pathophysiol. basis and perhaps the effective treatment of this difficult human disease.
- 263Bomfim, G. F.; Echem, C.; Martins, C. B.; Costa, T. J.; Sartoretto, S. M.; Dos Santos, R. A.; Oliveira, M. A.; Akamine, E. H.; Fortes, Z. B.; Tostes, R. C.; Webb, R. C.; Carvalho, M. H. C. Toll-like Receptor 4 Inhibition Reduces Vascular Inflammation in Spontaneously Hypertensive Rats. Life Sci. 2015, 122, 1– 7, DOI: 10.1016/j.lfs.2014.12.001[Crossref], [PubMed], [CAS], Google Scholar263https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXhslymsg%253D%253D&md5=082297038c8e78db63b1c84b60e04bb3Toll-like receptor 4 inhibition reduces vascular inflammation in spontaneously hypertensive ratsBomfim, G. F.; Echem, C.; Martins, C. B.; Costa, T. J.; Sartoretto, S. M.; Dos Santos, R. A.; Oliveira, M. A.; Akamine, E. H.; Fortes, Z. B.; Tostes, R. C.; Webb, R. C.; Carvalho, M. H. C.Life Sciences (2015), 122 (), 1-7CODEN: LIFSAK; ISSN:0024-3205. (Elsevier B.V.)Hypertension is assocd. with increased levels of circulating cytokines and recent studies have shown that innate immunity contributes to hypertension. The mechanisms which hypertension stimulates immune response remain unclear, but may involve formation of neo-antigens that activate the immune system. Toll like receptor 4 (TLR4) is an innate immune receptor that binds a wide spectrum of exogenous (lipopolysaccharide) and endogenous ligands. TLR4 signaling leads to activation of nuclear factor kappa B (NFκB) and transcription of genes involved in inflammatory response. We previously demonstrated that TLR4 blockade reduces blood pressure and the augmented vascular contractility in spontaneously hypertensive rats (SHR). Here we hypothesized that inhibition of TLR4 ameliorates the vascular inflammatory process by a NFκB signaling pathway.SHR and Wistar rats were treated with anti-TLR4 antibody (1 μg/day) or unspecific IgG for 15 days (i.p.).Anti-TLR4 treatment decreased prodn. of reactive oxygen species and expression of IL-6 cytokine in mesenteric resistance arteries from SHR, when compared with IgG-treated SHR. Anti-TLR4 treatment also abolished the increased vascular reactivity to noradrenaline obsd. in IgG-treated SHR, as described before, and inhibition of NFκB decreased noradrenaline responses only in IgG-treated SHR. Mesenteric arteries from SHR treated with anti-TLR4 displayed decreased expression of MyD88, but not TRIF, key mols. in TLR4 signaling. Phosphorylation of p38 and NF-κB p65 were decreased in arteries from anti-TLR4-treated SHR vs. IgG-treated SHR.Together, these results suggest that TLR4 is a key player in hypertension and vascular inflammatory process by a NFκB signaling pathway.
- 264Kim, J.; Yoo, J. Y.; Suh, J. M.; Park, S.; Kang, D.; Jo, H.; Bae, Y. S. The Flagellin-TLR5-Nox4 Axis Promotes the Migration of Smooth Muscle Cells in Atherosclerosis. Exp. Mol. Med. 2019, 51, 78, DOI: 10.1038/s12276-019-0275-6[Crossref], [PubMed], [CAS], Google Scholar264https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB3MzmtVCmuw%253D%253D&md5=e60a36c397872efe63f007a81fe46c5bThe flagellin-TLR5-Nox4 axis promotes the migration of smooth muscle cells in atherosclerosisKim Jinoh; Yoo Jung-Yeon; Suh Jung Min; Park Sujin; Kang Dongmin; Bae Yun Soo; Jo HanjoongExperimental & molecular medicine (2019), 51 (7), 78 ISSN:.We hypothesized that NADPH oxidase 4 (Nox4) is involved in the formation of neointimal atherosclerotic plaques through the migration of smooth muscle cells (SMCs) in response to flagellin. Here, we demonstrate that TLR5-mediated Nox4 activation regulates the migration of SMCs, leading to neointimal plaque formation in atherosclerosis. To investigate the molecular mechanism by which the TLR5-Nox4 cascade mediates SMC migration, we analyzed the signaling cascade in primary vascular SMCs (VSMCs) from wild-type (WT) or Nox4 KO mice. Stimulation of VSMCs from Nox4 KO mice with flagellin failed to induce H2O2 production and Rac activation compared with stimulation of VSMCs from WT mice. Moreover, the migration of Nox4-deficient VSMCs was attenuated in response to flagellin in transwell migration and wound healing assays. Finally, we performed partial carotid artery ligation in ApoE KO and Nox4ApoE DKO mice fed a high-fat diet (HFD) with or without recombinant FliC (rFliC) injection. Injection of rFliC into ApoE KO mice fed a HFD resulted in significantly increased SMC migration into the intimal layer, whereas SMC accumulation was not detected in Nox4ApoE DKO mice. We conclude that activation of the TLR5-Nox4 cascade plays an important role in the formation of neointimal atherosclerotic plaques.
- 265Fukuda, D.; Nishimoto, S.; Aini, K.; Tanaka, A.; Nishiguchi, T.; Kim-Kaneyama, J. R.; Lei, X. F.; Masuda, K.; Naruto, T.; Tanaka, K.; Higashikuni, Y.; Hirata, Y.; Yagi, S.; Kusunose, K.; Yamada, H.; Soeki, T.; Imoto, I.; Akasaka, T.; Shimabukuro, M.; Sata, M. Toll-like Receptor 9 Plays a Pivotal Role in Angiotensin II-Induced Atherosclerosis. J. Am. Heart Assoc. 2019, 8 (7), e010860, DOI: 10.1161/JAHA.118.010860[Crossref], [PubMed], [CAS], Google Scholar265https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXpslGltg%253D%253D&md5=6f924b44510681f83c0694a2e503c0edToll-like receptor 9 plays a pivotal role in angiotensin II-induced atherosclerosisFukuda, Daiju; Nishimoto, Sachiko; Aini, Kunduziayi; Tanaka, Atsushi; Nishiguchi, Tsuyoshi; Kim-Kaneyama, Joo-ri; Lei, Xiao-Feng; Masuda, Kiyoshi; Naruto, Takuya; Tanaka, Kimie; Higashikuni, Yasutomi; Hirata, Yoichiro; Yagi, Shusuke; Kusunose, Kenya; Yamada, Hirotsugu; Soeki, Takeshi; Imoto, Issei; Akasaka, Takashi; Shimabukuro, Michio; Sata, MasatakaJournal of the American Heart Association (2019), 8 (7), e010860/1-e010860/24CODEN: JAHABZ; ISSN:2047-9980. (Wiley-Blackwell)Background--Toll-like receptor (TLR) 9 recognizes bacterial DNA, activating innate immunity, whereas it also provokes inflammation in response to fragmented DNA released from mammalian cells. We investigated whether TLR9 contributes to the development of vascular inflammation and atherogenesis using apolipoprotein E-deficient (Apoe-/-) mice. Methods and Results--Tlr9-deficient Apoe-/- (Tlr9±/±Apoe-/-) mice and Apoe-/- mice on a Western-type diet received s.c. angiotensin II infusion (1000 ng/kg per min) for 28 days. Angiotensin II increased the plasma level of doublestranded DNA, an endogenous ligand of TLR9, in these mice. Genetic deletion or pharmacol. blockade of TLR9 in angiotensin II-infused Apoe-/- mice attenuated atherogenesis in the aortic arch (P<0.05), reduced the accumulation of lipid and macrophages in atherosclerotic plaques, and decreased RNA expression of inflammatory mols. in the aorta with no alteration of metabolic parameters. On the other hand, restoration of TLR9 in bone marrow in Tlr9-/-Apoe-/- mice promoted atherogenesis in the aortic arch (P<0.05). A TLR9 agonist markedly promoted proinflammatory activation of Apoe-/- macrophages, partially through p38 mitogen-activated protein kinase signaling. In addn., genomic DNA extd. from macrophages promoted inflammatory mol. expression more effectively in Apoe-/- macrophages than in Tlr9-/-Apoe-/- macrophages. Furthermore, in humans, circulating double-stranded DNA in the coronary artery pos. correlated with inflammatory features of coronary plaques detd. by optical coherence tomog. in patients with acute myocardial infarction (P<0.05). Conclusions--TLR9 plays a pivotal role in the development of vascular inflammation and atherogenesis through proinflammatory activation of macrophages. TLR9 may serve as a potential therapeutic target for atherosclerosis.
- 266Navi, A.; Patel, H.; Shaw, S.; Baker, D.; Tsui, J. Therapeutic Role of Toll-like Receptor Modification in Cardiovascular Dysfunction. Vasc. Pharmacol. 2013, 58 (3), 231– 239, DOI: 10.1016/j.vph.2012.10.001[Crossref], [PubMed], [CAS], Google Scholar266https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC38Xhs1ajtbnN&md5=d98e13fa22c261806718e7dab082c2b5Therapeutic role of toll-like receptor modification in cardiovascular dysfunctionNavi, Ali; Patel, Hemanshu; Shaw, Sidney; Baker, Daryll; Tsui, JaniceVascular Pharmacology (2013), 58 (3), 231-239CODEN: VPAHAJ; ISSN:1537-1891. (Elsevier B.V.)A review. Toll-like receptors (TLR) are key pattern recognition receptors in the innate immune system. The TLR-mediated immune response against pathogens is usually protective however inappropriate TLR activation may lead to excessive tissue damage. It is well recognized that TLRs respond to a variety of endogenous as well as exogenous ligands. By responding to endogenous ligands that are exposed during cellular damage, TLRs have been implicated in a range of pathol. conditions assocd. with cardiovascular dysfunction. Increasing knowledge on the mechanisms involved in TLR signalling has encouraged the exploration of therapeutic pharmacol. modulation of TLR activation in conditions such as atherosclerosis, ischemic heart disease, heart failure and ischemic reperfusion injury. The aim of this review is to explore the translational potentials of TLR modification in cardiovascular dysfunction, where these agents have been studied.
- 267Wang, Z.; Wang, Z.; Zhu, J.; Long, X.; Yan, J. Vitamin K2 Can Suppress the Expression of Toll-like Receptor 2 (TLR2) and TLR4, and Inhibit Calcification of Aortic Intima in ApoE–/– Mice as Well as Smooth Muscle Cells. Vascular 2018, 26 (1), 18– 26, DOI: 10.1177/1708538117713395[Crossref], [PubMed], [CAS], Google Scholar267https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXisVykuro%253D&md5=30735e224447f17d69449eb747e8dda5Vitamin K2 can suppress the expression of Toll-like receptor 2 (TLR2) and TLR4, and inhibit calcification of aortic intima in ApoE-/- mice as well as smooth muscle cellsWang, Zhaojun; Wang, Zhongqun; Zhu, Jie; Long, Xinguang; Yan, JinchuanVascular (2018), 26 (1), 18-26CODEN: VASCBO; ISSN:1708-539X. (Sage Publications Ltd.)Background and objectives: Vascular calcification is a common complication in atherosclerosis. Accumulating evidence showed that Toll-like receptors (TLRs) mediate pro-inflammatory and atherosclerosis. Recent studies demonstrated that vascular calcification is one of the detrimental effects of vitamin K (Vit K) antagonists. However, the effects of Vit K on the expression of TLR2 and 4 and intimal calcification in artery remained unidentified. Methods and results: Eighteen ApoE-/- mice were randomly divided into model group, Vit K-treated group, and control group. The mice of model and Vit K-treated group were fed with high-fat diet, while control group mice were fed with normal diet. Mice of Vit K-treated group were administered orally with vitamin K2 (40 mg.kg-1.day-1) for 12 wk. Twelve weeks later the aortic sections of mice were acquired and stained with hematoxylin and eosin and von Kossa, resp. Calcium content and activity of alk. phosphatase (ALP) at aortic tissues were measured. The expression levels of TLR2 and TLR4 in aorta sections were detected by immunohistochemisty and RT-PCR, resp. The effects of Vit K on cellular calcification were further studied in A7r5 SMCs. Results demonstrated that high-fat diet induced typical atherosclerosis with intimal calcification in ApoE-/- mice, while in Vit K-treated group atherosclerosis and calcium deposits were not serious; Vit K2 also inhibited cellular calcification in A7r5 SMCs. Quant. anal. showed that calcium and ALP activity at aortic tissues in the Vit K-treated mice were significantly lower than that of the model group (P < 0.01); Compared to the control group, the expression levels of TLR2 and TLR4 in the model group were significantly higher (P < 0.05), while in Vit K-treated group the levels of TLR2 and 4 were significantly lower than that in the model group. Furthermore, the content of calcium was pos. related to the expression levels of TLR2 and TLR4 mRNA at aortic tissues (r = 0.77 and r = 0.79, resp., both P < 0.001). Conclusion: VitK2 can inhibit intimal calcification of aortic artery induced by high-fat diet in ApoE-/- mice and A7r5 SMCs calcification induced by β-sodium glycerophosphate, and meanwhile can reduce the expression of TLR2 and TLR4. These results suggested that the effects of VitK2 on vascular calcification may be assocd. with the expression of TLR2 and TLR4.
- 268Owens, A. P.; Passam, F. H.; Antoniak, S.; Marshall, S. M.; McDaniel, A. L.; Rudel, L.; Williams, J. C.; Hubbard, B. K.; Dutton, J. A.; Wang, J.; Tobias, P. S.; Curtiss, L. K.; Daugherty, A.; Kirchhofer, D.; Luyendyk, J. P.; Moriarty, P. M.; Nagarajan, S.; Furie, B. C.; Furie, B.; Johns, D. G.; Temel, R. E.; Mackman, N. Monocyte Tissue Factor - Dependent Activation of Coagulation in Hypercholesterolemic Mice and Monkeys Is Inhibited by Simvastatin. J. Clin. Invest. 2012, 122 (2), 558– 568, DOI: 10.1172/JCI58969[Crossref], [PubMed], [CAS], Google Scholar268https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC38XitVelsrw%253D&md5=319ddc5550b72a81b97b04aaa5b5444bMonocyte tissue factor-dependent activation of coagulation in hypercholesterolemic mice and monkeys is inhibited by simvastatinOwens, A. Phillip, III; Passam, Freda H.; Antoniak, Silvio; Marshall, Stephanie M.; McDaniel, Allison L.; Rudel, Lawrence; Williams, Julie C.; Hubbard, Brian K.; Dutton, Julie-Ann; Wang, Jianguo; Tobias, Peter S.; Curtiss, Linda K.; Daugherty, Alan; Kirchhofer, Daniel; Luyendyk, James P.; Moriarty, Patrick M.; Nagaraian, Shanmugam; Furie, Barbara C.; Furie, Bruce; Johns, Douglas G.; Temei, Ryan E.; Mackman, NigelJournal of Clinical Investigation (2012), 122 (2), 558-568CODEN: JCINAO; ISSN:0021-9738. (American Society for Clinical Investigation)Hypercholesterolemia is a major risk factor for atherosclerosis. It also is assocd. with platelet hyperactivity, which increases morbidity and mortality from cardiovascular disease. However, the mechanisms by which hypercholesterolemia produces a procoagulant state remain undefined. Atherosclerosis is assocd. with accumulation of oxidized lipoproteins within atherosclerotic lesions. Small quantities of oxidized lipoproteins are also present in the circulation of patients with coronary artery disease. We therefore hypothesized that hypercholesterolemia leads to elevated levels of oxidized LDL (oxLDL) in plasma and that this induces expression of the procoagulant protein tissue factor (TF) in monocytes. In support of this hypothesis, we report here that oxLDL induced TF expression in human monocytic cells and monocytes. In addn., patients with familial hypercholesterolemia had elevated levels of plasma microparticle (MP) TF activity. Furthermore, a high-fat diet induced a time-dependent increase in plasma MP TF activity and activation of coagulation in both LDL receptor-deficient mice and African green monkeys. Genetic deficiency of TF in bone marrow cells reduced coagulation in hypercholesterolemic mice, consistent with a major role for monocyte-derived TF in the activation of coagulation. Similarly, a deficiency of either TLR4 or TLR6 reduced levels of MP TF activity. Simvastatin treatment of hypercholesterolemic mice and monkeys reduced oxLDL, monocyte TF expression, MP TF activity, activation of coagulation, and inflammation, without affecting total cholesterol levels. Our results suggest that the prothrombotic state assocd. with hypercholesterolemia is caused by oxLDL-mediated induction of TF expression in monocytes via engagement of a TLR4/TLR6 complex.
- 269Farkas, D.; Thompson, A. A. R.; Bhagwani, A. R.; Hultman, S.; Ji, H.; Kotha, N.; Farr, G.; Arnold, N. D.; Braithwaite, A.; Casbolt, H.; Cole, J. E.; Sabroe, I.; Monaco, C.; Cool, C. D.; Goncharova, E. A.; Lawrie, A.; Farkas, L. Toll-like Receptor 3 Is a Therapeutic Target for Pulmonary Hypertension. Am. J. Respir. Crit. Care Med. 2019, 199 (2), 199– 210, DOI: 10.1164/rccm.201707-1370OC[Crossref], [PubMed], [CAS], Google Scholar269https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhtFKhsr3O&md5=21bb56cfdeecc85cbfd5478051c57059Toll-like receptor 3 is a therapeutic target for pulmonary hypertensionFarkas, Daniela; Thompson, A. A. Roger; Bhagwani, Aneel R.; Hultman, Schuyler; Ji, Hyun; Kotha, Naveen; Farr, Grant; Arnold, Nadine D.; Braithwaite, Adam; Casbolt, Helen; Cole, Jennifer E.; Sabroe, Ian; Monaco, Claudia; Cool, Carlyne D.; Goncharova, Elena A.; Lawrie, Allan; Farkas, LaszloAmerican Journal of Respiratory and Critical Care Medicine (2019), 199 (2), 199-210CODEN: AJCMED; ISSN:1073-449X. (American Thoracic Society)Rationale: Pulmonary arterial hypertension (PAH) is characterized by vascular cell proliferation and endothelial cell apoptosis. TLR3 (Toll-like receptor 3) is a receptor for double-stranded RNA and has been recently implicated in vascular protection. Objectives: To study the expression and role of TLR3 in PAH and to det. whether a TLR3 agonist reduces pulmonary hypertension in preclin. models. Methods: Lung tissue and endothelial cells from patients with PAH were investigated by polymerase chain reaction, immunofluorescence, and apoptosis assays. TLR3-/- and TLR3+/+ mice were exposed to chronic hypoxia and SU5416. Chronic hypoxia or chronic hypoxia/ SU5416 rats were treated with the TLR3 agonist polyinosinic/ polycytidylic acid (Poly[I:C]). Measurements and Main Results: TLR3 expression was reduced in PAH patient lung tissue and endothelial cells, and TLR3-/- mice exhibited more severe pulmonary hypertension following exposure to chronic hypoxia/SU5416. TLR3 knockdown promoted doublestranded RNA signaling via other intracellular RNA receptors in endothelial cells. This was assocd. with greater susceptibility to apoptosis, a known driver of pulmonary vascular remodeling. Poly(I:C) increased TLR3 expression via IL-10 in rat endothelial cells. In vivo, high-dose Poly(I:C) reduced pulmonary hypertension in both rat models in proof-of-principle expts. In addn., Poly(I:C) also reduced right ventricular failure in established pulmonary hypertension. Conclusions: Our work identifies a novel role for TLR3 in PAH based on the findings that reduced expression of TLR3 contributes to endothelial apoptosis and pulmonary vascular remodeling.
- 270Wang, P.-F.; Fang, H.; Chen, J.; Lin, S.; Liu, Y.; Xiong, X.-Y.; Wang, Y.-C.; Xiong, R.-P.; lv, F.-L.; Wang, J.; Yang, Q.-W. Polyinosinic-Polycytidylic Acid Has Therapeutic Effects against Cerebral Ischemia/Reperfusion Injury through the Downregulation of TLR4 Signaling via TLR3. J. Immunol. 2014, 192 (10), 4783– 4794, DOI: 10.4049/jimmunol.1303108[Crossref], [PubMed], [CAS], Google Scholar270https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXntlGhtb0%253D&md5=a7b67aefbbe936ede6bad136cb991e91Polyinosinic-Polycytidylic Acid Has Therapeutic Effects against Cerebral Ischemia/Reperfusion Injury through the Downregulation of TLR4 Signaling via TLR3Wang, Peng-Fei; Fang, Huang; Chen, Jing; Lin, Sen; Liu, Yong; Xiong, Xiao-Yi; Wang, Yan-Chun; Xiong, Ren-Ping; Lv, Feng-Lin; Wang, Jian; Yang, Qing-WuJournal of Immunology (2014), 192 (10), 4783-4794CODEN: JOIMA3; ISSN:0022-1767. (American Association of Immunologists)Recent reports have shown that preconditioning with the TLR3 ligand polyinosinic-polycytidylic acid (poly(I:C)) protects against cerebral ischemia/reperfusion (I/R) injury. However, it is unclear whether poly(I:C) treatment after cerebral I/R injury is also effective. We used mouse/rat middle cerebral artery occlusion and cell oxygen-glucose deprivation models to evaluate the therapeutic effects and mechanisms of poly(I:C) treatment. Poly(I:C) was i.p. injected 3 h after ischemia (treatment group). Cerebral infarct vols. and brain edemas were significantly reduced, and neurol. scores were significantly increased. TNF-α and IL-1β levels were markedly decreased, whereas IFN-β levels were greatly increased, in the ischemic brain tissues, cerebral spinal fluid, and serum. Injuries to hippocampal neurons and mitochondria were greatly reduced. The nos. of TUNEL-pos. and Fluoro-Jade B+ cells also decreased significantly in the ischemic brain tissues. Poly(I:C) treatment increased the levels of Hsp27, Hsp70, and Bcl2 and decreased the level of Bax in the ischemic brain tissues. Moreover, poly(I:C) treatment attenuated the levels of TNF-α and IL-1β in serum and cerebral spinal fluid of mice stimulated by LPS. However, the protective effects of poly(I:C) against cerebral ischemia were abolished in TLR3-/- and TLR4-/-mice. Poly(I:C) downregulated TLR4 signaling via TLR3. Poly(I:C) treatment exhibited obvious protective effects 14 d after ischemia and was also effective in the rat permanent middle cerebral artery occlusion model. The results suggest that poly(I:C) exerts therapeutic effects against cerebral I/R injury through the downregulation of TLR4 signaling via TLR3. Poly(I:C) is a promising new drug candidate for the treatment of cerebral infarcts.
- 271Chen, G.; Chen, X. L.; Xu, C. B.; Lin, J.; Luo, H. L.; Xie, X.; Li, J. Toll-like Receptor Protein 4 Monoclonal Antibody Inhibits MmLDL-Induced Endothelium-Dependent Vasodilation Dysfunction of Mouse Mesenteric Arteries. Microvasc. Res. 2020, 127, 103923, DOI: 10.1016/j.mvr.2019.103923[Crossref], [PubMed], [CAS], Google Scholar271https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhslygsbbE&md5=ba9bc2713bc766633db7a1744bf49d93Toll-like receptor protein 4 monoclonal antibody inhibits mmLDL-induced endothelium-dependent vasodilation dysfunction of mouse mesenteric arteriesChen, Gen; Chen, Xiao-Lan; Xu, Cang-Bao; Lin, Jie; Luo, Hong-Li; Xie, Xi; Li, JieMicrovascular Research (2020), 127 (), 103923CODEN: MIVRA6; ISSN:0026-2862. (Elsevier Inc.)Minimally modified low-d. lipoprotein (mmLDL) is a risk factor for cardiovascular disease. This study was designed to investigate the effect of a Toll-like receptor 4 monoclonal antibody (TLR4 mAb) on mmLDL-induced endothelium-dependent vasodilation (EDV) impairment in mouse mesenteric arteries and to explore the underlying mechanism. Animals were divided into a normal control group, an mmLDL treatment group, and a TLR4 mAb intervention group. The serum concns. of IL-1β and TNF-α were detected using enzyme-linked immunosorbent assays (ELISAs). EDV function was measured using a microvascular tension tracing method. The protein levels and mRNA expression of IL-1β and TNF-α in vascular tissue were detected using western blot anal. and reverse transcription polymerase chain reaction, resp. TLR4 mAb improved mmLDL-induced EDV functional impairment in a dose-dependent manner. TLR4 mAb significantly upregulated KCa3.1 and KCa2.3 channel protein levels and downregulated TNF-α and IL-1β expression. These effects were possibly assocd. with the competitive antagonism of TLR4 mAb on the TLR4 signaling pathway and the downstream NF-κB p65 and p38 MAPK pathways, which are activated by mmLDL. In conclusion, pretreatment with TLR4 mAb lessens mmLDL-induced EDV dysfunction and inhibits overexpression of inflammatory factors. Regulation of the TLR4 pathway, as well as its downstream NF-κB p65 and p38 MAPK pathways, may be an effective strategy for the prevention and treatment of cardiovascular diseases.
- 272Huggins, C.; Pearce, S.; Peri, F.; Neumann, F.; Cockerill, G.; Pirianov, G. A Novel Small Molecule TLR4 Antagonist (IAXO-102) Negatively Regulates Non-Hematopoietic Toll like Receptor 4 Signalling and Inhibits Aortic Aneurysms Development. Atherosclerosis 2015, 242 (2), 563– 570, DOI: 10.1016/j.atherosclerosis.2015.08.010[Crossref], [PubMed], [CAS], Google Scholar272https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXhsVensrrL&md5=ea6fc3cddf6afb908508e6a0b9e8c32fA novel small molecule TLR4 antagonist (IAXO-102) negatively regulates non-hematopoietic toll like receptor 4 signalling and inhibits aortic aneurysms developmentHuggins, Christopher; Pearce, Stuart; Peri, Francesco; Neumann, Frank; Cockerill, Gillian; Pirianov, GrishaAtherosclerosis (Amsterdam, Netherlands) (2015), 242 (2), 563-570CODEN: ATHSBL; ISSN:0021-9150. (Elsevier B.V.)The toll-like receptors (TLRs), including TLR4, have been shown to play a crucial role in vascular inflammatory diseases, such as atherosclerosis and aneurysm. The main goal of this study was to det. the potential of IAXO-102 (Innaxon, Tewkesbury), a novel small mol. TLR4 antagonist, to modulate non-hematopoietic TLR4 proinflammatory signalling and inhibit exptl. abdominal aortic aneurysm (AAA) development. Human umbilical vein endothelial cells (HUVEC) and Angiotensin II-induced exptl. AAA development were our in vitro and in vivo models resp. Western blotting, antibody array and ELISA approaches were used to explore the effect of IAXO-102 on TLR4 functional activity on two levels: modulation of TLR4-induced mitogen activated protein kinases (MAPK) and p65 NF-kB phosphorylation and expression of TLR4 dependent proinflammatory proteins. Following activation of TLR4, in vitro/in vivo data revealed that IAXO-102 inhibited MAPK and p65 NF-kB phosphorylation assocd. with down regulation of the expression of TLR4 and TLR4 dependent proinflammatory proteins. Furthermore, IAXO-102 decreased Angiotensin II-induced aortic expansion, rupture and incidence of AAA. These results demonstrate the ability of IAXO-102 to neg. regulate TLR4 signalling and to inhibit exptl. AAA development, suggesting the potential therapeutic use of this TLR4 antagonist for pharmacol. intervention of AAA.
- 273Sun, M.; Deng, B.; Zhao, X.; Gao, C.; Yang, L.; Zhao, H.; Yu, D.; Zhang, F.; Xu, L.; Chen, L.; Sun, X. Isoflurane Preconditioning Provides Neuroprotection against Stroke by Regulating the Expression of the TLR4 Signalling Pathway to Alleviate Microglial Activation. Sci. Rep. 2015, 5, 11445, DOI: 10.1038/srep11445[Crossref], [PubMed], [CAS], Google Scholar273https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC2MbkvFCnsA%253D%253D&md5=b298a4a81cca128e4e377d96b5f000b3Isoflurane preconditioning provides neuroprotection against stroke by regulating the expression of the TLR4 signalling pathway to alleviate microglial activationSun Meiyan; Deng Bin; Zhao Xiaoyong; Gao Changjun; Yang Lu; Zhao Hui; Yu Daihua; Sun Xude; Deng Bin; Xu Lixian; Zhao Xiaoyong; Zhang Feng; Chen LeiScientific reports (2015), 5 (), 11445 ISSN:.Excessive microglial activation often contributes to inflammation-mediated neurotoxicity in the ischemic penumbra during the acute stage of ischemic stroke. Toll-like receptor 4 (TLR4) has been reported to induce microglial activation via the NF-κB pathway. Isoflurane preconditioning (IP) can provide neuroprotection and inhibit microglial activation. In this study, we investigated the roles of the TLR4 signalling pathway in IP to exert neuroprotection following ischemic stroke in vivo and in vitro. The results showed that 2% IP alleviated neurological deficits, reduced the infarct volume, attenuated apoptosis and weakened microglial activation in the ischemic penumbra. Furthermore, IP down-regulated the expression of HSP 60, TLR4 and MyD88 and up-regulated inhibitor of IκB-α expression compared with I/R group in vivo. In vitro, 2% IP and a specific inhibitor of TLR4, CLI-095, down-regulated the expression of TLR4, MyD88, IL-1β, TNF-α and Bax, and up-regulated IκB-α and Bcl-2 expression compared with OGD group. Moreover, IP and CLI-095 attenuated microglial activation-induced neuronal apoptosis, and overexpression of the TLR4 gene reversed the neuroprotective effects of IP. In conclusion, IP provided neuroprotection by regulating TLR4 expression directly, alleviating microglial activation and neuroinflammation. Thus, inhibiting the activation of microglial activation via TLR4 may be a new avenue for stroke treatment.
- 274Kapelouzou, A.; Giaglis, S.; Peroulis, M.; Katsimpoulas, M.; Moustardas, P.; Aravanis, C. V.; Kostakis, A.; Karayannakos, P. E.; Cokkinos, D. V. Overexpression of Toll-Like Receptors 2, 3, 4, and 8 Is Correlated to the Vascular Atherosclerotic Process in the Hyperlipidemic Rabbit Model: The Effect of Statin Treatment. J. Vasc. Res. 2017, 54 (3), 156– 169, DOI: 10.1159/000457797[Crossref], [PubMed], [CAS], Google Scholar274https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXps1aqs7s%253D&md5=fadabffe75a2b796dfffdd9e61a588dbOverexpression of Toll-Like Receptors 2, 3, 4, and 8 Is Correlated to the Vascular Atherosclerotic Process in the Hyperlipidemic Rabbit Model: The Effect of Statin TreatmentKapelouzou, Alkistis; Giaglis, Stavros; Peroulis, Michalis; Katsimpoulas, Michalis; Moustardas, Petros; Aravanis, Chrysostomos V.; Kostakis, Alkiviadis; Karayannakos, Panagiotis E.; Cokkinos, Dennis V.Journal of Vascular Research (2017), 54 (3), 156-169CODEN: JVREE9; ISSN:1018-1172. (S. Karger AG)Background: Atherosclerosis is the major cause of cardiovascular disease; hypercholesterolemia is a major risk factor. We hypothesized that specific TLR members (TLR2, TLR3, TLR4, TLR8) may play a role in atherosclerosis progression and its accompanying inflammatory response. We detd. the assocn. of atherosclerotic lesions and TLR mRNA expression in different aortic sites. We also assessed the effects of fluvastatin (Flu) treatment on TLR expression and plaque characteristics. Methods: Male rabbits, fed with an atherogenic diet for a duration of 3 mo, were screened for advanced atherosclerotic lesions in the aorta. Addnl. animals received normal diet or normal diet plus Flu for 1 addnl. month. TLR mRNA expression in various thoracic and abdominal aortic segments was assessed, together with atherosclerotic changes. Results: After high lipid diet, the atherosclerotic burden increased more in the abdominal than in the thoracic aorta; TLR2, 3, 4, and 8 also increased significantly. Flu decreased atherosclerotic plaque, calcium deposition, lipid cores, intraplaque hemorrhage, erythrocyte membranes, endothelial cells, and macrophage infiltration, while increasing smooth muscle cells in plaques of both aortic segments; it also lowered TLR2, 3, 4, and 8 expression in all aortic segments to a stronger degree than resumption of normal diet. There was a strong assocn. between blood and tissue parameters during exptl. period and finally a strong correlation found between these parameters with mRNA of TLR2, 3, 4, and 8 in various stages. Conclusion: For the first time TLR2, 3, 4, and 8 mRNA expression is prospectively explored after hypercholesterolemic diet in the rabbit model. TLR2, 3, 4, and 8 mRNA expression is strongly upregulated and correlates with the progression of atherosclerosis in the aorta. Flu significantly inhibited this progress and reduced inflammation via TLR downregulation which was strongly assocd. with regression of plaque morphol. and atherosclerosis promoting factors.
- 275Koulis, C.; Chen, Y. C.; Hausding, C.; Ahrens, I.; Kyaw, T. S.; Tay, C.; Allen, T.; Jandeleit-Dahm, K.; Sweet, M. J.; Akira, S.; Bobik, A.; Peter, K.; Agrotis, A. Protective Role for Toll-like Receptor-9 in the Development of Atherosclerosis in Apolipoprotein e-Deficient Mice. Arterioscler., Thromb., Vasc. Biol. 2014, 34 (3), 516– 525, DOI: 10.1161/ATVBAHA.113.302407[Crossref], [PubMed], [CAS], Google Scholar275https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXislGksbk%253D&md5=efc3b8511f4b8b152c0f795d3255434bProtective Role for Toll-Like Receptor-9 in the Development of Atherosclerosis in Apolipoprotein E-Deficient MiceKoulis, Christine; Chen, Yung-Chih; Hausding, Christian; Ahrens, Ingo; Kyaw, Tin Soe; Tay, Christopher; Allen, Terri; Jandeleit-Dahm, Karin; Sweet, Matthew J.; Akira, Shizuo; Bobik, Alexander; Peter, Karlheinz; Agrotis, AlexArteriosclerosis, Thrombosis, and Vascular Biology (2014), 34 (3), 516-525CODEN: ATVBFA; ISSN:1079-5642. (Lippincott Williams & Wilkins)OBJECTIVE-: Atherosclerosis is driven by inflammatory reactions that are shared with the innate immune system. Toll-like receptor-9 (TLR9) is an intracellular pattern recognition receptor of the innate immune system that is currently under clin. investigation as a therapeutic target in inflammatory diseases. Here, we investigated whether TLR9 has a role in the development of atherosclerosis in apolipoprotein E-deficient (ApoE) mice. APPROACH AND RESULTS-: Newly generated double-knockout ApoE:TLR9 mice and control ApoE mice were fed a high-fat diet from 8 wk and effects on lesion size, cellular compn., inflammatory status, and plasma lipids were assessed after 8, 12, 15, and 20 wk. All 4 time points demonstrated exacerbated atherosclerotic lesion severity in ApoE:TLR9 mice, with a corresponding increase in lipid deposition and accumulation of macrophages, dendritic cells, and CD4 T cells. Although ApoE:TLR9 mice exhibited an increase in plasma very low-d. lipoprotein/low-d.-lipoprotein cholesterol, the very low-d. lipoprotein/low-d. lipoprotein:high-d. lipoprotein ratio was unaltered because of a parallel increase in plasma high-d. lipoprotein cholesterol. As a potential mechanism accounting for plaque progression in ApoE:TLR9 mice, CD4 T-cell accumulation was further investigated and depletion of these cells in ApoE:TLR9 mice significantly reduced lesion severity. As a final translational approach, administration of a TLR9 agonist (type B CpG oligodeoxynucleotide 1668) to ApoE mice resulted in a redn. of lesion severity. CONCLUSIONS-: Genetic deletion of the innate immune receptor TLR9 exacerbated atherosclerosis in ApoE mice fed a high-fat diet. CD4 T cells were identified as potential mediators of this effect. A type B CpG oligodeoxynucleotide TLR9 agonist reduced lesion severity, thus identifying a novel therapeutic approach in atherosclerosis.
- 276McCarthy, C. G.; Wenceslau, C. F.; Goulopoulou, S.; Baban, B.; Matsumoto, T.; Webb, R. C. Chloroquine Suppresses the Development of Hypertension in Spontaneously Hypertensive Rats. Am. J. Hypertens. 2017, 30 (2), 173– 181, DOI: 10.1093/ajh/hpw113[Crossref], [PubMed], [CAS], Google Scholar276https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXivV2mt7w%253D&md5=a4a44ff4227e4bd68fc63620570a4873Chloroquine suppresses the development of hypertension in spontaneously hypertensive ratsMcCarthy, Cameron G.; Wenceslau, Camilla F.; Goulopoulou, Styliani; Baban, Babak; Matsumoto, Takayuki; Webb, R. ClintonAmerican Journal of Hypertension (2017), 30 (2), 173-181CODEN: AJHYE6; ISSN:1941-7225. (Oxford University Press)BACKGROUND Innate immune system responses to damage-assocd. mol. patterns (DAMPs) are involved in hypertension. However, the mechanisms of this contribution are not well understood. Circulating mitochondrial DNA is a DAMP that activates Toll-like receptor (TLR) 9 and is elevated in spontaneously hypertensive rats (SHR). Therefore, we hypothesized that lysosomotropic agent chloroquine (CQ) would impair TLR9 signaling, as well as prevent the development of hypertension and immune cell recruitment to the vasculature, in SHR. METHODS Initially, adult SHR and Wistar-Kyoto (WKY) rats (12 wk old), as well as a group of young SHR (5 wk old), were treated with CQ (40 mg/kg/ day) or vehicle (saline) via i.p. injections for 21 days and then TLR9-myeloid differentiation primary response protein (MyD88) signaling proteins were assessed in mesenteric resistance arteries (MRA) via western blot. Subsequently, young SHR and WKY were treated from 5-8 wk of age and then were allowed to mature without further treatment. Blood pressure was measured pretreatment, posttreatment, and after maturation, and immune cell recruitment to the vasculature was measured via flow cytometry after maturation. RESULTS In MRA from adult SHR, CQ increased the expression of MyD88- dependent proteins, whereas young SHR MRA exhibited a decrease. This inhibition was subsequently assocd. with suppression of blood pressure, as well as decreased counts of circulating T cells and vascular infiltrating leukocytes in SHR, when CQ was administered during the prehypertensive phase. CONCLUSIONS These data bring into question the participation of TLRs during the maintenance phase of hypertension and promote the exploration of innate immune system therapy during the crit. developmental phase.
- 277Carullo, G.; Governa, P.; Leo, A.; Gallelli, L.; Citraro, R.; Cione, E.; Caroleo, M. C.; Biagi, M.; Aiello, F.; Manetti, F. Quercetin-3-Oleate Contributes to Skin Wound Healing Targeting FFA1/GPR40. ChemistrySelect 2019, 4 (29), 8429– 8433, DOI: 10.1002/slct.201902572[Crossref], [CAS], Google Scholar277https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhsFChtr7J&md5=a24e4e5d93c3dbe919b3e2c7200f9413Quercetin-3-Oleate Contributes to Skin Wound Healing Targeting FFA1/GPR40Carullo, Gabriele; Governa, Paolo; Leo, Antonio; Gallelli, Luca; Citraro, Rita; Cione, Erika; Caroleo, Maria Cristina; Biagi, Marco; Aiello, Francesca; Manetti, FabrizioChemistrySelect (2019), 4 (29), 8429-8433CODEN: CHEMUD; ISSN:2365-6549. (Wiley-VCH Verlag GmbH & Co. KGaA)The hybrid mol. Quercetin-3-oleate (AV2), accommodates within the binding pocket for allosteric full GPR40 agonists. AV2 endorses skin wound healing acting as a promoter of keratinocytes proliferation and overcomes immunosuppressive conditions in vitro. AV2 stimulated HaCaT wound healing by 51% compared to the untreated control, at the concn. of 1 μM with slight TGF-β prodn. and MMP-9 release. Pretreatment with the known GPR40 antagonist DC260126 abolished its wound healing power. Docking simulations suggested that both mols. share the same binding site.
- 278Carullo, G.; Perri, M.; Manetti, F.; Aiello, F.; Caroleo, M. C.; Cione, E. Quercetin-3-Oleoyl Derivatives as New GPR40 Agonists: Molecular Docking Studies and Functional Evaluation. Bioorg. Med. Chem. Lett. 2019, 29 (14), 1761– 1764, DOI: 10.1016/j.bmcl.2019.05.018[Crossref], [PubMed], [CAS], Google Scholar278https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXpvVGrt7k%253D&md5=16b3502e11ef0aa88ccc19769a769f24Quercetin-3-oleoyl derivatives as new GPR40 agonists: Molecular docking studies and functional evaluationCarullo, Gabriele; Perri, Mariarita; Manetti, Fabrizio; Aiello, Francesca; Caroleo, Maria Cristina; Cione, ErikaBioorganic & Medicinal Chemistry Letters (2019), 29 (14), 1761-1764CODEN: BMCLE8; ISSN:0960-894X. (Elsevier B.V.)The G-protein-coupled receptor 40 (GPR40) is an attractive mol. target for the treatment of type 2 diabetes mellitus. Previously, based on the natural oleic acid substrate, an exogenous ligand for this receptor, named AV1, was synthesized. In this context, here we validated the activity of AV1 as a full agonist, while the corresponding catechol analog, named AV2, was investigated for the first time. The ligand-protein interaction between this new mol. and the receptor was highlighted in the lower portion of the GPR40 groove that generally accommodates DC260126. The functional assays performed have demonstrated that AV2 is a suitable GPR40 partial agonist, showing a therapeutic potential and representing a useful tool in the management of type 2 diabetes.
- 279Westwell-Roper, C.; Nackiewicz, D.; Dan, M.; Ehses, J. A. Toll-like Receptors and NLRP3 as Central Regulators of Pancreatic Islet Inflammation in Type 2 Diabetes. Immunol. Cell Biol. 2014, 92 (4), 314– 323, DOI: 10.1038/icb.2014.4[Crossref], [PubMed], [CAS], Google Scholar279https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2cXitFahsbw%253D&md5=d60d7895df6722e5646f1f32c44b274fToll-like receptors and NLRP3 as central regulators of pancreatic islet inflammation in type 2 diabetesWestwell-Roper, Clara; Nackiewicz, Dominika; Dan, Meixia; Ehses, Jan A.Immunology & Cell Biology (2014), 92 (4), 314-323CODEN: ICBIEZ; ISSN:0818-9641. (NPG Nature Asia-Pacific)A review. The global health and economic burden of type 2 diabetes (T2D) has reached staggering proportions. Current projections est. that 592 million people will have diabetes by 2035. T2D-which comprises 90% of cases-is a complex disease, in most cases resulting from a combination of predisposing genes and an unhealthy environment. Clin. onset of the disease occurs when pancreatic β cells fail in the face of insulin resistance. It has long been appreciated that chronic activation of the innate immune system is assocd. with T2D, and many organs crit. to the regulation of glucose homeostasis show signs of a chronic inflammatory process, including the pancreatic islets of Langerhans. Recent clin. trials using IL-1-targeting agents have confirmed that inflammation contributes to β-cell failure in humans with T2D. However, little is known about the nature of the pro-inflammatory response within the islet, and there is considerable debate about the triggers for islet inflammation, which may be systemically derived and/or tissue-specific. In this review, we present evidence that Toll-like receptors 2 and 4 and the NLRP3 (Nucleotide-binding oligomerization domain, Leucine-rich Repeat and Pyrin domain contg. 3) inflammasome are triggers for islet inflammation in T2D and propose that the activation of macrophages by these triggers mediates islet endocrine cell dysfunction. Therapeutically targeting these receptors may improve hyperglycemia and protect the β cell in T2D.
- 280Rada, I.; Deldicque, L.; Francaux, M.; Zbinden-Foncea, H. Toll like Receptor Expression Induced by Exercise in Obesity and Metabolic Syndrome: A Systematic Review. Exerc. Immunol. Rev. 2018, 24 (14), 60– 71[PubMed], [CAS], Google Scholar280https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC1MrjsVKqsA%253D%253D&md5=be3fef2390848c11473f8880b1ad1cecToll like receptor expression induced by exercise in obesity and metabolic syndrome: A systematic reviewRada Isabel; Zbinden-Foncea Hermann; Deldicque Louise; Francaux MarcExercise immunology review (2018), 24 (), 60-71 ISSN:1077-5552.BACKGROUND: Obesity and metabolic syndrome are disorders that correlate with the activation of pro-inflammatory pathways and cytokine production, to which Toll like receptors (TLR) contribute. Exercise may act as an anti-inflammatory modulator, but there is no consensus about the role of the TLR in this tuning. The present styudy aims to systematically review the current evidence on exercise-induced TLR regulation in animals and humans suffering from obesity and metabolic syndrome. METHODS: Pubmed and Scopus databases were searched for publications from 1990 to September 2015. Search terms included: "Toll like Receptor", "TLR", "exercise", "obesity", "diabetes", and "metabolic syndrome". Elegibility criteria comprised: randomized control trials, cross-sectional and cohort studies; human or animal models with metabolic syndrome; any type of exercise; TLR expression measurement in any tissue by a clearly reported technique. The quality of selected studies was assessed using a modified version of the Downs and Black Quality Assessment Checklist. Data of study design; population; exercise type, timing and training elements; measurement technique, tissue analyzed and main outcome were extracted and categorized to facilitate data synthesis. RESULTS: 17 studies were included, of which 11 publications obtained a high, 5 a moderate and 1 a low score for quality assessment. A total of 8 human studies were analyzed: 6 studies used endurance continuous or interval training protocols, 1 study resistance training and the remaining study was performed following a marathon race. Blood cells were analyzed in seven studies, of which four studies sampled peripheral blood mononuclear cells (PBMC), three analyzed whole blood and one study sampled skeletal muscle. Nine animal studies were included: 8 used endurance training and 1 acute aerobic exercise. A variety of tissues samples were explored such as PBMC, skeletal muscle, adipose, vascular and nervous tissue. Globally, the animal studies showed a marked tendency towards a down-regulation of TLR2 and 4 expression accompagnied with, a reduced activation of nuclear factorkappaB (NF-κB) signaling and cytokine production, and an improvement in insulin sensitivity and body composition. CONCLUSION: While animal studies showed a marked tendency towards TLR2 and 4 down-regulation after chronic endurance exercise, the current evidence in human is not sufficiently robust to conclude any role of TLR in the anti-inflammatory properties of exercise.
- 281Singh, K.; Singh, K.; Agrawal, N. K.; Gupta, S. K.; Mohan, G.; Chaturvedi, S. Genetic and Epigenetic Alterations in Toll like Receptor 2 and Wound Healing Impairment in Type 2 Diabetes Patients. J. Diabetes Complications 2015, 29 (2), 222– 229, DOI: 10.1016/j.jdiacomp.2014.11.015[Crossref], [PubMed], [CAS], Google Scholar281https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC2MvhvFGjtg%253D%253D&md5=424f8411970997e79f65b58e42d1c0ecGenetic and epigenetic alterations in Toll like receptor 2 and wound healing impairment in type 2 diabetes patientsSingh Kanhaiya; Agrawal Neeraj K; Gupta Sanjeev K; Mohan Gyanendra; Chaturvedi Sunanda; Singh KiranJournal of diabetes and its complications (2015), 29 (2), 222-9 ISSN:.AIM: Persistent hyperglycemic microenvironment in type 2 diabetes mellitus (T2DM) leads to the development of secondary complications like wound healing impairment. Proper co-ordination of innate immune system plays an integral role in wound healing. Toll like receptors (TLRs) are prominent contributors for the induction of the innate immune and inflammation response. TLR2 is an important extracellular member in mammalian TLR family and has been shown to be a potent player in the wound healing mechanism. METHODS: Expressional status of TLR2 was seen in wounds of T2DM cases with respect to the severity of wounds in 110 human lower extremity wounds. The methylation status of TLR2 promoter was also examined. RESULTS: Although TLR2 transcripts were downregulated in T2DM wounds compared to control, their levels tend to increase with the severity of T2DM wounds. The methylation status of TLR2 gene promoter was not significantly different among different grades of wounds in T2DM subjects. The CpG sites investigated were totally or partially methylated in majority of DFU cases. CONCLUSION: TLR2 down regulation in wounds of T2DM patients compared to non diabetic patients may lead to development of non healing chronic ulcers in them.
- 282Zaharieva, E.; Velikova, T.; Tsakova, A.; Kamenov, Z. Reduced Soluble Toll-like Receptors 2 in Type 2 Diabetes. Arch. Physiol. Biochem. 2018, 124 (4), 326– 329, DOI: 10.1080/13813455.2017.1401642[Crossref], [PubMed], [CAS], Google Scholar282https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXhvVGisLbI&md5=eee76d8c72d30d9dc2e0ffbf7c3a5b14Reduced soluble Toll-like receptors 2 in type 2 diabetesZaharieva, Emanuela; Velikova, Tsvetelina; Tsakova, Adelina; Kamenov, ZdravkoArchives of Physiology and Biochemistry (2018), 124 (4), 326-329CODEN: APBIF5; ISSN:1381-3455. (Taylor & Francis Ltd.)Sol. forms of Toll-like receptors (sTLR) 2 and 4 exert neg. regulatory control on membrane-bound receptor activation. The study ests. the sTLR2 and sTLR4's serum levels in type 2 diabetes (T2D) and evaluates their relationship with metabolic and inflammatory parameters. Sixty three patients with T2D and 25 controls were enrolled. sTLR were assayed through ELISA. Inflammatory markers included Interleukin 6 (IL-6), high sensitivity C-reactive protein (hs-CRP) and tumor necrosis factor α. Anal. demonstrated lower sTLR2 level in T2D than in control subjects (1.15 ± 0.65 vs. 1.44 ± 0.60 ng/mL, p = .019) while sTLR4 level remained similar (0.09 ± 0.16 vs. 0.07 ± 0.12 ng/mL, p > .05) despite higher IL-6 (2.65 ± 2.46 vs. 1.44 ± 0.22 pg/mL, p = .005) and hs-CRP (2.79 ± 2.89 vs. 0.70 ± 0.89 mg/l, p < .001) concns. Neither sTLR correlated with BMI, HbA1c, plasma glucose and analyzed cytokines (p > .05). The sTLR2 serum level in T2D patients was reduced despite elevated inflammatory parameters.
- 283Pahwa, R.; Jialal, I. Hyperglycemia Induces Toll-Like Receptor Activity Through Increased Oxidative Stress. Metab. Syndr. Relat. Disord. 2016, 14 (5), 239– 241, DOI: 10.1089/met.2016.29006.pah[Crossref], [PubMed], [CAS], Google Scholar283https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XotF2itbc%253D&md5=2d951bfe1da46e44796a8591b906c582Hyperglycemia Induces Toll-Like Receptor Activity Through Increased Oxidative StressPahwa, Roma; Jialal, IshwarlalMetabolic Syndrome and Related Disorders (2016), 14 (5), 239-241CODEN: MSRDBF; ISSN:1540-4196. (Mary Ann Liebert, Inc.)Hyperglycemia-induced oxidative stress and inflammation are central in the genesis of diabetic vascular complications. Toll-like receptors (TLRs) play a crucial role in promoting inflammatory responses and are known to be activated in diabetic patients. Also in animal models, they have been shown to have a role in the pathogenesis of diabetic vasculopathies. However, the mechanisms underlying this increase in TLR activity in diabetes are not well documented. Since increased reactive oxygen species (ROS) are also produced in various tissues under diabetic conditions, we postulated that ROS act as a potential activator of TLR. Several studies support our hypothesis that hyperglycemia-induced oxidative stress appears to be an important factor in promoting TLR activity in monocytes, both microvascular and macrovascular endothelial cells and cardiomyocytes and in animal models. Most importantly, the increase in ROS and TLR activity is ameliorated with antioxidant strategies. Thus, targeting ROS/NADPH oxidase with small mol. inhibitors could be a promising strategy to reduce both oxidative stress and TLR-mediated inflammation in diabetic vascular diseases.
- 284Sepehri, Z.; Kiani, Z.; Nasiri, A. A.; Kohan, F. Toll-like Receptor 2 and Type 2 Diabetes. Cell. Mol. Biol. Lett. 2016, 21, 2, DOI: 10.1186/s11658-016-0002-4[Crossref], [PubMed], [CAS], Google Scholar284https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXkslGkurc%253D&md5=1d9c8b6fc26cc61be2d2ad9a693d408fToll-like receptor 2 and type 2 diabetesSepehri, Zahra; Kiani, Zohre; Nasiri, Ali Akbar; Kohan, FarhadCellular & Molecular Biology Letters (2016), 21 (), 2/1-2/9CODEN: CMBLFF; ISSN:1689-1392. (BioMed Central Ltd.)Innate immunity plays a crucial role in the pathogenesis of type 2 diabetes and related complications. Since the toll-like receptors (TLRs) are central to innate immunity, it appears that they are important participants in the development and pathogenesis of the disease. Previous investigations demonstrated that TLR2 homodimers and TLR2 heterodimers with TLR1 or TLR6 activate innate immunity upon recognition of damage-assocd. mol. patterns (DAMPs). Several DAMPs are released during type 2 diabetes, so it may be hypothesized that TLR2 is significantly involved in its progression. Here, we review recent data on the important roles and status of TLR2 in type 2 diabetes and related complications.
- 285Sepehri, Z.; Kiani, Z.; Javadian, F.; Akbar Nasiri, A.; Kohan, F.; Sepehrikia, S.; Javan Siamardi, S.; Aali, H.; Daneshvar, H.; Kennedy, D. TLR3 and Its Roles in the Pathogenesis of Type 2 Diabetes. Cell. Mol. Biol. 2015, 61 (3), 46– 50, DOI: 10.14715/cmb/2015.61.3.10[Crossref], [PubMed], [CAS], Google Scholar285https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC2MbktlKltw%253D%253D&md5=3af868c2bdc95ffa4ae41e53100ee2bfTLR3 and its roles in the pathogenesis of type 2 diabetesSepehri Z; Aali H; Kiani Z; Javadian F; Akbar Nasiri A; Kohan F; Sepehrikia S; Javan Siamardi S; Daneshvar H; Kennedy DCellular and molecular biology (Noisy-le-Grand, France) (2015), 61 (3), 46-50 ISSN:.Type 2 diabetes (T2D) is the most prevalent non—infectious disease and leads to several complications including nephropathy and retinopathy. The mechanisms and signaling molecules responsible for the development and progression of T2D, as well as its associated complications are yet to be identified. It would appear that genetic backgrounds and immunological parameters of people susceptible to T2D may play important roles in induction of T2D. TLRs participate in several cellular pathways which can induce activation of proliferation. However, in contradiction, these pathways can also be associated with apoptosis. The multiple roles of TLRs and their signaling molecules associated with T2D pathways makes them candidates for the induction of immune—regulated diseases like T2D. TLR3 has been identified as an intracellular ligand and subsequently activates signaling molecules via the TRIF pathway. Therefore, the alteration of expression of TLR3 and their functions may lead to inappropriate induction of immune system functions that are related to T2D disease. The aim of this review was to collect recent data regarding the roles of TLR3 in the progression and pathogenesis of T2D.
- 286Rogero, M. M.; Calder, P. C. Obesity, Inflammation, Toll-like Receptor 4 and Fatty Acids. Nutrients 2018, 10 (4), 432, DOI: 10.3390/nu10040432[Crossref], [CAS], Google Scholar286https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXitlOjtLrO&md5=204e9f3af12041c00699b9197bb87954Obesity, inflammation, toll-like receptor 4 and fatty acidsRogero, Marcelo Macedo; Calder, Philip C.Nutrients (2018), 10 (4), 432/1-432/19CODEN: NUTRHU; ISSN:2072-6643. (MDPI AG)A review. Obesity leads to an inflammatory condition that is directly involved in the etiol. of cardiovascular diseases, type 2 diabetes mellitus, and certain types of cancer. The classic inflammatory response is an acute reaction to infections or to tissue injuries, and it tends to move towards resoln. and homeostasis. However, the inflammatory process that was obsd. in individuals affected by obesity and metabolic syndrome differs from the classical inflammatory response in certain respects. This inflammatory process manifests itself systemically and it is characterized by a chronic low-intensity reaction. The toll-like receptor 4 (TLR4) signaling pathway is acknowledged as one of the main triggers of the obesity-induced inflammatory response. The aim of the present review is to describe the role that is played by the TLR4 signaling pathway in the inflammatory response and its modulation by satd. and omega-3 polyunsatd. fatty acids. Studies indicate that satd. fatty acids can induce inflammation by activating the TLR4 signaling pathway. Conversely, omega-3 polyunsatd. fatty acids, such as eicosapentaenoic acid and docosahexaenoic acid, exert anti-inflammatory actions through the attenuation of the activation of the TLR4 signaling pathway by either lipopolysaccharides or satd. fatty acids.
- 287Portou, M. J.; Yu, R.; Baker, D.; Xu, S.; Abraham, D.; Tsui, J. Hyperglycaemia and Ischaemia Impair Wound Healing via Toll-like Receptor 4 Pathway Activation in Vitro and in an Experimental Murine Model. Eur. J. Vasc. Endovasc. Surg. 2020, 59 (1), 117– 127, DOI: 10.1016/j.ejvs.2019.06.018[Crossref], [PubMed], [CAS], Google Scholar287https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB3MjpslSktw%253D%253D&md5=a0e2b88ca875c416f67e4b0f69e0c23eHyperglycaemia and Ischaemia Impair Wound Healing via Toll-like Receptor 4 Pathway Activation in vitro and in an Experimental Murine ModelPortou Mark J; Yu Rebekah; Baker Daryll; Tsui Janice; Xu Shiwen; Abraham DavidEuropean journal of vascular and endovascular surgery : the official journal of the European Society for Vascular Surgery (2020), 59 (1), 117-127 ISSN:.OBJECTIVE: Diabetes mellitus has reached epidemic proportions. Foot ulceration is a multifactorial complication of diabetes associated with marked morbidity and mortality. Innate immune Toll-like receptor 4 (TLR4) mediated inflammation has been implicated in the systemic pathogenesis of diabetes and may contribute to impairment of wound healing. This study investigates the effect of high glucose and hypoxic conditions on TLR4 activation and signalling in vitro and in vivo. METHODS: Fibroblasts cultured at physiological glucose concentration (5.5 mM) were exposed to glucose concentrations from 0 mM to 25 mM, with duplicates placed in a hypoxic chamber. TLR4 inhibition was assessed in the 25 mM glucose groups. Diabetes was induced in wild type (WT) and TLR4 knockout (KO) C57BL/6 mice by intraperitoneal injection of low dose streptozocin (STZ). Hindlimb ischaemia was induced by femoral artery ligation four weeks post streptozocin, and a full thickness 4 mm skin wound inflicted below the knee. Wound healing was assessed via digital planimetry on days 3, 7, and 14 post surgery. RESULTS: Hypoxic and high glucose (25 mM) conditions led to an increase in TLR4 protein expression, apoptosis, and interleukin (IL)-6 release. Inhibition with a TLR4 neutralising antibody and specific TLR4 antagonist ameliorated the effects of high glucose and ischaemia (p < .05). In vivo, wound healing was significantly impaired in the diabetic ischaemic group at day 14 (p < .05). Diabetic ischaemic wounds in TLR4 KO mice exhibited significantly improved healing rates compared with those in WT mice at all time points. CONCLUSION: Hypoxia stimulates upregulation of TLR4 protein expression and this effect is exaggerated by hyperglycaemia. In TLR4 KO mice, there is a significant improvement in the healing of diabetic ischaemic wounds compared with WT. It is suggested that a synergistic effect between hypoxia and hyperglycaemia impairing wound healing exists, through TLR4 mediated inflammation.
- 288Karpova, T.; de Oliveira, A. A.; Naas, H.; Priviero, F.; Nunes, K. P. Blockade of Toll-like Receptor 4 (TLR4) Reduces Oxidative Stress and Restores Phospho-ERK1/2 Levels in Leydig Cells Exposed to High Glucose. Life Sci. 2020, 245, 117365, DOI: 10.1016/j.lfs.2020.117365[Crossref], [PubMed], [CAS], Google Scholar288https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXivVegurc%253D&md5=d4d153386a039d18cc21911a15664737Blockade of Toll-like receptor 4 (TLR4) reduces oxidative stress and restores phospho-ERK1/2 levels in Leydig cells exposed to high glucoseKarpova, Tatiana; Almeida de Oliveira, Amanda; Naas, Huda; Priviero, Fernanda; Nunes, Kenia PedrosaLife Sciences (2020), 245 (), 117365CODEN: LIFSAK; ISSN:0024-3205. (Elsevier B.V.)Hyperglycemia in combination with oxidative stress plays a significant pathophysiol. role in diabetic testicular dysfunction, often leading to infertility. Activation of Toll-like receptor 4 (TLR4) has been reported to mediate oxidative stress during diabetes. However, engagement of the TLR4 signaling pathway in diabetic testicular dysfunction has not been previously explored. Herein, we investigated the role of TLR4 in reactive oxygen species (ROS) prodn. and in the phosphorylation status of ERK1/2 in primary Leydig cells exposed to high glucose and in testis isolated from diabetic rats. Testicular levels of TLR4 and phospho-ERK1/2 were detd. by Western blotting. ROS prodn. was detected with a fluorescent probe. Addnl., primary Leydig cells were exposed to normal (5.5 mmol/l) or elevated (33 mmol/l) glucose concns. and treated with or without a TLR4 inhibitor, CLI095 (10-5 mol/l) for 24 h, followed by evaluation of TLR4 and phospho-ERK1/2 expression levels by Western blotting and immunofluorescence staining, resp. We show that high glucose induces the expression of TLR4 in Leydig cells. Addnl., we demonstrate that blockade of this receptor in this cell population reduces oxidative stress and restores the levels of phospho-ERK1/2. Our findings provide new insight into TLR4 interaction with ROS and MEK/ERK pathway in Leydig cells exposed to high glucose and present a rationale for the development of new therapeutics for diabetic testicular dysfunction.
- 289Wang, H.; Zhang, Q.; Chai, Y.; Liu, Y.; Li, F.; Wang, B.; Zhu, C.; Cui, J.; Qu, H.; Zhu, M. 1,25(OH)2D3 Downregulates the Toll-like Receptor 4-Mediated Inflammatory Pathway and Ameliorates Liver Injury in Diabetic Rats. J. Endocrinol. Invest. 2015, 38 (10), 1083– 1091, DOI: 10.1007/s40618-015-0287-6[Crossref], [PubMed], [CAS], Google Scholar289https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XhvFSju7k%253D&md5=7c79f07bbd93d28fcba6ba9012b185ae1,25(OH)2D3 downregulates the Toll-like receptor 4-mediated inflammatory pathway and ameliorates liver injury in diabetic ratsWang, H.; Zhang, Q.; Chai, Y.; Liu, Y.; Li, F.; Wang, B.; Zhu, C.; Cui, J.; Qu, H.; Zhu, M.Journal of Endocrinological Investigation (2015), 38 (10), 1083-1091CODEN: JEIND7; ISSN:0391-4097. (Springer International Publishing AG)Background: Fatty acid deposition in the liver can activate a no. of pro-inflammatory signaling pathways such as the Toll-like receptor 4 (TLR4) pathway, which may be important in the pathogenesis of nonalcoholic steatohepatitis. 1,25(OH)2D3 downregulates the expression of TLR4 and may represent a novel treatment strategy for reducing hepatocyte injury. Therefore, in this study, we investigated the protective effects of 1,25(OH)2D3 on diabetic liver injury in vivo. Methods: Streptozotocin (STZ)-induced diabetic rats were randomly divided into five groups and treated with low-dose 1,25(OH)2D3 (0.025 μg/kg/day), medium-dose 1,25(OH)2D3 (0.15 μg/kg/day), high-dose 1,25(OH)2D3 (0.3 μg/kg/day), insulin (protamine zinc insulin 16 U/kg/day, s.c. injection), or no intervention (the control group). Sixteen weeks later, the rats were killed, and blood samples were obtained to test lipid profiles and hepatic function. The infiltration of inflammatory cells, the level of fibrosis, and the expression levels of TLR4, nuclear factor-kappa B (NF-κB), and tumor necrosis factor-α (TNF-α) in the liver were analyzed. The hepatocytes were treated with vehicle control, LPS (100 ng), high fat [DMEM + FFA (0.1 mM: palmitic acid, oleic acid, 1:2)], LPS + high fat, vehicle + 1,25(OH)2D3 (10-7 M), LPS + 1,25(OH)2D3, high fat + 1,25(OH)2D3, or LPS + high fat + 1,25(OH)2D3. RNA and protein were extd. to detect the expression of TLR4 and downstream inflammatory factors such as NF-κB, TNF-α, and IL-6. Groups of data were compared by single factor variance anal. Results: High-dose 1,25(OH)2D3 administration for 16 wk downregulated the expression of TLR4, NF-κB, and TNF-α in the liver tissue of diabetic rats and attenuated hepatic inflammation and fibrosis, as shown by immunohistochem. staining, hematoxylin and eosin staining, Masson's trichrome staining, reverse transcription polymerase chain reaction (RT-PCR), and western blotting. In vitro, hepatocytes treated with high fat or LPS exhibited significantly increased expression of TLR4, NF-κB, and downstream inflammatory factors (P < 0.05). Intervention with 1,25(OH)2D3 decreased the expression of TLR4, NF-κB, and inflammatory factors (P < 0.05). Conclusions: 1,25(OH)2D3 exhibited protective effects against diabetes-related liver injury, possibly through downregulation of components of the TLR4 signaling pathway.
- 290Yu, R.; Bo, H.; Villani, V.; Spencer, P. J.; Fu, P. The Inhibitory Effect of Rapamycin on Toll Like Receptor 4 and Interleukin 17 in the Early Stage of Rat Diabetic Nephropathy. Kidney Blood Pressure Res. 2016, 41 (1), 55– 69, DOI: 10.1159/000368547[Crossref], [PubMed], [CAS], Google Scholar290https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28Xjt1ejuro%253D&md5=c33e3ec28adbd56d8d86acedaf10fe85The Inhibitory Effect of Rapamycin on Toll Like Receptor 4 and Interleukin 17 in the Early Stage of Rat Diabetic NephropathyYu, Ruichao; Bo, Hong; Villani, Vincenzo; Spencer, Philip J.; Fu, PingKidney & Blood Pressure Research (2016), 41 (1), 55-69CODEN: KBPRFC; ISSN:1420-4096. (S. Karger AG)Background/Aims: There is increasing evidence showing that innate immune responses and inflammatory processes play an important role in the development and progression of diabetic nephropathy (DN). The potential effect of innate immunity in the early stage of DN is still unclear. Toll-Like-Receptor 4 (TLR4) is vigorously involved in the progress of kidney diseases in a sterile environment. The activation of the interleukin 17 (IL-17) pathway produces inflammatory cytokines, appearing in various kidney diseases. Unfortunately the relationship between TLR4 and IL-17 has not been investigated in diabetic nephropathy to date. The aim of this study is to investigate whether mammalian target of rapamycin (mTOR) inhibition may be dependent on TLR4 signaling and the pro-inflammatory factor IL-17 to delay the progression of DN. Methods: Streptozotocin (STZ)-induced diabetic rats were randomly assigned to 3 exptl. groups: a diabetic nephropathy group (DN, n = 6); and a diabetic nephropathy treated with rapamycin group (Rapa, n = 6) and a control group (Control, n =6). Body wt., fasting blood sugar, and 24h urine albumin were assessed at week 2, week 4 and week 8. Renal tissues were harvested for H&E, PAS staining, as well as an immunohistochem. assay for TLR4 and IL-17. TLR4 quant. expression was measured by Western-Blot anal. and RT-PCR. Results: Our results demonstrated that the expression of both TLR4 and IL-17 were upregulated in early stage DN and reduced by rapamycin. TLR4 and IL-17 both increased and pos. related to 24h urinary albumin and kidney/wt. ratio. However, neither TLR4 nor IL-17 made a significant difference on fasting blood sugar. Conclusions: Taken together, our results confirm and extend previous studies identifying the significance of the TLR4 and Th17 pathways in development of early stage DN. Furthermore, we suggest this overexpression of TLR4 might be involved in the immunopathogenesis of DN through activation of Th17 cells. Rapamycin may attenuate DN via redn. of the TLR4 signaling pathway and Th17 cells signaling. Although the underlying mechanisms need to be explored, the obsd. increase of TLR4 and IL-17 during the early stages of DN and their suppression with rapamycin treatment suggest the importance of TLR4 and IL-17 in DN pathophysiol.
- 291Lin, M.; Yiu, W. H.; Li, R. X.; Wu, H. J.; Wong, D. W. L.; Chan, L. Y. Y.; Leung, J. C. K.; Lai, K. N.; Tang, S. C. W. The TLR4 Antagonist CRX-526 Protects against Advanced Diabetic Nephropathy. Kidney Int. 2013, 83 (5), 887– 900, DOI: 10.1038/ki.2013.11[Crossref], [PubMed], [CAS], Google Scholar291https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXntVWqtbk%253D&md5=4697ed2343a5e2e12656f0110351808aThe TLR4 antagonist CRX-526 protects against advanced diabetic nephropathyLin, Miao; Yiu, Wai Han; Li, Rui Xi; Wu, Hao Jia; Wong, Dickson W. L.; Chan, Loretta Y. Y.; Leung, Joseph C. K.; Lai, Kar Neng; Tang, Sydney C. W.Kidney International (2013), 83 (5), 887-900CODEN: KDYIA5; ISSN:0085-2538. (Nature Publishing Group)We recently showed that Toll-like receptor (TLR) TLR4 was overexpressed in the human diabetic kidney, which could promote tubular inflammation. Here we explored whether the TLR4 antagonist, CRX-526, has therapeutic potential to attenuate renal injuries and slow the progression of advanced diabetic nephropathy in wild-type and endothelial nitric oxide synthase (eNOS) knockout mice. In the latter, the endogenous TLR4 ligand, high-mobility group box 1, was upregulated more than in wild-type animals. Four weeks after streptozotocin induction of diabetes, mice were injected with either CRX-526 or vehicle for 8 wk. CRX-526 significantly reduced albuminuria and blood urea nitrogen without altering blood glucose and systolic blood pressure in diabetic mice. Glomerular hypertrophy, glomerulosclerosis, and tubulointerstitial injury were attenuated by CRX-526, which was assocd. with decreased chemokine (C-C motif) ligand (CCL)-2, osteopontin, CCL-5 overexpression, subsequent macrophage infiltration, and collagen deposition. These effects were assocd. with inhibition of TGF-β overexpression and NF-κB activation. In vitro, CRX-526 inhibited high glucose-induced osteopontin upregulation and NF-κB nuclear translocation in cultured human proximal tubular epithelial cells. Thus, we provided evidence that inhibition of TLR4 with the synthetic antagonist CRX-526 conferred renoprotective effects in eNOS knockout diabetic mice with advanced diabetic nephropathy. Kidney International (2013) 83, 887-900; doi:10.1038/ki.2013.11; published online 20 Feb. 2013.
- 292Dasu, M. R.; Ramirez, S.; Isseroff, R. R. Toll-like Receptors and Diabetes: A Therapeutic Perspective. Clin. Sci. 2012, 122 (5), 203– 214, DOI: 10.1042/CS20110357[Crossref], [PubMed], [CAS], Google Scholar292https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3MXhsVCksLjL&md5=fe91e352c631e9a5745ca7cb4c691a6dToll-like receptors and diabetes: a therapeutic perspectiveDasu, Mohan R.; Ramirez, Sandra; Isseroff, Roslyn R.Clinical Science (2012), 122 (5/6), 203-214CODEN: CSCIAE; ISSN:0143-5221. (Portland Press Ltd.)A review. Diabetes is a multifactorial metabolic disorder that leads to a no. of complications. Diabetes is estd. to affect 36 million people in the U.S.A., and the prevalence of diagnosed and undiagnosed diabetes is at 9.3% and continues to rise. Evidence from exptl. animal models as well as humans has indicated that systemic inflammation plays a role in the pathophysiol. processes of diabetes and is facilitated by innate immune responses. TLRs (Toll-like receptors) are key innate immune receptors that recognize conserved PAMPs (pathogen-assocd. mol. patterns), induce inflammatory responses essential for host defences and initiate an adaptive immune response. Although TLR expression is increased in a plethora of inflammatory disorders, the effects of metabolic aberrations on TLRs and their role in diabetes and its complications is still emerging. In the present paper, we provide a systematic review on how TLRs play a detrimental role in the pathogenic processes [increased blood sugar, NEFAs (non-esterified free' fatty acids), cytokines and ROS (reactive oxygen species)] that manifest diabetes. Furthermore, we will highlight some of the therapeutic strategies targeted at decreasing TLRs to abrogate inflammation in diabetes that may eventually result in decreased complications.
- 293Hayward, J. H.; Lee, S. J. A Decade of Research on TLR2 Discovering Its Pivotal Role in Glial Activation and Neuroinflammation in Neurodegenerative Diseases. Exp. Neurobiol. 2014, 23 (2), 138– 147, DOI: 10.5607/en.2014.23.2.138[Crossref], [PubMed], [CAS], Google Scholar293https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC2cfmsFyhsA%253D%253D&md5=eccb103351c7f6f5f44ed90478ddf6b7A Decade of Research on TLR2 Discovering Its Pivotal Role in Glial Activation and Neuroinflammation in Neurodegenerative DiseasesHayward Jin Hee; Lee Sung JoongExperimental neurobiology (2014), 23 (2), 138-47 ISSN:1226-2560.Toll-like receptors (TLRs) belong to a class of pattern recognition receptors that play an important role in host defense against pathogens. TLRs on innate immune cells recognize a wide variety of pathogen-associated molecular patterns (PAMPs) and trigger innate immune responses. Later, it was revealed that the same receptors are also utilized to detect tissue damage to trigger inflammatory responses in the context of non-infectious inflammation. In the nervous system, different members of the TLR family are expressed on glial cells including astrocytes, microglia, oligodendrocytes, and Schwann cells, implicating their putative role in innate/inflammatory responses in the nervous system. In this regard, we have investigated the function of TLRs in neuroinflammation. We discovered that a specific member of the TLR family, namely TLR2, functions as a master sentry receptor to detect neuronal cell death and tissue damage in many different neurological conditions including nerve transection injury, intracerebral hemorrhage, traumatic brain injury, and hippocampal excitotoxicity. In this review, we have summarized our research for the last decade on the role of TLR2 in neuroinflammation in the above neurological disorders. Our data suggest that TLR2 can be an efficient target to regulate unwanted inflammatory response in these neurological conditions.
- 294Rangasamy, S. B.; Jana, M.; Roy, A.; Corbett, G. T.; Kundu, M.; Chandra, S.; Mondal, S.; Dasarathi, S.; Mufson, E. J.; Mishra, R. K.; Luan, C. H.; Bennett, D. A.; Pahan, K. Selective Disruption of TLR2-MyD88 Interaction Inhibits Inflammation and Attenuates Alzheimer’s Pathology. J. Clin. Invest. 2018, 128 (10), 4297– 4312, DOI: 10.1172/JCI96209[Crossref], [PubMed], [CAS], Google Scholar294https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB3c%252FmsFGrsg%253D%253D&md5=92f997711b4deb1df2b09bd4e80e1ceaSelective disruption of TLR2-MyD88 interaction inhibits inflammation and attenuates Alzheimer's pathologyRangasamy Suresh B; Jana Malabendu; Roy Avik; Corbett Grant T; Kundu Madhuchhanda; Chandra Sujyoti; Mondal Susanta; Dasarathi Sridevi; Pahan Kalipada; Mufson Elliott J; Mishra Rama K; Luan Chi-Hao; Bennett David A; Pahan KalipadaThe Journal of clinical investigation (2018), 128 (10), 4297-4312 ISSN:.Induction of TLR2 activation depends on its association with the adapter protein MyD88. We have found that TLR2 and MyD88 levels are elevated in the hippocampus and cortex of patients with Alzheimer's disease (AD) and in a 5XFAD mouse model of AD. Since there is no specific inhibitor of TLR2, to target induced TLR2 from a therapeutic angle, we engineered a peptide corresponding to the TLR2-interacting domain of MyD88 (TIDM) that binds to the BB loop of only TLR2, and not other TLRs. Interestingly, WT TIDM peptide inhibited microglial activation induced by fibrillar Aβ1-42 and lipoteichoic acid, but not 1-methyl-4-phenylpyridinium, dsRNA, bacterial lipopolysaccharide, flagellin, or CpG DNA. After intranasal administration, WT TIDM peptide reached the hippocampus, reduced hippocampal glial activation, lowered Aβ burden, attenuated neuronal apoptosis, and improved memory and learning in 5XFAD mice. However, WT TIDM peptide was not effective in 5XFAD mice lacking TLR2. In addition to its effects in 5XFAD mice, WT TIDM peptide also suppressed the disease process in mice with experimental allergic encephalomyelitis and collagen-induced arthritis. Therefore, selective targeting of the activated status of 1 component of the innate immune system by WT TIDM peptide may be beneficial in AD as well as other disorders in which TLR2/MyD88 signaling plays a role in disease pathogenesis.
- 295Kwon, S.; Iba, M.; Masliah, E.; Kim, C. Targeting Microglial and Neuronal Toll-like Receptor 2 in Synucleinopathies. Exp. Neurobiol. 2019, 28 (5), 547– 553, DOI: 10.5607/en.2019.28.5.547[Crossref], [PubMed], [CAS], Google Scholar295https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB3MjmtlegtA%253D%253D&md5=e182dea6144d38fdf8d9be7974ec6e26Targeting Microglial and Neuronal Toll-like Receptor 2 in SynucleinopathiesKwon Somin; Iba Michiyo; Masliah Eliezer; Kim ChangyounExperimental neurobiology (2019), 28 (5), 547-553 ISSN:1226-2560.Synucleinopathies are neurodegenerative disorders characterized by the progressive accumulation of α-synuclein (α-syn) in neurons and glia and include Parkinson's disease (PD) and dementia with Lewy bodies (DLB). In this review, we consolidate our key findings and recent studies concerning the role of Toll-like receptor 2 (TLR2), a pattern recognition innate immune receptor, in the pathogenesis of synucleinopathies. First, we address the pathological interaction of α-syn with microglial TLR2 and its neurotoxic inflammatory effects. Then, we show that neuronal TLR2 activation not only induces abnormal α-syn accumulation by impairing autophagy, but also modulates α-syn transmission. Finally, we demonstrate that administration of a TLR2 functional inhibitor improves the neuropathology and behavioral deficits of a synucleinopathy mouse model. Altogether, we present TLR2 modulation as a promising immunotherapy for synucleinopathies.
- 296Fiebich, B. L.; Batista, C. R. A.; Saliba, S. W.; Yousif, N. M.; de Oliveira, A. C. P. Role of Microglia TLRs in Neurodegeneration. Front. Cell. Neurosci. 2018, 12, 329, DOI: 10.3389/fncel.2018.00329[Crossref], [PubMed], [CAS], Google Scholar296https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhvFyjt7rO&md5=b52b7a17d8604b2181ac5152901e01d7Role of microglia TLR in neurodegenerationFiebich, Bernd L.; Batista, Carla Ribeiro Alvares; Saliba, Soraya Wilke; Yousif, Nizar M.; Pinheiro de Oliveira, Antonio CarlosFrontiers in Cellular Neuroscience (2018), 12 (), 329CODEN: FCNRAH; ISSN:1662-5102. (Frontiers Media S.A.)Toll-like receptors (TLRs) are a group of receptors widely distributed in the organism. In the central nervous system, they are expressed in neurons, astrocytes and microglia. Although their involvement in immunity is notorious, different articles have demonstrated their roles in physiol. and pathol. conditions, including neurodegeneration. There is increasing evidence of an involvement of TLRs, esp. TLR2, 4 and 9 in neurodegenerative diseases such as Alzheimer's disease (AD), Parkinson's disease (PD), and amyotrophic lateral sclerosis (ALS). In this sense, their expression in microglia might modulate the activity of these cells, which in turn, lead to protective or deleterious effects over neurons and other cells. Therefore, TLRs might mediate the link between inflammation and neurodegenerative diseases. However, further studies have to be performed to elucidate the role of the other TLRs in these diseases and to further prove and confirm the pathophysiol. role of all TLRs in neurodegeneration. In this article, we revise and summarize the current knowledge regarding the role of TLRs in neurodegeneration with the focus on the possible functions of these receptors in microglia.
- 297Mulfaul, K.; Ozaki, E.; Fernando, N.; Brennan, K.; Chirco, K. R.; Connolly, E.; Greene, C.; Maminishkis, A.; Salomon, R. G.; Linetsky, M.; Natoli, R.; Mullins, R. F.; Campbell, M.; Doyle, S. L. Toll-like Receptor 2 Facilitates Oxidative Damage-Induced Retinal Degeneration. Cell Rep. 2020, 30 (7), 2209– 2224.e5, DOI: 10.1016/j.celrep.2020.01.064[Crossref], [PubMed], [CAS], Google Scholar297https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXls1CrurY%253D&md5=5420f058925d597585db64b7dd80a1d8Toll-like Receptor 2 Facilitates Oxidative Damage-Induced Retinal DegenerationMulfaul, Kelly; Ozaki, Ema; Fernando, Nilisha; Brennan, Kiva; Chirco, Kathleen R.; Connolly, Emma; Greene, Chris; Maminishkis, Arvydas; Salomon, Robert G.; Linetsky, Mikhail; Natoli, Riccardo; Mullins, Robert F.; Campbell, Matthew; Doyle, Sarah L.Cell Reports (2020), 30 (7), 2209-2224.e5CODEN: CREED8; ISSN:2211-1247. (Cell Press)Retinal degeneration is a form of neurodegenerative disease and is the leading cause of vision loss globally. The Toll-like receptors (TLRs) are primary components of the innate immune system involved in signal transduction. Here we show that TLR2 induces complement factors C3 and CFB, the common and rate-limiting factors of the alternative pathway in both retinal pigment epithelial (RPE) cells and mononuclear phagocytes. Neutralization of TLR2 reduces opsonizing fragments of C3 in the outer retina and protects photoreceptor neurons from oxidative stress-induced degeneration. TLR2 deficiency also preserves tight junction expression and promotes RPE resistance to fragmentation. Finally, oxidative stress-induced formation of the terminal complement membrane attack complex and Iba1+ cell infiltration are strikingly inhibited in the TLR2-deficient retina. Our data directly implicate TLR2 as a mediator of retinal degeneration in response to oxidative stress and present TLR2 as a bridge between oxidative damage and complement-mediated retinal pathol.
- 298Kohno, H.; Chen, Y.; Kevany, B. M.; Pearlman, E.; Miyagi, M.; Maeda, T.; Palczewski, K.; Maeda, A. Photoreceptor Proteins Initiate Microglial Activation via Toll-like Receptor 4 in Retinal Degeneration Mediated by All-Trans-Retinal. J. Biol. Chem. 2013, 288 (21), 15326– 15341, DOI: 10.1074/jbc.M112.448712[Crossref], [PubMed], [CAS], Google Scholar298https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3sXot1Wit7o%253D&md5=a9dd51f7758d0d0acccdb1bc17629c23Photoreceptor proteins initiate microglial activation via toll-like receptor 4 in retinal degeneration mediated by all-trans-retinalKohno, Hideo; Chen, Yu; Kevany, Brian M.; Pearlman, Eric; Miyagi, Masaru; Maeda, Tadao; Palczewski, Krzysztof; Maeda, AkikoJournal of Biological Chemistry (2013), 288 (21), 15326-15341CODEN: JBCHA3; ISSN:0021-9258. (American Society for Biochemistry and Molecular Biology)Although several genetic and biochem. factors are assocd. with the pathogenesis of retinal degeneration, it has yet to be detd. how these different impairments can cause similar degenerative phenotypes. Here, we report microglial/macrophage activation in both a Stargardt disease and age-related macular degeneration mouse model caused by delayed clearance of all-trans-retinal from the retina, and in a retinitis pigmentosa mouse model with impaired retinal pigment epithelium (RPE) phagocytosis. Mouse microglia displayed RPE cytotoxicity and increased prodn. of inflammatory chemokines/cytokines, Ccl2, Il1b, and Tnf, after coincubation with ligands that activate innate immunity. Notably, phagocytosis of photoreceptor proteins increased the activation of microglia/macrophages and RPE cells isolated from model mice as well as wild-type mice. The mRNA levels of Tlr2 and Tlr4, which can recognize proteins as their ligands, were elevated in mice with retinal degeneration. Bone marrow-derived macrophages from Tlr4-deficient mice did not increase Ccl2 after coincubation with photoreceptor proteins. Tlr4-/-Abca4-/-Rdh8-/- mice displayed milder retinal degenerative phenotypes than Abca4-/-Rdh8-/- mice. Addnl., inactivation of microglia/macrophages by pharmacol. approaches attenuated mouse retinal degeneration. This study demonstrates an important contribution of TLR4-mediated microglial activation by endogenous photoreceptor proteins in retinal inflammation that aggravates retinal cell death. This pathway is likely to represent an underlying common pathol. in degenerative retinal disorders.
- 299Huang, Z.; Zhou, T.; Sun, X.; Zheng, Y.; Cheng, B.; Li, M.; Liu, X.; He, C. Necroptosis in Microglia Contributes to Neuroinflammation and Retinal Degeneration through TLR4 Activation. Cell Death Differ. 2018, 25 (1), 180– 189, DOI: 10.1038/cdd.2017.141[Crossref], [PubMed], [CAS], Google Scholar299https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2sXhsVKlsL%252FP&md5=71daa04c318f096174ada4a5470b57e0Necroptosis in microglia contributes to neuroinflammation and retinal degeneration through TLR4 activationHuang, Zijing; Zhou, Tian; Sun, Xiaowei; Zheng, Yingfeng; Cheng, Bing; Li, Mei; Liu, Xialin; He, ChangCell Death & Differentiation (2018), 25 (1), 180-189CODEN: CDDIEK; ISSN:1350-9047. (Nature Research)Inflammation has emerged to be a crit. mechanism responsible for neural damage and neurodegenerative diseases. Microglia, the resident innate immune cells in retina, are implicated as principal components of the immunol. insult to retinal neural cells. The involvement of microglia in retinal inflammation is complex and here we propose for the first time that necroptosis in microglia triggers neuroinflammation and exacerbates retinal neural damage and degeneration. We found microglia experienced receptor-interacting protein kinase 1 (RIP1)- and RIP3-dependent necroptosis not only in the retinal degenerative rd1 mice, but also in the acute retinal neural injury mice. The necroptotic microglia released various pro-inflammatory cytokines and chemokines, such as tumor necrosis factor-α and chemokine (C-C motif) ligand 2, which orchestrated the retinal inflammation. Importantly, necroptosis blockade using necrostatin-1 could suppress microglia-mediated inflammation, rescue retinal degeneration or prevent neural injury in vivo. Meanwhile, cultured microglia underwent RIP1/3-mediated necroptosis and the necroptotic microglia produced large amts. of pro-inflammatory cytokines in response to lipopolysaccharide or oxidative stress in vitro. Mech., TLR4 deficiency ameliorated microglia necroptosis with decreased expression levels of machinery mols. RIP1 and RIP3, and suppressed retinal inflammation, suggesting that TLR4 signaling was required in microglia necroptosis-mediated inflammation. Thus, we proposed that microglia experienced necroptosis through TLR4 activation, promoting an inflammatory response that serves to exacerbate considerable neural damage and degeneration. Necroptosis blockade therefore emerged as a novel therapeutic strategy for tempering microglia-mediated neuroinflammation and ameliorating neural injury and neurodegenerative diseases.
- 300Liao, W. Y.; Tsai, T. H.; Ho, T. Y.; Lin, Y. W.; Cheng, C. Y.; Hsieh, C. L. Neuroprotective Effect of Paeonol Mediates Anti-Inflammation via Suppressing Toll-like Receptor 2 and Toll-like Receptor 4 Signaling Pathways in Cerebral Ischemia-Reperfusion Injured Rats. Evidence-based Complement. Altern. Med. 2016, 2016, 3704647, DOI: 10.1155/2016/3704647[Crossref], [PubMed], [CAS], Google Scholar300https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC1c7ntFWjtQ%253D%253D&md5=7503d213963543ad680a9539bcf2473aNeuroprotective Effect of Paeonol Mediates Anti-Inflammation via Suppressing Toll-Like Receptor 2 and Toll-Like Receptor 4 Signaling Pathways in Cerebral Ischemia-Reperfusion Injured RatsLiao Wen-Yen; Ho Tin-Yun; Tsai Tung-Hu; Lin Yi-Wen; Cheng Chin-Yi; Hsieh Ching-LiangEvidence-based complementary and alternative medicine : eCAM (2016), 2016 (), 3704647 ISSN:1741-427X.Paeonol is a phenolic compound derived from Paeonia suffruticosa Andrews (MC) and P. lactiflora Pall (PL). Paeonol can reduce cerebral infarction volume and improve neurological deficits through antioxidative and anti-inflammatory effects. However, the anti-inflammatory pathway of paeonol remains unclear. This study investigated the relationship between anti-inflammatory responses of paeonol and signaling pathways of TLR2 and TLR4 in cerebral infarct. We established the cerebral ischemia-reperfusion model in Sprague Dawley rats by occluding right middle cerebral artery for 60 min, followed by reperfusion for 24 h. The neurological deficit score was examined, and the brains of the rats were removed for cerebral infarction volume and immunohistochemistry (IHC) analysis. The infarction volume and neurological deficits were lower in the paeonol group (pretreatment with paeonol; 20 mg/kg i.p.) than in the control group (without paeonol treatment). The IHC analysis revealed that the number of TLR2-, TLR4-, Iba1-, NF-κB- (P50-), and IL-1β-immunoreactive cells and TUNEL-positive cells was significantly lower in the paeonol group; however, the number of TNF-α-immunoreactive cells did not differ between the paeonol and control groups. The paeonol reveals some neuroprotective effects in the model of ischemia, which could be due to the reduction of many proinflammatory receptors/mediators, although the mechanisms are not clear.
- 301Zhao, R.; Zhang, J.; Wang, Y.; Jin, J.; Zhou, H.; Chen, J.; Su, S. B. Activation of Toll-like Receptor 3 Promotes Pathological Corneal Neovascularization by Enhancement of SDF-1-Mediated Endothelial Progenitor Cell Recruitment. Exp. Eye Res. 2019, 178, 177– 185, DOI: 10.1016/j.exer.2018.10.005[Crossref], [PubMed], [CAS], Google Scholar301https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1cXhvFejtbbK&md5=f78b6dc2f05f7761b94d0a1711a89d45Activation of Toll-like receptor 3 promotes pathological corneal neovascularization by enhancement of SDF-1-mediated endothelial progenitor cell recruitmentZhao, Ruijuan; Zhang, Jing; Wang, Yan; Jin, Jiayi; Zhou, Hongyan; Chen, Jianping; Su, Shao BoExperimental Eye Research (2019), 178 (), 177-185CODEN: EXERA6; ISSN:0014-4835. (Elsevier Ltd.)Toll-like receptors (TLRs) play an important role in inflammatory and immunol. responses, which are intimately related to neovascularization. However, the precise mode of action of TLR3 in neovascularization still remains ambiguous. In this study, we sought to investigate the role of TLR3 in pathol. corneal neovascularization (CNV) using a mouse model of alkali-induced CNV. CNV was attenuated in TLR3-deficient mice, and the absence of TLR3 led to decreased prodn. of stromal cell-derived factor 1 (SDF-1), a well-characterized cytokine that regulates the recruitment of endothelial progenitor cells (EPCs) to the sites of neo-angiogenic niches in the injured tissues. Topical administration of polyinosinic-polycytidylic acid [poly (I:C)], a synthetic ligand for TLR3, to the injured cornea promoted CNV in wild type (WT) mice but not in TLR3-deficient mice. In addn., the effect of poly (I:C) on WT mice was abolished by addn. of SDF-1 receptor antagonist AMD 3100. Furthermore, poly (I:C) treatment in vitro enhanced the migration of EPCs, whereas the enhanced migration was abolished by AMD 3100. These results indicate an essential role of TLR3 signalling in CNV that involves upregulating SDF-1 prodn. and recruiting EPCs to the sites of injury for neovascularization. Thus, targeting the TLR3 signalling cascade may constitute a novel therapeutic approach for treating neovascularization-related diseases.
- 302Leitner, G. R.; Wenzel, T. J.; Marshall, N.; Gates, E. J.; Klegeris, A. Targeting Toll-like Receptor 4 to Modulate Neuroinflammation in Central Nervous System Disorders. Expert Opin. Ther. Targets 2019, 23 (10), 865– 882, DOI: 10.1080/14728222.2019.1676416[Crossref], [PubMed], [CAS], Google Scholar302https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB3Mnks1Cqug%253D%253D&md5=e9ee1cb7b3db6b0bc6d873543cd88705Targeting toll-like receptor 4 to modulate neuroinflammation in central nervous system disordersLeitner Gunnar R; Wenzel Tyler J; Marshall Nick; Gates Ellen J; Klegeris AndisExpert opinion on therapeutic targets (2019), 23 (10), 865-882 ISSN:.Introduction: Adverse immune activation contributes to many central nervous system (CNS) disorders. All main CNS cell types express toll-like receptor 4 (TLR 4). This receptor is critical for a myriad of immune functions such as cytokine secretion and phagocytic activity of microglia; however, imbalances in TLR 4 activation can contribute to the progression of neurodegenerative diseases. Areas covered: We considered available evidence implicating TLR 4 activation in the following CNS pathologies: Alzheimer's disease, Parkinson's disease, ischemic stroke, traumatic brain injury, multiple sclerosis, multiple systems atrophy, and Huntington's disease. We reviewed studies reporting effects of TLR 4-specific antagonists and agonists in models of peripheral and CNS diseases from the perspective of possible future use of TLR 4 ligands in CNS disorders. Expert opinion: TLR 4-specific antagonists could suppress neuroinflammation by reducing overproduction of inflammatory mediators; however, they may interfere with protein clearance mechanisms and myelination. Agonists that specifically activate myeloid differentiation primary-response protein 88 (MyD88)-independent pathway of TLR 4 signaling could facilitate beneficial glial phagocytic activity with limited activity as inducers of proinflammatory mediators. Deciphering the disease stage-specific involvement of TLR 4 in CNS pathologies is crucial for the future clinical development of TLR 4 agonists and antagonists.
- 303Chavali, V. D.; Agarwal, M.; Vyas, V. K.; Saxena, B. Neuroprotective Effects of Ethyl Pyruvate against Aluminum Chloride-Induced Alzheimer’s Disease in Rats via Inhibiting Toll-Like Receptor 4. J. Mol. Neurosci. 2020, 70, 836– 850, DOI: 10.1007/s12031-020-01489-9[Crossref], [PubMed], [CAS], Google Scholar303https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXislCnt7o%253D&md5=c17f83ce6b4d1546ca8c69509295a64eNeuroprotective Effects of Ethyl Pyruvate against Aluminum Chloride-Induced Alzheimer's Disease in Rats via Inhibiting Toll-Like Receptor 4Chavali, Vijaya Durga; Agarwal, Milee; Vyas, Vivek Kumar; Saxena, BhagawatiJournal of Molecular Neuroscience (2020), 70 (6), 836-850CODEN: JMNEES; ISSN:0895-8696. (Humana Press Inc.)The present study aimed to investigate the neuroprotective role of Et pyruvate against in vitro and in vivo model of aluminum chloride (AlCl3)-induced AD. In vivo model, AlCl3 (50 mg/kg) were given through i.p. route (i.p.) once daily for 4 wk in rats and after 2 wk, Et pyruvate (50, 100, 200 mg/kg/day) was co-administered with AlCl3 once daily via the oral route. The present study, in addn. to perform histopathol. of the brain, also estd. oxidant and antioxidant parameters as well as memory impairment using pole test, plus maze, and Morris water maze test. The binding mode of Et pyruvate in the hMD-2 was also studied. AlCl3 administration in rats resulted in memory loss, oxidative stress (increased lipid peroxide and nitric oxide), impairment of antioxidant mechanisms (superoxide dismutase, catalase, and reduced glutathione), and deposition of amyloid plaques in cerebral cortex region of the brain. AlCl3 also resulted in the overexpression of the TLR4 receptors in the brain tissues. Administration of Et pyruvate ameliorated the AlCl3-induced neurotoxicity in neuron-glial mixed cell culture as well as histopathol., neurochem., and behavioral consequences of chronic administration of AlCl3 in the rat. Et pyruvate showed a docking score of 4.048. Thus, Et pyruvate is effective against in vitro and in vivo models of AlCl3-induced AD.
- 304Kamigaki, M.; Hide, I.; Yanase, Y.; Shiraki, H.; Harada, K.; Tanaka, Y.; Seki, T.; Shirafuji, T.; Tanaka, S.; Hide, M.; Sakai, N. The Toll-like Receptor 4-Activated Neuroprotective Microglia Subpopulation Survives via Granulocyte Macrophage Colony-Stimulating Factor and JAK2/STAT5 Signaling. Neurochem. Int. 2016, 93, 82– 94, DOI: 10.1016/j.neuint.2016.01.003[Crossref], [PubMed], [CAS], Google Scholar304https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XhvFSqu7Y%253D&md5=dfd68a98d3d9c0843b28fb8ec48beb2bThe Toll-like receptor 4-activated neuroprotective microglia subpopulation survives via granulocyte macrophage colony-stimulating factor and JAK2/STAT5 signalingKamigaki, Mayumi; Hide, Izumi; Yanase, Yuhki; Shiraki, Hiroko; Harada, Kana; Tanaka, Yoshiki; Seki, Takahiro; Shirafuji, Toshihiko; Tanaka, Shigeru; Hide, Michihiro; Sakai, NorioNeurochemistry International (2016), 93 (), 82-94CODEN: NEUIDS; ISSN:0197-0186. (Elsevier Ltd.)Toll-like receptor (TLR) 4 mediates inflammation and is also known to trigger apoptosis in microglia. Our time-lapse observations showed that lipopolysaccharide (LPS) stimulation induced rapid death in primary cultures of rat microglia, while a portion of the microglia escaped from death and survived for much longer than 2 days, in which time, all of the control cells had died. However, it remains unclear how the LPS-stimulated microglia subpopulation could continue to survive in the absence of any supplied growth factors. In the present study, to clarify the mechanism underlying the LPS-stimulated survival, we investigated whether microglia could produce their own survival factors in response to LPS, focusing on macrophage colony-stimulating factor (M-CSF), granulocyte macrophage colony-stimulating factor (GM-CSF) and interleukin (IL)-34, which are mainly supplied by astrocytes or neurons. The LPS-stimulated microglia drastically induced the expression of the GM-CSF mRNA and protein, while M-CSF and IL-34 levels were unchanged. The surviving microglia also significantly upregulated the expression of GM-CSF receptor (GM-CSFR) mRNA without affecting M-CSFR. As for the GM-CSFR downstream signal, LPS resulted in the phosphorylation of STAT5 and its translocation to the nucleus in the surviving microglia. Moreover, a specific JAK2 inhibitor, NVP-BSK805, suppressed STAT5 phosphorylation and microglia survival in response to LPS, indicating a crit. role of the JAK2/STAT5 pathway in this survival mechanism. Together, these results suggest that a subpopulation of TLR4-activated microglia may survive by producing GM-CSF and up-regulating GM-CSFR. This autocrine GM-CSF pathway may activate the JAK2/STAT5 signaling pathway, which controls the transcription of survival-related genes. Finally, these surviving microglia may have neuroprotective functions because the neurons remained viable in co-cultures with these microglia.
- 305Feng, Y.; Gao, J.; Cui, Y.; Li, M.; Li, R.; Cui, C.; Cui, J. Neuroprotective Effects of Resatorvid Against Traumatic Brain Injury in Rat: Involvement of Neuronal Autophagy and TLR4 Signaling Pathway. Cell. Mol. Neurobiol. 2017, 37 (1), 155– 168, DOI: 10.1007/s10571-016-0356-1[Crossref], [PubMed], [CAS], Google Scholar305https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XksVyhu74%253D&md5=f937ed42018bfa32354adb68e47e178aNeuroprotective Effects of Resatorvid Against Traumatic Brain Injury in Rat: Involvement of Neuronal Autophagy and TLR4 Signaling PathwayFeng, Yan; Gao, Junling; Cui, Ying; Li, Minghang; Li, Ran; Cui, Changmeng; Cui, JianzhongCellular and Molecular Neurobiology (2017), 37 (1), 155-168CODEN: CMNEDI; ISSN:0272-4340. (Springer)Accumulating evidence indicates that autophagy and inflammatory responses contributes to secondary brain injury after traumatic brain injury (TBI), and toll-like receptor 4 (TLR4) is considered to involvement of this cascade and plays an important role. The present study was designed to det. the hypothesis that administration of resatorvid (TAK-242), a TLR4 antagonist, might provide a neuroprotective effect by inhibit TLR4-mediated pathway in a TBI rat model. Rat subjected to controlled cortical impact injury were injected with TAK-242 (0.5 mg/kg, i.v. injected) 10 min prior to injury. The results demonstrated that TAK-242 treatment significantly attenuated TBI-induced neurons loss, brain edema, and neurobehavioral impairment in rats. Immunoblotting anal. showed that TAK-242 treatment reduced TBI-induced TLR4, Beclin 1, and LC3-II levels, and maintained p62 levels at 24 h. Double immunolabeling demonstrated that LC3 dots co-localized with the hippocampus pyramidal neurons, and TLR4 was localized with the hippocampus neurons and astrocytes. In addn., the expression of TLR4 downstream signaling mols., including MyD88, TRIF, NF-κB, TNF-α, and IL-1β, was significantly downregulated in hippocampus tissue by Western blot anal. In conclusion, our findings indicate that pre-injury treatment with TAK-242 could inhibit neuronal autophagy and neuroinflammation responses in the hippocampus in a rat model of TBI. The neuroprotective effects of TAK-242 may be related to modulation of the TLR4-MyD88/TRIF-NF-κB signaling pathway. Furthermore, the study also suggests that TAK-242, an attractive potential drug, may be a promising drug candidate for TBI.
- 306Yang, L.; Zhou, R.; Tong, Y.; Chen, P.; Shen, Y.; Miao, S.; Liu, X. Neuroprotection by Dihydrotestosterone in LPS-Induced Neuroinflammation. Neurobiol. Dis. 2020, 140, 104814, DOI: 10.1016/j.nbd.2020.104814[Crossref], [PubMed], [CAS], Google Scholar306https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXms1yksLc%253D&md5=fff1da4f572a8c57a5bff744209c447aNeuroprotection by dihydrotestosterone in LPS-induced neuroinflammationYang, Lei; Zhou, Renyuan; Tong, Yu; Chen, Pengfei; Shen, Yu; Miao, Shuai; Liu, XiaoqiangNeurobiology of Disease (2020), 140 (), 104814CODEN: NUDIEM; ISSN:0969-9961. (Elsevier Inc.)Microglia-induced neuroinflammation plays a vital role in the etiol. and progression of neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease and multiple sclerosis. The neuroprotective role of androgens, including testosterone and its metabolite dihydrotestosterone (DHT), has been increasingly demonstrated in these diseases, but few studies investigated the effects of androgen on neuroinflammation. This study investigated the role of DHT in lipopolysaccharide (LPS)-induced neuroinflammation, neuronal damage and behavioral dysfunction, as well as underlying mechanisms. We showed that DHT inhibited LPS-induced release of proinflammatory factors, including TNF-α, IL-1β, IL-6; iNOS, COX-2, NO, and PGE2 in BV2 cells and primary microglia by suppressing the TLR4-mediated NF-κB and MAPK p38 signaling pathways, thus protecting SH-SY5Y neurons from inflammatory damage induced by activated microglia. In an LPS-induced neuroinflammation mouse model, endogenous DHT depletion by castration exacerbated inflammatory responses by upregulating the levels of TNF-α, IL-1β, IL-6, iNOS, and COX-2 in the serum and brain by increasing the LR4-mediated NF-κB and MAPK pathway activation, but these effects were restored by exogenous DHT supplementation. Moreover, DHT also regulated the mRNA levels of the anti-inflammatory cytokines IL-10 and IL-13 in the brain. In addn., DHT modulated the expression of Aβ, the apoptotic proteins caspase-3, Bcl-2, and Bax, and synaptophysin, as well as neuronal damage in LPS-treated mouse brains. Further behavioral tests revealed that DHT ameliorated LPS-induced spatial and learning impairment and motor incoordination, and partly improved the locomotor activity in LPS-injected mice. Therefore, this study suggests that DHT exerts anti-neuroinflammatory and neuroprotective effects; thus, androgen replacement therapy is a potential therapeutic strategy for improving cognitive and behavioral function in neuroinflammation-related diseases.
- 307De Paola, M.; Mariani, A.; Bigini, P.; Peviani, M.; Ferrara, G.; Molteni, M.; Gemma, S.; Veglianese, P.; Castellaneta, V.; Boldrin, V.; Rossetti, C.; Chiabrando, C.; Forloni, G.; Mennini, T.; Fanelli, R. Neuroprotective Effects of Toll-like Receptor 4 Antagonism in Spinal Cord Cultures and in a Mouse Model of Motor Neuron Degeneration. Mol. Med. 2012, 18 (6), 971– 981, DOI: 10.2119/molmed.2012.00020[Crossref], [PubMed], [CAS], Google Scholar307https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC38XhsVWgsrfI&md5=8b742990a09e929bc66f3a83b59a627fNeuroprotective effects of Toll-like receptor 4 antagonism in spinal cord cultures and in a mouse model of motor neuron degenerationDe Paola, Massimiliano; Mariani, Alessandro; Bigini, Paolo; Peviani, Marco; Ferrara, Giovanni; Molteni, Monica; Gemma, Sabrina; Veglianese, Pietro; Castellaneta, Valeria; Boldrin, Valentina; Rossetti, Carlo; Chiabrando, Chiara; Forloni, Gianluigi; Mennini, Tiziana; Fanelli, RobertoMolecular Medicine (Manhasset, NY, United States) (2012), 18 (6), 971-981CODEN: MOMEF3; ISSN:1076-1551. (Feinstein Institute for Medical Research)Sustained inflammatory reactions are common pathol. events assocd. with neuron loss in neurodegenerative diseases. Reported evidence suggests that Toll-like receptor 4 (TLR4) is a key player of neuroinflammation in several neurodegenerative diseases. However, the mechanisms by which TLR4 mediates neurotoxic signals remain poorly understood. We investigated the role of TLR4 in in vitro and in vivo settings of motor neuron degeneration. Using primary cultures from mouse spinal cords, we characterized both the proinflammatory and neurotoxic effects of TLR4 activation with lipopolysaccharide (activation of microglial cells, release of proinflammatory cytokines and motor neuron death) and the protective effects of a cyanobacteria-derived TLR4 antagonist (VB3323). With the use of TLR4-deficient cells, a crit. role of the microglial component with functionally active TLR4 emerged in this setting. The in vivo expts. were carried out in a mouse model of spontaneous motor neuron degeneration, the wobbler mouse, where we preliminarily confirmed a protective effect of TLR4 antagonism. Compared with vehicle- and riluzole-treated mice, those chronically treated with VB3323 showed a decrease in microglial activation and morphol. alterations of spinal cord neurons and a better performance in the paw abnormality and grip-strength tests. Taken together, our data add new understanding of the role of TLR4 in mediating neurotoxicity in the spinal cord and suggest that TLR4 antagonists could be considered in future studies as candidate protective agents for motor neurons in degenerative diseases.
- 308Ikram, M.; Muhammad, T.; Rehman, S. U.; Khan, A.; Jo, M. G.; Ali, T.; Kim, M. O. Hesperetin Confers Neuroprotection by Regulating Nrf2/TLR4/NF-KB Signaling in an Aβ Mouse Model. Mol. Neurobiol. 2019, 56 (9), 6293– 6309, DOI: 10.1007/s12035-019-1512-7[Crossref], [PubMed], [CAS], Google Scholar308https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXmt1ymsb8%253D&md5=08541b9d7da0921a52aa08476fa6433bHesperetin Confers Neuroprotection by Regulating Nrf2/TLR4/NF-KB Signaling in an amyloid beta Mouse ModelIkram, Muhammad; Muhammad, Tahir; Rehman, Shafiq Ur; Khan, Amjad; Jo, Min Gi; Ali, Tahir; Kim, Myeong OkMolecular Neurobiology (2019), 56 (9), 6293-6309CODEN: MONBEW; ISSN:0893-7648. (Humana Press Inc.)Here, we hypothesized that hesperetin may protect the mice brain against Abeta-induced neurodegeneration. Our results indicated that hesperetin significantly attenuated oxidative stress, as assessed by the expression of Nrf2/HO-1 and LPO and ROS assays, in the hippocampus, cortex, and in vitro HT22 cells. Similarly, activated glial cells were regulated by hesperetin, as assessed by the expression of GFAP and Iba-1. Moreover, the expression of TLR4, p-NF-KB, and downstream targets was analyzed; the results showed that hesperetin reinstated the expression of these markers. The effects of hesperetin were further confirmed by using specific TLR4 and p-NF-kB inhibitors in BV-2 cells. Next, we evaluated Abeta pathol. in the cortex, hippocampus, and HT22 cells, showing that hesperetin significantly reduced the A beta pathol. Furthermore, the antiapoptotic effects of hesperetin were assessed, which showed strong antiapoptotic effects. Overall, the neuroprotective effect of hesperetin was found to be a multipotent effect, involving the inhibition of oxidative stress, neuroinflammation, apoptotic cell death, and cognitive consolidation. Given antioxidant, anti-inflammatory, and antiapoptotic potentials against A beta-induced neurodegeneration and memory impairment, hesperetin may be a promising therapeutic agent for Alzheimer's disease-like neurol. disorders.
- 309Jiwrajka, M.; Phillips, A.; Butler, M.; Rossi, M.; Pocock, J. M. The Plant-Derived Chalcone 2,2′,5′-Trihydroxychalcone Provides Neuroprotection against Toll-Like Receptor 4 Triggered Inflammation in Microglia. Oxid. Med. Cell. Longevity 2016, 2016, 6301712, DOI: 10.1155/2016/6301712[Crossref], [PubMed], [CAS], Google Scholar309https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC28njsFSgsw%253D%253D&md5=61c8f66a4406902c91ea4bf9148a1c1cThe Plant-Derived Chalcone 2,2',5'-Trihydroxychalcone Provides Neuroprotection against Toll-Like Receptor 4 Triggered Inflammation in MicrogliaJiwrajka Manasi; Phillips Alexandra; Butler Matt; Pocock Jennifer M; Rossi MiriamOxidative medicine and cellular longevity (2016), 2016 (), 6301712 ISSN:.Chalcones are plant metabolites with potential for therapeutic exploitation as antioxidant, anti-inflammatory, and antiproliferative agents. Here we explored the neuroprotective effects of 2,2',5'-trihydroxychalcone (225THC), a potent antioxidant with radical-scavenging properties. 225THC was found to be a potent inhibitor of apoptosis in stimulated primary rat neuronal cultures. This was likely mediated by an anti-inflammatory effect on microglial cells since 225THC inhibited LPS-stimulated TNF-α and IL-6 secretion from primary rat microglia and modulated the cytokine/chemokine profile of BV2 microglial cells. Additionally, 225THC inhibited LPS-evoked inducible nitric oxide synthase expression but did not influence endogenous superoxide generation. Microglial flow cytometric analyses indicated the 225THC treatment induced a shift from an M1-like phenotype to a more downregulated microglial profile. Taken together these data suggest that the chalcone 2,2',5'-trihydroxychalcone can modulate neuroinflammatory activation in brain-derived microglia and holds promise as a therapeutic in neuroinflammatory conditions.
- 310Zhu, X.; Liu, J.; Chen, O.; Xue, J.; Huang, S.; Zhu, W.; Wang, Y. Neuroprotective and Anti-Inflammatory Effects of Isoliquiritigenin in Kainic Acid-Induced Epileptic Rats via the TLR4/MYD88 Signaling Pathway. Inflammopharmacology 2019, 27 (6), 1143– 1153, DOI: 10.1007/s10787-019-00592-7[Crossref], [PubMed], [CAS], Google Scholar310https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhtFWmsbfM&md5=98a2b02d2eb34b12d5b06c70559e8bceNeuroprotective and anti-inflammatory effects of isoliquiritigenin in kainic acid-induced epileptic rats via the TLR4/MYD88 signaling pathwayZhu, Xiaobo; Liu, Jiankun; Chen, Ou; Xue, Jiang; Huang, Shanying; Zhu, Weiwei; Wang, YibiaoInflammopharmacology (2019), 27 (6), 1143-1153CODEN: IAOAES; ISSN:0925-4692. (Birkhaeuser Basel)Epileptogenesis is a complex pathol. process that occurs after an initial brain injury and involves a series of mol. events. Isoliquiritigenin (ISL), a flavonoid in licorice, is reported to have anti-inflammatory and antioxidant effects in various exptl. models, but its specific roles and mol. mechanisms in the epileptogenic process following kainic acid (KA) treatment remain unclear. The purpose of this study was to explore the effects of ISL pretreatment in KA-induced epileptic rats and the underlying mechanisms. Our findings show that ISL pretreatment significantly attenuated the KA-induced expression of ionized calcium-binding adapter mol. 1 (IBα1)-labeled microglia (F(3,20) = 97.29, p < 0.01, η p2 = 0.94) and glial fibrillary acidic protein (GFAP)-pos. astrocytes (F(3,20) = 72.48, p < 0.01, η p2 = 0.92), and the release of inflammatory mediators, such as TNF-α (F(3,20) = 133.14, p < 0.01, η p2 = 0.95), IL-1β, and C-C motif chemokine ligand 3 (CCL3). ISL pretreatment given before KA also significantly prevented apoptotic neuronal injury by upregulating the activities of superoxide dismutase and glutathione peroxidase. It also significantly suppressed the protein levels of Toll-like receptor 4 (TLR4) (F(3,20) = 63.23, p <0.01, η p2 = 0.91) and its downstream mols., myeloid differentiation primary response 88 (MYD88), phosphorylated (p-)IκBα, and p-NF-κB. Blocking TLR4/MYD88 signaling also attenuated KA-induced neuroinflammation and neuronal damage in the hippocampus. Overall, our study demonstrates that ISL pretreatment plays neuroprotective and anti-inflammatory roles in KA-induced epileptogenesis, which may be mediated by the TLR4/MYD88 signaling pathway.
- 311Maatouk, L.; Compagnion, A. C.; Sauvage, M. A. C. De; Bemelmans, A. P.; Leclere-Turbant, S.; Cirotteau, V.; Tohme, M.; Beke, A.; Trichet, M.; Bazin, V.; Trawick, B. N.; Ransohoff, R. M.; Tronche, F.; Manoury, B.; Vyas, S. TLR9 Activation via Microglial Glucocorticoid Receptors Contributes to Degeneration of Midbrain Dopamine Neurons. Nat. Commun. 2018, 9, 2450, DOI: 10.1038/s41467-018-04569-y[Crossref], [PubMed], [CAS], Google Scholar311https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BB3c%252FhtVWrsg%253D%253D&md5=09ca9463cacd458309b641e23902c29aTLR9 activation via microglial glucocorticoid receptors contributes to degeneration of midbrain dopamine neuronsMaatouk Layal; Compagnion Anne-Claire; Cirotteau Vincent; Beke Allen; Tronche Francois; Vyas Sheela; Sauvage Maria-Angeles Carrillo-de; Bemelmans Alexis-Pierre; Leclere-Turbant Sabrina; Tohme Mira; Manoury Benedicte; Trichet Michael; Bazin Virginie; Trawick Bobby N; Ransohoff Richard MNature communications (2018), 9 (1), 2450 ISSN:.Inflammation is a characteristic feature of Parkinson's disease (PD). We examined the role of TLR9 and its regulation by glucocorticoid receptors (GRs) in degeneration of substantia nigra dopamine neurons (DNs). TLR9 agonist, CpG-ODN, induced DN degeneration in mice lacking GR in microglia but not in controls. TLR9 deletion reduced DN loss in neurotoxin, 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) mouse model of PD. GR regulates TLR9 activation during MPTP neurotoxicity as TLR9 antagonist suppressed increased DN loss in microglia/macrophage GR mutant mice. GR absence in microglia enhanced TLR9 translocation to endolysosomes and facilitated its cleavage leading to pro-inflammatory gene expression. GR-dependent TLR9 activation also triggered DN loss following intranigral injection of mitochondrial DNA. Finally, microglial GR sensitivity to A53T-alpha-synuclein induced DN degeneration as well as decreased microglial GR expression observed in SN of PD brain samples, all suggest that reduced microglial GR activity in SN can stimulate TLR9 activation and DN loss in PD pathology.
- 312Portou, M. J.; Baker, D.; Abraham, D.; Tsui, J. The Innate Immune System, Toll-like Receptors and Dermal Wound Healing: A Review. Vasc. Pharmacol. 2015, 71, 31– 36, DOI: 10.1016/j.vph.2015.02.007[Crossref], [PubMed], [CAS], Google Scholar312https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXmslCqurk%253D&md5=d65a3eca98e907f777a7fe4498a05872The innate immune system, toll-like receptors and dermal wound healing: A reviewPortou, M. J.; Baker, D.; Abraham, D.; Tsui, J.Vascular Pharmacology (2015), 71 (), 31-36CODEN: VPAHAJ; ISSN:1537-1891. (Elsevier B.V.)Wound healing is a complex physiol. process comprised of discrete but inter-related and overlapping stages, requiring exact timing and regulation to successfully progress, yet occurs spontaneously in response to injury. It is characterised by four phases, coagulation, inflammation, proliferation and remodelling. Each phase is predominated by particular cell types, cytokines and chemokines. The innate immune system represents the first line of defense against invading microorganisms. It is entirely encoded with the genome, and comprised of a cellular response with specificity provided by pattern recognition receptors (PRRs) such as toll-like receptors (TLRs). TLRs are activated by exogenous microbial pathogen assocd. mol. patterns (PAMPs), initiating an immune response through the prodn. of pro-inflammatory cytokines and further specialist immune cell recruitment. TLRs are also activated by endogenous mol. patterns termed damage assocd. mol. patterns (DAMPs). These ligands, usually shielded from the immune system, act as alarm signals alerting the immune system to damage and facilitate the normal wound healing process. TLRs are expressed by cells essential to wound healing such as keratinocytes and fibroblasts, however the specific role of TLRs in this process remains controversial. This article reviews the current knowledge on the potential role of TLRs in dermal wound healing where inflammation arising from pathogenic activation of these receptors appears to play a role in chronic ulceration assocd. with diabetes, scar hypertrophy and skin fibrosis.
- 313Yang, H.; Brackett, C. M.; Morales-Tirado, V. M.; Li, Z.; Zhang, Q.; Wilson, M. W.; Benjamin, C.; Harris, W.; Waller, E. K.; Gudkov, A. V.; Burdelya, L. G.; Grossniklaus, H. E. The Toll-like Receptor 5 Agonist Entolimod Suppresses Hepatic Metastases in a Murine Model of Ocular Melanoma via an NK Cell-Dependent Mechanism. Oncotarget 2016, 7 (3), 2936– 2950, DOI: 10.18632/oncotarget.6500[Crossref], [PubMed], [CAS], Google Scholar313https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A280%3ADC%252BC28vpt1Ggsg%253D%253D&md5=be07d6f6757c4ab6d91af04b9b731aefThe Toll-like receptor 5 agonist entolimod suppresses hepatic metastases in a murine model of ocular melanoma via an NK cell-dependent mechanismYang Hua; Li Zezhong; Zhang Qing; Grossniklaus Hans E; Brackett Craig M; Benjamin Camille; Gudkov Andrei V; Burdelya Lyudmila G; Morales-Tirado Vanessa Marie; Wilson Matthew W; Harris Wayne; Waller Edmund K; Gudkov Andrei VOncotarget (2016), 7 (3), 2936-50 ISSN:.Uveal melanoma (UM) is the most common primary cancer of the eye in adults and progresses to metastatic disease predominantly of the liver in ~50% of patients. In these cases, life expectancy averages just 9 months due to the lack of effective treatment options. The Toll-like receptor 5 (TLR5) agonist entolimod (former name CBLB502) rapidly activates TLR5-NF-κB signaling in hepatocytes and suppresses growth of both TLR5-expressing and non-expressing tumors in the liver through mobilization and activation of innate and adaptive immune mechanisms. The goal of this study was to explore the potential of entolimod as an immunotherapeutic agent against hepatic metastasis of UM using the TLR5-positive B16LS9 mouse model of ocular melanoma. Mice were given seven subcutaneous injections of vehicle or entolimod given 72 h apart started one day before, on the same day or three days after intraocular injection of B16LS9 cells. All tested regimens of entolimod treatment resulted in significantly reduced B16LS9 metastasis to the liver. Entolimod induced mobilization of natural killer (NK) cells to the liver and stimulated their maturation, differentiation and activation. Antibody-mediated depletion of NK cells from mice abrogated entolimod's antimetastatic activity in the liver and eliminated the entolimod-elicited in vitro cytotoxic activity of hepatic lymphocytes against B16LS9 cells. These results provide pre-clinical evidence of entolimod's efficacy against hepatometastasis of UM and support its further development as an anticancer immunotherapeutic drug.
- 314Bi, J.; Wang, W.; Du, J.; Chen, K.; Cheng, K. Structure-Activity Relationship Study and Biological Evaluation of SAC-Garlic Acid Conjugates as Novel Anti-Inflammatory Agents. Eur. J. Med. Chem. 2019, 179, 233– 245, DOI: 10.1016/j.ejmech.2019.06.059[Crossref], [PubMed], [CAS], Google Scholar314https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXhtlaqsL3P&md5=569c3b7fae86c93d9606be9f628fd8f1Structure-activity relationship study and biological evaluation of SAC-Garlic acid conjugates as novel anti-inflammatory agentsBi, Jingjie; Wang, Wenqing; Du, Junxi; Chen, Kun; Cheng, KuiEuropean Journal of Medicinal Chemistry (2019), 179 (), 233-245CODEN: EJMCA5; ISSN:0223-5234. (Elsevier Masson SAS)A series of S-allyl-L-cysteine (SAC) with garlic acid conjugates as anti-inflammatory agents were designed and synthesized. Among the 40 tested compds., SMU-8c exhibited the most potent inhibitory activity to Pam3CSK4-induced nitric oxide (NO) in RAW264.7 macrophages with IC50 of 22.54 ± 2.60 μM. The structure-activity relationship (SAR) study suggested that the esterified carboxyl group, carbon chain extension and methoxylation phenol hydroxy could improve the anti-inflammatory efficacy. Preliminary anti-inflammatory mechanism studies showed that SMU-8c significantly down-regulated the levels of Pam3CSK4 triggered TNF-α cytokine in human THP-1 cells, mouse RAW 264.7 macrophages, as well as in ex-vivo human peripheral blood mononuclear cells (PBMC) with no influence on cell viability. SMU-8c specifically blocked the Pam3CSK4 ignited secreted embryonic alk. phosphatase (SEAP) signaling with no influence to Poly I:C or LPS triggered TLR3 or TLR4 signaling. Moreover, SMU-8c suppressed TLR2 in HEK-Blue hTLR2 cells and inhibited the formation of TLR1-TLR2, and TLR2-TLR6 complex in human PBMC. In summary, SMU-8c inhibited the TLR2 signaling pathway to down-regulate the inflammation cytokines, such as NO, SEAP and TNF-α, to realize its anti-inflammatory activity.
- 315Zhang, Y.; Zhang, Y. Pterostilbene, a Novel Natural Plant Conduct, Inhibits High Fat-Induced Atherosclerosis Inflammation via NF-KB Signaling Pathway in Toll-like Receptor 5 (TLR5) Deficient Mice. Biomed. Pharmacother. 2016, 81, 345– 355, DOI: 10.1016/j.biopha.2016.04.031[Crossref], [PubMed], [CAS], Google Scholar315https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC28XmslOit7o%253D&md5=ae504a87b52b5531d79a83071bf3bfc8Pterostilbene, a novel natural plant conduct, inhibits high fat-induced atherosclerosis inflammation via NF-κB signaling pathway in Toll-like receptor 5 (TLR5) deficient miceZhang, Yuan; Zhang, YiBiomedicine & Pharmacotherapy (2016), 81 (), 345-355CODEN: BIPHEX; ISSN:0753-3322. (Elsevier Masson SAS)Atherosclerosis is a specific form of an artery wall thickens, a syndrome affecting arterial blood vessels due to a chronic inflammatory response in the walls of arteries, which is promoted by fat accumulation. Toll-like receptors (TLRs) play prominent roles in inflammatory responses. And TLR5 is overexpressed in several diseases. Here in our study, we investigated the effect of TLR5 in high fat-induced atherosclerosis via NF-κB signaling pathway modulating pro-inflammatory cytokines releasing. Our results found that high fat induced atherosclerosis in wild type mice with fat accumulation and inflammatory response through NF-κB activation. Contrastly, TLR5 knockout mice displayed lower fat accumulation and ameliorated inflammation after high fat feeding with NF-κB inactivation. In addn., pterostilbene, as a natural di-Me ether deriv. of resveratrol mainly from blueberries, has diverse pharmacol. activities, esp. anti-inflammation. Our study also found that pterostilbene displayed inhibited role in suppressing inflammatory response through inactivating NF-κB signaling pathway regulated by TLR5 down-regulation in high fat-induced mice. Moreover, in vitro expts. of vascular smooth muscle cells (VSMCs) challenged with LPS or TNF-α, further indicated that NF-κB was involved in atherosclerosis progression, leading to high secretion of pro-inflammatory cytokines. However, VSMCs from TLR5 deficient mice inhibited phosphorylated levels of NF-κB signaling pathway, finally resulting in down-regulation of inflammatory cytokines. Notably, pterostilbene also displayed suppressed role in inflammatory response via NF-κB inactivity in LPS or TNF-α-induced VSMCs by decreasing TLR5 expression. The results above indicated a novel therapeutic strategy of pterostilbene to protect against atherosclerosis via TLR5 regulation for clinic treatment in the future.
- 316Anwar, M. A.; Shah, M.; Kim, J.; Choi, S. Recent Clinical Trends in Toll-like Receptor Targeting Therapeutics. Med. Res. Rev. 2019, 39 (3), 1053– 1090, DOI: 10.1002/med.21553[Crossref], [PubMed], [CAS], Google Scholar316https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC1MXntlGksbs%253D&md5=525a0020ddcf3bfd585e51a4f93e0265Recent clinical trends in Toll-like receptor targeting therapeuticsAnwar, Muhammad Ayaz; Shah, Masaud; Kim, Jason; Choi, SangdunMedicinal Research Reviews (2019), 39 (3), 1053-1090CODEN: MRREDD; ISSN:0198-6325. (John Wiley & Sons, Inc.)A review. Toll-like receptors (TLRs) are germline-encoded receptors that are central to innate and adaptive immune responses. Owing to their vital role in inflammation, TLRs are rational targets in clinics; thus, many ligands and biologics have been reported to overcome the progression of various inflammatory and malignant conditions and support the immune system. For each TLR, at least one, and often many, drug formulations are being evaluated. Ligands reported as stand-alone drugs may also be reported based on their use in combinatorial therapeutics as adjuvants. Despite their profound efficacy in TLR-modulation in preclin. studies, multiple drugs have been terminated at different stages of clin. trials. Here, TLR modulating drugs that have been evaluated in clin. trials are discussed, along with their mode of action, suggestive failure reasons, and ways to improve the clin. outcomes. This review presents recent advances in TLR-targeting drugs and provides directions for more successful immune system manipulation.
- 317Lima, C. X.; Souza, D. G.; Amaral, F. A.; Fagundes, C. T.; Rodrigues, I. P. S.; Alves-Filho, J. C.; Kosco-Vilbois, M.; Ferlin, W.; Shang, L.; Elson, G.; Teixeira, M. M. Therapeutic Effects of Treatment with Anti-TLR2 and Anti-TLR4Monoclonal Antibodies in Polymicrobial Sepsis. PLoS One 2015, 10 (7), e0132336, DOI: 10.1371/journal.pone.0132336[Crossref], [PubMed], [CAS], Google Scholar317https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC2MXhtlGqtrfE&md5=0ea0c48e2df8fa2bd2061e0b908b0f01Therapeutic effects of treatment with anti- TLR2 and anti-TLR4 monoclonal antibodies in polymicrobial sepsisLima, Cristiano Xavier; Souza, Danielle Gloria; Amaral, Flavio Almeida; Fagundes, CaioTavares; Rodrigues, Irla Paula Stopa; Alves-Filho, Jose Carlos; Kosco-Vilbois, Marie; Ferlin, Walter; Shang, Limin; Elson, Greg; Teixeira, Mauro MartinsPLoS One (2015), 10 (7), e0132336/1-e0132336/14CODEN: POLNCL; ISSN:1932-6203. (Public Library of Science)Introduction Toll-like receptors (TLRs) play an important role in the recognition of microbial products and in host defense against infection. However, the massive release of inflammatory mediators into the bloodstream following TLR activation following sepsis is thought to contribute to disease pathogenesis. Methods Here, we evaluated the effects of preventive or therapeutic administration of monoclonal antibodies (mAbs) targeting either TLR2 or TLR4 in a model of severe polymicrobial sepsis induced by cecal ligation and puncture in mice. Results Pre-treatment with anti-TLR2 or anti-TLR4 mAb alone showed significant protection from sepsis-assocd. death. Protective effects were obsd. even when the administration of either anti-TLR2 or anti-TLR4 alone was delayed (i.e., 3 h after sepsis induction). Delayed administration of either mAb in combination with antibiotics resulted in additive protection. Conclusion Although attempts to translate preclin. findings to clin. sepsis have failed so far, our preclin. expts. strongly suggest that there is a sufficient therapeutic window within which patients with ongoing sepsis could benefit from combined antibiotic plus anti-TLR2 or anti-TLR4 mAb treatment.
- 318Toshchakov, V. Y.; Szmacinski, H.; Couture, L. A.; Lakowicz, J. R.; Vogel, S. N. Targeting TLR4 Signaling by TLR4 Toll/IL-1 Receptor Domain-Derived Decoy Peptides: Identification of the TLR4 Toll/IL-1 Receptor Domain Dimerization Interface. J. Immunol. 2011, 186 (8), 4819– 4827, DOI: 10.4049/jimmunol.1002424[Crossref], [PubMed], [CAS], Google Scholar318https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BC3MXkt1Gqtrs%253D&md5=cc42419d0d055310309a1899c1a5bccfTargeting TLR4 Signaling by TLR4 Toll/IL-1 Receptor Domain-Derived Decoy Peptides: Identification of the TLR4 Toll/IL-1 Receptor Domain Dimerization InterfaceToshchakov, Vladimir Y.; Szmacinski, Henryk; Couture, Leah A.; Lakowicz, Joseph R.; Vogel, Stefanie N.Journal of Immunology (2011), 186 (8), 4819-4827CODEN: JOIMA3; ISSN:0022-1767. (American Association of Immunologists)Agonist-induced dimerization of TLR4 Toll/IL-1R (TIR) domains initiates intracellular signaling. Therefore, identification of the TLR4-TIR dimerization interface is one key to the rational design of therapeutics that block TLR4 signaling. A library of cell-permeating decoy peptides, each of which represents a nonfragmented patch of the TLR4 TIR surface, was designed such that the peptides entirely encompass the TLR4 TIR surface. Each peptide was synthesized in tandem with a cell-permeating Antennapedia homeodomain sequence and tested for the ability to inhibit early cytokine mRNA expression and MAPK activation in LPS-stimulated primary murine macrophages. Five peptides-4R1, 4R3, 4BB, 4R9, and 4αE-potently inhibited all manifestations of TLR4, but not TLR2 signaling. When tested for their ability to bind directly to TLR4 TIR by Foerster resonance energy transfer using time-resolved fluorescence spectroscopy, Bodipy-TMR-X-labeled 4R1, 4BB, and 4αE quenched fluorescence of TLR4-Cerulean expressed in HeLa or HEK293T cells, whereas 4R3 was partially active, and 4R9 was least active. These findings suggest that the area between the BB loop of TLR4 and its fifth helical region mediates TLR4 TIR dimerization. Moreover, the authors' data provide direct evidence for the utility of the decoy peptide approach, in which peptides representing various surface-exposed segments of a protein are initially probed for the ability to inhibit protein function, and then their specific targets are identified by Foerster resonance energy transfer to define recognition sites in signaling proteins that may be targeted therapeutically to disrupt functional transient protein interactions.
- 319Sallenave, J.-M.; Guillot, L. Innate Immune Signaling and Proteolytic Pathways in the Resolution or Exacerbation of SARS-CoV-2 in Covid-19: Key Therapeutic Targets?. Front. Immunol. 2020, 11, 1229, DOI: 10.3389/fimmu.2020.01229[Crossref], [PubMed], [CAS], Google Scholar319https://chemport.cas.org/services/resolver?origin=ACS&resolution=options&coi=1%3ACAS%3A528%3ADC%252BB3cXitVWnsL7L&md5=27d8bca7aa6d569c2e42f79d9af2124aInnate immune signaling and proteolytic pathways in the resolution or exacerbation of SARS-CoV-2 in Covid-19: key therapeutic targets?Sallenave, Jean-Michel; Guillot, LoicFrontiers in Immunology (2020), 11 (), 1229CODEN: FIRMCW; ISSN:1664-3224. (Frontiers Media S.A.)A review. COVID-19 is caused by the Severe Acute Respiratory Syndrome (SARS) coronavirus (Cov)-2, an enveloped virus with a pos.-polarity, single-stranded RNA genome. The initial outbreak of the pandemic began in Dec. 2019, and it is affecting the human health of the global community. In common with previous pandemics (Influenza H1N1 and SARS-CoV) and the epidemics of Middle east respiratory syndrome (MERS)-CoV, CoVs target bronchial and alveolar epithelial cells. Virus protein ligands (e.g., haemagglutinin or trimeric spike glycoprotein for Influenza and CoV, resp.) interact with cellular receptors, such as (depending on the virus) either sialic acids, Dipeptidyl peptidase 4 (DPP4), or angiotensin-converting enzyme 2 (ACE2). Host proteases, e.g., cathepsins, furin, or members of the type II transmembrane serine proteases (TTSP) family, such as Transmembrane protease serine 2 (TMPRSS2), are involved in virus entry by proteolytically activating virus ligands. Also involved are Toll Like Receptor (TLR) family members, which upregulate anti-viral and pro-inflammatory mediators [interleukin (IL)-6 and IL-8 and type I and type III Interferons among others], through the activation of Nuclear Factor (NF)-kB. When these events (virus cellular entry and innate immune responses) are uncontrolled, a deleterious systemic response is sometimes encountered in infected patients, leading to the well-described "cytokine storm" and an ensuing multiple organ failure promoted by a downregulation of dendritic cell, macrophage, and T-cell function. We aim to describe how the lung and systemic host innate immune responses affect survival either pos., through downregulating initial viral load, or neg., by triggering uncontrolled inflammation. An emphasis will be put on host cellular signaling pathways and proteases involved with a view on tackling these therapeutically.
- 320Chakraborty, C.; Sharma, A. R.; Bhattacharya, M.; Sharma, G.; Lee, S.-S.; Agoramoorthy, G. Consider TLR5 for New Therapeutic Development against COVID-19. J. Med. Virol. 2020, DOI: 10.1002/jmv.25997
- 321Wali, S.; Flores, J. R.; Jaramillo, A. M.; Goldblatt, D. L.; Pantaleón García, J.; Tuvim, M. J.; Dickey, B. F.; Evans, S. E. Immune Modulation to Improve Survival of Respiratory Virus Infections in Mice. bioRxiv 2020, DOI: 10.1101/2020.04.16.045054 .
- 322Conti, P.; Ronconi, G.; Caraffa, A.; Gallenga, C.; Ross, R.; Frydas, I.; Kritas, S. Induction of Pro-Inflammatory Cytokines (IL-1 and IL-6) and Lung Inflammation by Coronavirus-19 (COVI-19 or SARS-CoV-2): Anti-Inflammatory Strategies. J. Biol. Regul. Homeost. Agents 2020, 34 (2), 11– 15, DOI: 10.23812/conti-e