ACS Publications. Most Trusted. Most Cited. Most Read
My Activity
Recently Viewed
You have not visited any articles yet, Please visit some articles to see contents here.
CONTENT TYPES

Figure 1Loading Img

Modulation of the Innate Immune Response by Targeting Toll-like Receptors: A Perspective on Their Agonists and Antagonists

Cite this: J. Med. Chem. 2020, 63, 22, 13466–13513
Publication Date (Web):August 26, 2020
https://doi.org/10.1021/acs.jmedchem.0c01049
Copyright © 2020 American Chemical Society
Subscribed Access
Article Views
2276
Altmetric
-
Citations
LEARN ABOUT THESE METRICS
PDF (6 MB) OpenURL HONG KONG UNIV SCIENCE TECHLGY

Abstract

Toll-like receptors (TLRs) are a class of proteins that recognize pathogen-associated molecular patterns (PAMPs) and damaged-associated molecular patterns (DAMPs), and they are involved in the regulation of innate immune system. These transmembrane receptors, localized at the cellular or endosomal membrane, trigger inflammatory processes through either myeloid differentiation primary response 88 (MyD88) or TIR-domain-containing adapter-inducing interferon-β (TRIF) signaling pathways. In the last decades, extensive research has been performed on TLR modulators and their therapeutic implication under several pathological conditions, spanning from infections to cancer, from metabolic disorders to neurodegeneration and autoimmune diseases. This Perspective will highlight the recent discoveries in this field, emphasizing the role of TLRs in different diseases and the therapeutic effect of their natural and synthetic modulators, and it will discuss insights for the future exploitation of TLR modulators in human health.

Introduction

ARTICLE SECTIONS
Jump To

Innate immune cells, such as dendritic cells (DCs), natural killer (NK) cells, macrophages, and neutrophils, take advantage of pattern recognition receptors (PRRs) to identify damaged-associated molecular patterns (DAMPs) and pathogen-associated molecular patterns (PAMPs).(1) PRRs have a crucial role in the defense against pathogenic insults and they are associated with the release of pro-inflammatory cytokines, interferons (IFNs), chemokines, and B and T cells activation (all components of the adaptive immunity). To date, many PRRs have been discovered, including, among others, nucleotide-binding oligomerization domain-like receptors (NODs), C-type lectin receptors (CLRs), and toll-like receptors (TLRs), with these latter being the most deeply investigated and characterized.(2) The structure of TLRs consists of three distinct domains: an extracellular domain (ECD) that directly interacts with the ligands, a Toll/interleukin-1 receptor (TIR) domain necessary for the interaction with other TIR-containing systems and the subsequent downstream signaling, and a transmembrane domain that anchors TLRs to the membrane (see Figure 1, with the following PDB IDs: ectodomain, 2Z7X; transmembrane domain, 2MK9; and TIR domain, 4OM7). In humans, 10 TLR family members have been identified and classified, according to their cellular localization: TLR1, TLR2, TLR5, TLR6, and TLR10 are located on the cell membrane, while TLR3, TLR7, TLR8, and TLR9 are localized on the endosomal membrane. As an exception, TLR4 can be found in both cellular and endosomal membranes. In the absence of a ligand, TLRs exist as monomers or weak dimers that are incapable of triggering any signaling. After the generation of homodimers (dimerization of two TLR monomers belonging to the same receptor type, e.g., TLR4) or heterodimers (dimerization of two TLR monomers belonging to different receptor types, e.g., TLR1/2 and TLR2/6), the receptor can interact with a ligand, which confers a higher stability to the dimer and induces a conformational change that allows the initiation of the signaling.(3) TLR10 may form homodimers or heterodimers with TLR1 or TLR2 and, to date, the functions of TLR10 are still unknown, as well as its natural substrates or other ligands.(4)

Figure 1

Figure 1. General structure of a dimeric toll-like receptor (TLR).

The TLR Signaling Pathways

The signaling pathway of TLRs differs among the family members; hence, the activity of TLR1, TLR2, and TLR5–TLR9 is dependent on the myeloid differentiation primary response protein 88 (MyD88) pathway, while TLR3 functionality is dependent on the presence of the TIR-domain-containing adapter-inducing interferon-β (TRIF) pathway; TLR4 is again the only exception that can use both pathways (Figure 2).(1,5) Therefore, after the interaction with DAMPs or PAMPs, TLR dimers move the TIR domains toward MyD88 or TRIF. TLR4 uses MyD88 adapter-like protein (MAL) or TRIF-related adapter molecule (TRAM) as a bridge between MyD88 and TIR or TRIF and TIR, respectively.

Figure 2

Figure 2. Schematic representation of TLR signaling pathways.

Within the MyD88 pathway, the death domain of this protein recruits IL-1R-associated kinases (IRAKs), consisting of IRAK4 and IRAK1/2. IRAKs can be activated by cross- and self-phosphorylation, culminating in the activation and dimerization of tumor necrosis factor (TNF) receptor-associated factor 6 (TRAF6), which mediates the ubiquitination of the transforming growth factor β-activated kinase (TAK1). Once activated, TAK1 modulates the expression of nuclear factor kappa B (NF-κB) and mitogen-activated protein kinase (MAPK). NF-κB is kept inactive in the cytoplasm by the inhibitor of κB (IκB), which can be phosphorylated by IκB kinase α (IKKα) and IKKβ, resulting in IκB degradation by the proteasome and in the translocation of the activated NF-κB into the nucleus (Figure 2).
MAPK protein family activation (such as MKK7 or MKK6/3) leads to protein 38 (p38) and c-Jun N-terminal kinase (JNK) phosphorylation. These proteins are involved in the recruitment of activated protein 1 (AP1) family of transcription factors and mRNA stabilization of several genes involved in the inflammatory response. Following AP1 and NF-κB translocation into the nucleus, the expression of cytokines (TNF-α, interleukin (IL)-6, IL-1 and IFN-β), chemokines and cluster of differentiation 80 (CD80), CD86, CD40 and major histocompatibility complex (MHC) class II is increased. These factors are potentially able to promote both the inflammation and activation of T and B cells (Figure 2).
The TRIF pathway is associated with the activation of either TRAF3 or TRAF6, which is directly mediated by TRIF. TRAF6 activation triggers TAK1 by interacting with the receptor interacting protein kinase 1 (RIPK-1), favoring the nuclear release of NF-κB as previously described. In contrast, TRAF3 regulates the phosphorylation of IFN-regulatory factor 3 (IRF3) by the activity of IKK-related kinases and NF-κB essential modulator (NEMO). Once activated, IRF3 dimerizes and moves to the nucleus, inducing the production of type I IFN genes (Figure 2).(1,3)
Since TLRs are highly expressed on immune cells (and some nonimmune cells), they play a pivotal role in the innate immune response. The first discovered TLR ligands are represented by bacterial cell wall components, pathogen nucleic acids and other pathogens-associated elements (i.e., lipoproteins, flagellin, ssDNA, etc.; see Figure 3). Therefore, the research interest in the discovery of new TLR ligands able to modulate the immune response has increased in the last decades. Until now, TLR ligands have found application in many diseases, especially in the context of infectious diseases, inflammatory diseases, autoimmune diseases, and cancers. Inactivated vaccines (i.e., isolated nonreplicating subcellular components, killed organisms, etc.) stimulate shorter and lower levels of immunity when compared to live vaccines (i.e., replicating live organisms). Old reports showed that the use of alum or mineral oil emulsion were able to increase the immune response against an antigen and to enhance the activity of a vaccine preparation. Successively, an antibody titer increase was observed in local inflammation determined by bacterial components. From this observation, Ramon coined the term “adjuvant” to describe compounds able to enhance the antibody response against an antigen. Immunological adjuvants are compounds that prompt the immune system toward TH1 or TH2 immunity, thus boosting the immune response against an antigen. Inactivated vaccines require an adjuvant to become effective therapeutic tools.(6) To date, the majority of TLR agonists under clinical evaluation are studied as possible vaccine adjuvants against several infections and cancer. Indeed, two TLR4 agonists are currently in use as adjuvants against HBV infections, and a TLR9 agonist reached phase III studies against this virus.(7) Several TLR3, TLR4, TLR7, and TLR8 agonists showed promising results in enhancing the therapeutic efficacy of vaccination against cancer and chronic viral infections.(8) Furthermore, TLR agonists were able to confer protection against several bacterial pathogens. TLR antagonists are usually structurally related to agonists but fail to generate a signal after binding the receptor. These compounds have been investigated against several inflammatory-related disorders and autoimmune diseases. For example, TLR3 and TLR4 inhibition represents the main strategy to fight pathogen-associated inflammation and viral or bacterial sepsis. Overactivation of TLRs may lead to the production of high levels of IFN and other cytokines, leading to chronic inflammation. Many DAMPs have been identified for most of the TLRs and they are usually released from apoptotic cells or damaged tissues. The chronic activation of TLRs exerted by DAMPs may stimulate T- and B-cells responses and, together with the release of cytokines, contributes to the development of autoimmunity. Therefore, also the inhibition of TLRs represents a valid therapeutic strategy against inflammatory and autoimmune disorders.(8)

Figure 3

Figure 3. Multiple members of TLR family are responsible for micro-organism and viral PAMPs recognition.

This perspective reports the latest (2010–2020) findings on TLR modulators and their application against different diseases. We have systematically treated the topic considering various pathological states in which the involvement of TLRs is relevant. When available, the modulators have been reported and the targeted TLR has been highlighted.

TLRs and Viral Infections

ARTICLE SECTIONS
Jump To

Antiviral immunity was related for the first time to TLR signaling by Kurt-Jones et al. in 2000,(9) when they demonstrated that an intact TLR4 pathway is needed for the induction of IL-6 releasing by respiratory syncytial virus (RSV) proteins in murine macrophages. Viral pathogens can be detected either by plasma membrane TLRs, such as TLR2 and TLR4, or by endosomal TLRs, including TLR3, TLR7, TLR8, and TLR9.(10) The formers recognize proteins in the extracellular medium, while the latter specifically sense pathogen nucleic acids within the cell.

The Role of TLR2/1 and TLR 2/6 in Viral Infections and Their Modulators

Although TLR2 is mainly involved in sensing bacterial cell wall and membrane components, recent findings showed its involvement also in the innate immune response against a wide variety of viruses. For instance, TLR2 was reported to detect human cytomegalovirus (HCMV) glycoproteins gB and gH, Herpes Simplex viruses (HSV-1 and HSV-2) glycoproteins gH/gL and gB, Epstein–Barr virus (EBV) dUTPase, hepatitis C virus (HCV) core and nonstructural protein 3 (NSP3), measles virus hemagglutinin and rotavirus NSP4.(11,12) TLR2 seems to have a role also in hepatitis E virus (HEV) infection(13) and in the detection of vaccinia virus (VV), lymphocytic choriomeningitis virus (LCMV), and human adenoviruses (HAdV) B and C.(10,14) TLR2 signaling has been related to chronic hepatitis B virus (HBV) infection, since the hepatitis B antigen (HBsAg) reduces TLR2 expression in hepatic cell lines;(15) moreover, several studies highlighted the importance of TLR2 signaling in the suppression of HBV replication within hepatocytes.(16) The heterodimer TLR2/6 is involved in RSV sensing, as demonstrated by several works reviewed in Jung et al.,(17) and in the activation of immune response in monocytes and macrophages upon Varicella Zoster virus (VZV) infection.(11)
Lipopeptides are the most common TLR2 agonists, and these compounds are derived from bacterial cell wall components. The structure of these molecules usually includes the S-[2,3-bis(palmitoyloxy)propyl] cysteine (Pam2Cys, where Pam is palmitoyl) or S-[2,3-bis(palmitoyloxy)propyl]-N-palmitoyl-cysteine (Pam3Cys) motifs, which promote the immunomodulation. From the optimization studies conducted on these structures, compounds Pam2CSK4 (1a, Figure 4) and Pam3CSK4 (1b) emerged as the most potent and soluble TLR2/TLR6 and TLR2/TLR1 agonists, respectively. In 2006, Jin and co-workers obtained for the first time the crystal structure of the heterodimer TLR2/1 in complex with the synthetic agonist 1b, which is the tripalmitoylated peptide Cys-Ser-Lys4 derived from the mycoplasmal lipopeptide macrophage activating lipopeptide-2 (MALP-2, 2).(18) Since then, extensive research developed other analogues exploring their structure–activity relationship (SAR) to selectively target the heterodimers TLR2/1 or TLR2/6. In particular, the presence of three acyl moieties, two ester-bound and one amide-bound, as in 1b or Pam3Cys, is necessary to drive the formation of the heterodimer between TLR2 and TLR1; on the other hand, only two acyl derivatives, as in 1a and Pam2Cys, lead to TLR2/6 heterodimerization. Moreover, it was found that the strongest agonist activity was associated with a C16 acyl moiety.(19−21) These molecules are under investigation for different potential therapeutic applications and, until now, Pam2Cys was shown to counteract influenza A virus (IAV) infection.(20) Moreover, recent studies demonstrated that 1b-mediated TLR2 activation not only exerts a suppressive action against HBV replication and capsid formation in the hepatoblastoma cell line HepG2 (human hepatoblastoma cell line), but it also triggers the immune response in two hepatocyte cell lines, leading to the subsequent decrease in HBV replication markers.(16,22) On the other hand, the diacylated lipopeptide FSL-1 (3) was shown to induce an antiherpetic environment in mice against HSV-2 infections through the TLR2/6 pathway.(12) More recently, Yin et al.(4) designed a selective TLR2/1 agonist, namely, CU-T12-9 (4), that exhibited an IC50 value of 54.4 nM and whose binding pocket partially overlaps that of the amide-bound lipid of the TLR2/1-1b complex. Although no therapeutic application has been suggested, the agonist activity of all these molecules may be useful to stimulate the immune response upon microbial infection or as vaccine adjuvants. A recent work identified low-molecular-weight mannogalactofucans (LMMGFs) prepared by enzymatic degradation of galactofucans from Undaria pinnatifida sporophylls as promising TLR2 agonists able to counteract HSV-1 infections of host cells.(23)

Figure 4

Figure 4. Chemical structures of the TLR2/1 and 2/6 modulators 16 for the treatment of viral infection.

The identification of a series of triacetylated lipopeptides related to 1b, characterized by a glycerol core and variable amino acids, namely, small-molecule immune potentiators (SMIPs), led to the development of potential tetanus and influenza vaccines adjuvants. The representative compound SMIP2.1 (5) showed an increased cross-presentation by human antigen-presenting cells (APCs).(24) More recently, SMP-105, which is a TLR2 agonist derived from the Mycobacterium bovis cell wall skeleton, approved for the treatment of bladder cancer, has been proposed as an adjuvant, because of its ability to upregulate NF-κB signaling.(25)
E567 (6), the first synthetic TLR2 antagonist discovered through a cell-based screening, was shown to strongly reduce TLR2-mediated inflammatory response upon LCMV and HSV-1 infections. Remarkably, this compound also inhibited LCMV replication in mice, but this effect was not related to its activity on TLR pathways.(20)

The Role of TLR3 in Viral Infections and the Effect of Its Modulators

Endosomal TLRs, i.e., TLR3, 7, 8 and 9, are the PRRs able to detect pathogen nucleic acids, thus constituting the first line of the innate immune response against viral infections. More specifically, TLR3 recognizes viral pathogens by binding to dsRNA sequences either derived from their genome or from the intermediates generated during their replication cycles. This feature enables this PRR to trigger innate immune response against dsRNA viruses, such as rotavirus, but also ssRNA viruses, e.g., Hantaan virus (HV), RSV, West Nile Virus (WNV), coxsackievirus B3 (CVB3), IAV, Punta Toro Virus (PTV), HCV, HEV, Dengue Virus (DENV), encephalomyocarditis virus (EMCV), and poliovirus. Moreover, even some DNA viruses, such as EBV, VV, Kaposi’s sarcoma-associated herpesvirus (KSHV), HBV, HSV-1, and HSV-2, can be recognized by TLR3.(10,20,26−28) Interestingly, TLR3 is heavily involved in several viral infections of the central nervous system (CNS), where it can play either a protective or detrimental role for the host. Indeed, TLR3 has been related to the immune response against Japanese encephalitis virus (JEV), tick-borne encephalitis virus (TBEV), enterovirus-A71 (EV-A71), and Zika virus (ZIKV); sometimes, it also plays a role in the excessive neuro-inflammation that let rabies virus (RABV) or WNV invade neurons.(29,30) Also, other viruses can take advantage of the TLR3 signaling activation, resulting either in lower host resistance to lethal infections, as it happens for PTV, or in a detrimental inflammatory response, as it happens for IAV and VV in the lungs.(10) Two TLR3 single nucleotide polymorphisms (SNPs) lead to an interesting dual effect: SNP L412F at the same time promotes HSV encephalitis and protects from human immunodeficiency virus-1 (HIV-1) by restoring immune homeostasis; on the other hand, SNP P554S, while stimulating the resistance against HIV-1 infection, also increases susceptibility to CVB3 invasion of several body districts.(31)
TLR3 recognizes viral dsRNA and stimulates IFNs production. The most studied TLR3 agonist is polyinosinic:polycytidylic acid (poly(I:C)), from which many derivatives have been developed. Poly(I:C) determined a TLR3-dependent immune response, but in vivo assays also showed several toxic effects, including shock, kidney failure, and hypersensitivity reactions. For these reasons, poly(IC:LC) (interstitial Cajal-like cell, Hiltonol), a poly(I:C) molecule stabilized with polylysine and carboxymethylcellulose, has been developed. These modifications confer to the molecule a higher stability compared to the original dsRNA. This molecule was proposed to be used in combination with heat shock protein (HSP)-E7 (a construct consisting of the human papilloma virus (HPV) Type 16 E7 protein and HSP65) as a vaccine against several cancers. Another poly(I:C) derivative in which uridylic acid is added at a molar ratio of 12:1 during polycytidylic acid production, namely, poly(I:C12U), also known as Ampligen, has been widely used in several clinical trials for the treatment of viral infections and cancer (NCT01591473, NCT04119830). The presence of uridylic acids in this structure determines a higher affinity for TLR3, thus activating genes for IFNs and protein kinase (p68).(32) Because of the complex protein-RNA interactions needed for the recognition of dsRNA by TLR3, to date, only a few small molecules able to modulate this receptor have been developed. The most important synthetic TLR3 agonist is poly(I:C), which is widely used both as an antiviral agent, vaccine adjuvant, and pharmacological tool to study the TLR3 pathway. The pivotal role of this ligand in the stimulation of the immune system and in the protection against a remarkable variety of viral pathogens, such as HIV, DENV, IAVs, severe acute respiratory syndrome-corona virus (SARS-CoV), Chikungunya virus (CHIKV), HBV, HSV-1, and HSV-2, has been widely reviewed by others.(12,20,28,33) Moreover, poly(I:C) has been investigated as potential vaccine adjuvant for HPV, HSV-2 and HIV vaccinations, since it induces the expression of IFNs, cytokines, and chemokines and it drives DCs maturation, NK cell-mediated cytotoxicity and T-cell responses to these viruses.(12,34,35) Since the poly(I:C) potent immune-stimulatory effect is also mediated by RIG-1 and melanoma differentiation-associated protein 5 (MDA5) receptors, which are cytoplasmic RIG-1-like receptors (RLRs), several efforts have been made to develop more selective and less toxic analogues.(10) Poly(I:C12U) has been extensively studied to treat HBV, IAV, HCV, HIV, and HPV infections as vaccine adjuvant. Moreover, this ligand is better tolerated than poly(I:C) and it has been demonstrated that its antiviral activity is strictly TLR3-dependent.(12,20,25,28) Poly(IC:LC) seems to provide broad spectrum protection against IAVs, RSV, and SARS-CoV.(12) Moreover, it has been shown to exert anti-HBV activity through an enhanced expression of IFNs and to induce innate immune responses in HIV-positive patients.(15,36) The stabilized dsRNA PIKA is a potent adjuvant that was demonstrated to enhance cellular and humoral immune response to HBV antigen and to reduce viral loads of influenza viruses in infected mice lungs.(20) Recently, several studies and clinical trials assessed the ability of PIKA to act as a potential rabies vaccine adjuvant: Zhang et al. showed that this ligand protected 70%–80% of mice challenged with rabies virus, compared to a survival rate of 20%–30% in the control group.(37) A synthetic 50-bp dsRNA selective for TLR3 called Riboxxol showed a dose-dependent decrease of intracellular HBV DNA, as well as extracellular HBeAg and HBsAg, thus proving to be a valuable potential candidate for the treatment of HBV infections.(22) Finally, the small molecule RO 90–7501 (7, Figure 5) developed by Guo et al. was shown to enhance the TLR3-mediated expression of IFN-β upon poly(I:C) treatment of 293TLR3HA and THP-1 cells and to promote poly(I:C) antiviral activity in 293TLR3HA cells challenged with vesicular stomatitis virus (VSV).(38)

Figure 5

Figure 5. Chemical structures of TLR3 and 4 modulators 714 for the treatment of viral infection.

The Role of TLR4 in Viral Infections and the Effect of Its Modulators

Among TLRs, TLR4 is in complex with the myeloid differentiation 2 (MD2), which exhibits a ligand-binding pocket for compounds such as lipopolysaccharides (LPS), lipooligosaccharides (LOS), and exogenous modulators. Lipid A represents the membrane-anchoring moiety of LPS, and it is composed by a glucosamine disaccharide substituted with two negatively charged phosphate esters and six fatty acid acyl chains. Because of the toxic properties of lipid A, several chemical modifications were performed on its structure. Peri and Calabrese reviewed the SAR studies performed on lipid A structure in order to obtain either TLR4 agonists or antagonists.(39) Briefly, underacylated analogues, i.e., molecules bearing less than six fatty acid chains, exert antagonist activity. The most known example of this strategy is Eritoran (8, Figure 5), which failed a phase III clinical trial (NCT00334828) as an antisepsis agent. On the other hand, dephosphorylated lipid A or derivatives obtained by replacement of the sugar moieties with amino acids, were characterized by nontoxic agonist effect. Monophosphoryl lipid A (MPLA, 9) and aminoalkylglucosaminide 4-phosphates (AGPs), such as RC-529 (10), are examples of TLR4 agonists approved for cancer immunotherapy and as vaccine adjuvants, thanks to their ability to trigger Th-1-mediated immune response.(12,39) TLR4 main ligand is bacterial LPS, but several studies elucidated the role of this receptor also in the detection of viral pathogens. TLR4 recognizes RSV membrane-bound F protein,(9) and it also senses the VSV glycoprotein G, the HCV NS3 and NS5A proteins, the DENV NSP1, and the Ebola virus (EBOV) glycoprotein, both in its membrane-bound and secreted forms.(40,41) Moreover, recent reports suggested an important role of TLR4 signaling in HSV-2 infection of human cervical epithelial cells and also in KSHV infection of ECs.(26) In addition to RSV, other respiratory-related viruses can activate the TLR4 signaling (i.e., HAdV-C and IAV).(40,42) This aspect was further confirmed by the TLR4 SNPs D299G and T399I, which resulted in possessing an increased susceptibility to RSV infections.(12,31) Other viral pathogens, such as EV-A71 and HBV, enhance the immune response by stimulating the maturation of DCs by inducing TLR4 pathway.(15,43) Several works elucidated a dual role of TLR4 in HPV infections and in the subsequent induction of cancers: TLR4 stimulation was proved to enhance the immune response, leading to the eradication of both HPV and related malignancies; however, at the same time, the promoted inflammatory state has also been related to the insurgence of HPV-related warts.(44) Moreover, a recent study described an association between TLR4 SNP D299G and HPV wart infection in a group of 78 Egyptian patients.(45) Not surprisingly, TLR4-mediated immune response stimulation led to the release of pro-inflammatory cytokines and chemokines; thus resulting in detrimental effects for the host also during respiratory infections and hemorrhagic fevers. Indeed, as already reviewed by Olejnik et al., TLR4 stimulation is needed to trigger an initial protective response to IAV, SARS-CoV, RSV, EBOV, and DENV; moreover, several works demonstrated a reduction in lethality and disease progression upon mice treatment with TLR4 antagonists.(40)
Bacterial LPS was shown to stimulate TLR4 during HBV infection, thus inhibiting viral replication, via the upregulation of IFN-β expression. Therefore, TLR4 agonisms can be a precious tool in the fight against viral pathogens.(16) Indeed, 9, in combination with aluminum salts, the so-called adjuvant system 04 (AS04), is currently used in two registered vaccines: for HBV, Fendrix, and for HPV, Cervarix.(46)9, alone or in association with saponin QS-21, is currently evaluated in several clinical trials as adjuvant for HSV, HBV, and HIV vaccines (NCT04066881, NCT00001042, NCT03961438, NCT00224484). It is clear that the efforts to discover novel TLR4 agonists have mainly been directed toward the development of new vaccine adjuvants with better properties, improved immune-stimulatory effects, and reduced toxicity. In the above-mentioned work, the authors also reported the discovery of the lead compound 1Z105 (11) by a cell-based high-throughput screening aimed to identify potent NF-κB stimulators.(47,48)11 belongs to the class of pyrimido[5,4-b]indoles and it has been proposed as IAV hemagglutinin vaccine adjuvant, in combination with TLR7 agonist to balance TH1- and TH2-type immune response against influenza viruses.(49) Polysaccharide peptide (PSP), extracted from the edible fungus Coriolus versicolor, is a natural compound endowed with antiviral properties mediated by the stimulation of TLR4 pathway. Indeed, it contains α- and β-glucans, as well as polypeptides that make PSP a powerful PAMP, which is promptly recognized by TLR4. For this reason, its ability to inhibit HIV replication was studied and data suggested that PSP-induced TLR4 signaling led to the expression of anti-HIV chemokines.(50) A different strategy involved the development of small peptides mimicking LPS, thus replacing the natural bacterial PAMPs in vaccines, together with proper adjuvants, in order to induce the same level of immunization while reducing detrimental side effects. For instance, the LPS-mimicking heptapeptide RS09 (12) was either conjugated or mixed with an adenovirus-derived HIV antigen complexed with DEG-PEI polymer and intranasally administered. Data showed that the addition of 12 was able to increase the mucosal immunity triggered by the antigen through a TLR4-mediated signaling.(51) Fimbriae H (FimH) protein is a known TLR4 ligand able to stimulate the innate immune system and to exert protective effects against several viral infections. Similar to LPS, FimH is a constituent of E. coli type 1 fimbriae and consists of two immunoglobulin (Ig)-like domains connected by a linker.(52) This polypeptide has been thoroughly investigated in the past and it showed an interesting immune-stimulating activity against IAV in mice lungs, thus reducing the lethality of the infection; it also resulted to be active against CVB3 induced myocarditis.(52,53) Finally, a reporter gene-based high-throughput assay to identify novel TLR modulators revealed amphotericin B (AmpB, 13) as a promising TLR4 agonist; indeed this compound displayed an adjuvant effect comparable to that of other TLR agonists, i.e., ODN 2006 for TLR9, MB-564 for TLR8, C4 for TLR7, and DBS-2–217c for TLR2, inducing similar titers of anti-CRM197 (which is a nontoxic mutant diphtheria toxin) IgG in rabbits.(54)
In mice infected with IAV, the synthetic TLR4 antagonist 8 was shown to enhance their survival via suppressing influenza-induced cytokine gene expression, thus determining a reduction of IAV-related inflammation. Following TLR4 inhibition, compound 8 reduced lung injuries when administered up to 6 days after infection. Moreover, it reduced lung pathology in cotton rats infected with the H3N2 strain of the influenza virus.(55) FP7 (14) is a diacylated diphosphorylated monosaccharide designed to mimic Lipid X, which is a precursor of lipid A. This latter is able to bind CD14 and induce its selective endocytosis in bone-marrow derived macrophages, thus preventing the TLR4/CD14 coupling and signaling activation. Like Eritoran, 14 reduced IAV-induced lethality and lung damage associated with the inflammatory response. From the recent discovery that the cyclic antimicrobial 18-residue peptides (namely, θ-defensins, ex- 498 pressed from primates) counteracted LPS-induced lethality in mice by TLR4 inhibition, further studies on these compounds were conducted.(12) Both θ-defensins and retrocyclins (bioengineered analogues of θ-defensins) showed potent antiviral properties by blocking the entrance of HIV, HSV, and IAV into the cells. Moreover, it was recently proved that RC-101, a synthetic retrocyclin, was able to block both the LPS-induced TLR4 signaling and the 1b-induced TLR2 signaling and to reduce the severity of PR8-associated disease in mice.(56)

TLR5 in Viral Infections and the Role of Its Modulators

Usually, TLR5 is not involved in the detection of viral and fungal PAMPs, because it selectively recognizes bacterial flagellin; nevertheless, flagellin itself has been proposed as an adjuvant for vaccines against IAV and murine HCMV.(57) In particular, Salmonella typhimurium FljB flagellin (STF2) fused either with hemagglutinin antigen of the HA1 Solomon Island strain of IAV, or with M2e protein of IAV, has been developed as an adjuvant for the IAV vaccines VAX125 and VAX102, respectively.(3,20)

TLR7 and TLR8 in Viral Infections and the Role of Their Modulators

The endosomal PRRs TLR7 and TLR8 recognize GU-rich and AU-rich ssRNA sequences from the genomes of different viral pathogens. Both of them can detect PAMPs derived from yellow fever virus (YFV), HCV, ZIKV, and rhinoviruses, while several studies highlighted their involvement in HIV, IAV, RSV, VSV, CVB3, HSVs, WNV, SARS-CoV, and rotavirus infections.(10,12,28,58−60) TLR7/TLR8 stimulation has also been related to the reactivation of KSHV from latency in infected B lymphocytes.(61) However, differences between these TLRs arise in their cellular expression, since TLR7 can be mainly found in pDCs, B cells, monocytes, and macrophages, while TLR8 is primarily expressed by monocytes, macrophages, and mDCs. Furthermore, some pathogens, such as measles virus, EBOV, DENV, human T-lymphotropic virus type 1 (HTLV-1), HCV and poliovirus, can be selectively recognized by TLR7.(28) It has also been demonstrated that EBV infection upregulates TLR7 expression in B cells,(26) while the IFN-β production by pDCs in mice lungs upon RSV infection is dependent on TLR7 signaling.(17) EV-A71 infection induces a pro-inflammatory response in a TLR7-dependent manner in several cell types;(43) similarly, Langerhans cells and T-cells upon WNV infection and murine DCs, following JEV injection, seem to trigger an immune response through TLR7 signaling.(62) Notably, a TLR7 SNP has also been related to the severity of both HIV and HCV infections.(31) On the other hand, ssRNA40, a TLR8 ligand, activates innate immune cells in healthy and chronic HBV or HCV infected livers, strongly suggesting a role for this PRR in the treatment of chronic hepatitis.(15) Moreover, SNPs studies in the Turkish population suggested a role of TLR8 in the clinical outcome of Crimean-Congo hemorrhagic fever, caused by the homonymous virus.(31)
TLR7 and TLR8 dimers possess two distinct binding sites: the first one recognizes and interacts with ssRNA sequences, while the second one is located at the dimerization interface and it binds free guanosine, in the case of TLR7, and free uridine, in the case of TLR8. The first attempts to identify TLR7 and TLR8 modulators were directed toward different chemical modifications of natural oligoribonucleotides (ORNs) and nucleosides to obtain more selective and more stable ligands. In fact, the recent work by Patinote et al., which extensively reviewed several TLR7 and TLR8 modulators, highlights the fact that agonists generally possess a scaffold derived from purines and pyrimidines.(2) Imiquimod (15, IMQ; see Figure 6) was first described for its immune-stimulating activity against HSV-2, Sendai virus, and HPV.(2) Later, 15 was shown to exert antiviral activities, in the case of respiratory and HBV infections, and also to enhance the T cell response toward HIV.(25,63,64) Moreover, as a vaccine adjuvant, IMQ was shown to improve the morbidity and survival in mice following influenza challenges, when administered at the time of vaccination,(65) and it is currently under investigation for an E7 peptide-based HPV vaccine.(34) Resiquimod (16), which is a dual TLR7/8 agonist developed for the treatment of HSV-2 and HCV infections, belongs to the same structural class as IMQ. Despite failing the clinical trials for its initial applications, it has recently been shown to reduce HIV replication in cultured human monocytes and ZIKV replication in myeloid cells at micromolar concentrations.(20,66)16 also showed promising results in the enhancement of the immune response upon administration of different HIV-1 and simian immunodeficiency virus (SIV) epitopes in Rhesus macaques and it was capable of inducing an antigen-specific TH1-acquired immune response against HSV-2 infection, thus displaying interesting adjuvant effects.(58,67) Increasing efforts have been made to understand the SAR of these potent TLR agonists and to develop novel imidazoquinolines with an improved safety profile and a broader spectrum of action, as described in the review by Patinote et al.(2) Other imidazoquilones derivatives have been claimed as potential vaccine adjuvants: 2- or 7-lipidated imidazoquinolines—namely, UM-3003, UM-3004, UM-3005 (17a17c)—are potent TH1/TH17 adjuvants in influenza-challenged mice and they induce the required cytokines to generate the same TH1/TH17 response in humans;(68) 3M-012 conjugated with HIV-Gag strongly enhances TH1 response;(20) 3M-011 (18) administered either before infection or after inoculation reduces IAV titers in rats lungs; finally, the incorporation of 3M-019 into IAV vaccine promotes antibody production upon influenza challenge.(65) Several other classes of (hetero)polycyclic compounds or nucleic acids analogues with antiviral activity have been synthesized, such as pteridinones, tetrahydropyridopyrimidines, pyridopyrimidines, and guanine derivatives, and they all have been well-reviewed in the previously mentioned paper.(2) 8-Hydroxyadenine scaffold is associated with selective TLR7 stimulation and several analogues have been developed to treat HCV infection or to reverse HIV-1 latency in infected cells, when conjugated with TLR2 modulators such as Pam2Cys (CL401, 19a), 1a (CL413, 19b), or monoacyl-ethyl-cysteine (CL572, 19c).(2,69) Other 8-hydroxyadenines, such as SZU-101 (20a) and its ethacrynic acid-conjugated analogue T7-EA (20b), are promising candidates as adjuvants: the former for the inactivated H1N1 influenza vaccine, the latter for prophylactic and therapeutic HBV vaccines.(2,70) Novartis Vaccines and Diagnostic, Inc., developed the benzonaphthyridine derivative SMIP-7.7 as TLR7 agonist that protects against genital HSV-2 disease in guinea pigs.(58) In order to promote drug penetration through the skin barrier, phospholipid TLR7 agonist conjugates have been investigated as potential therapeutic tools for the treatment of viral warts. These conjugates determined a higher induction of proinflammatory cytokines, when compared to the unmodified TLR7 activator.(71) Several different compounds are currently undergoing clinical trials for the treatment of chronic hepatitis infections: the TLR7, TLR8, and dual TLR7/8 agonists RG-7854 (clinical trial identifier not disclosed), GS-9620 (21, NCT02166047, NCT01591668, NCT01590654, NCT01590641, NCT02579382, NCT02258581), RG-7795 (ANA773, NCT01211626, NCT02015715, NCT02391805), GS-9688 (22, ACTRN12617000235303), and RO7020531 (NCT02956850). Notably, 21 (NCT02858401, NCT03060447) has been extensively studied and suggested also to target latent HIV reservoirs. Recently, McGowan et al. explored the SAR of pyrimidine-based compounds and, by a high-throughput screening, dual TLR7–8 agonists were identified.(72) In particular, they varied the substituents at each position of the heterocycle and assessed their TLR activity in vitro and their inhibition of HBV replication in vivo. The best results were obtained with compound 23, which was able to target both the receptors in their homodimeric form with the same activity (lowest effective concentration (LEC) [hTLR7] = 1.6 μM, LEC [hTLR8] = 1.6 μM) and to exert anti-HBV activity.(72) Later on, the same group optimized the previously obtained lead compound and designed a series of more potent 2,4-diaminoquinazolines, which retained the dual agonist nature and the antiviral induction of IFN and cytokines. Despite not being the most potent compound of the series, 24 (LEC [hTLR7] = 0.15 μM, LEC [hTLR8] = 0.16 μM) was selected for further studies, because of its reduced off-target activity. It showed a promising in vivo pharmacokinetic and pharmacodynamic profiles, as well as good tolerability and IFN-α induction, thus promoting HBV immunity in chronically infected patients.(73) The same authors also developed a series of pyrrolo[3,2-d]pyrimidines as selective TLR7 agonists active against HBV. The best compound of the series 25 (LEC [hTLR7] = 0.4 μM) proved to be well-tolerated in vivo and induced IFN-stimulated gene response in both mice and monkeys; it also reduced HBV viral load in the serum and in the liver, thus suggesting a great potential for the treatment of viral hepatitis.(74) In addition to small molecules, several nucleic acid derivatives with antiviral activity have been developed to target TLR7 and/or TLR8. For example, synthetic dsRNA-based TLR3/7/8 agonist reduced pulmonary influenza virus, HIV and HCV levels in several animal models.(2) A phosphorothioate protected ssRNA oligonucleotide containing a GU-rich sequence, namely, ssRNA40, selectively activated liver innate immune cells to produce IFN-γ, thus suggesting a potential role for this TLR8 agonist in the treatment of HCV or HBV diseases.(15)

Figure 6

Figure 6. Chemical structures of the TLR7, TLR8, and TLR9 modulators 1527 endowed with an antiviral activity.

To date, the vast majority of TLR7 and TLR8 antagonists are modified analogues of known agonists that bind to the receptor but fail to trigger the downstream signaling. To date, only a few TLR7 and TLR8 antagonists have been developed or investigated for antiviral purposes, the main examples being chloroquine (CQ, 26), anti-miRNA oligonucleotides (AMOs) and IRS 954, which showed inhibition of TLR7/8/9 signaling. 26 was investigated for the treatment of severe sepsis, HIV, IAV, and DENV infections. AMOs proved to strongly bind TLR7 and TLR8 and to inhibit their sensing for viral ssRNA. IRS 954 (5′-TGCTCCTGGAGGGGTTGT-3′) is an oligonucleotide TLR7/9 antagonist able to decrease IFN-α production in HIV-stimulated peripheral blood monocyte cells, currently under preclinical investigation to treat HIV infections.(2)

TLR9 in Viral Infections and the Role of Its Modulators

TLR9 is the only DNA-sensing TLR, and it is expressed in the endosomes of B cells, macrophages, DCs, ECs, VSMCs, T cells, and platelets. It recognizes unmethylated cytosine–phosphate–guanine (CpG) motifs commonly found in the dsDNA of many viruses, such as poxviruses, KSHV, VZV, CMV, and human herpesvirus 6. TLR9 is also involved in the antiviral response against HSV-1, HSV-2, HAdV, and EBV in cooperation with TLR2 signaling.(10,26) Emerging evidence suggests a role for TLR9 in the detection of HPV infections.(75) There are some reports that relate TLR9 signaling to RNA viruses infections, such as HIV and EV-A71, despite the fact that it only recognizes dsDNA. Indeed, the HIV envelope glycoprotein gp120 has been shown to selectively disrupt TLR9-mediated DCs activation, thus reducing the immune response. On the other hand, the ability of TLR9 to activate the immune system in the brain of EV-A71 infected mice may be related to the sensing of host DNA derived from dying infected cells.(43,76) Moreover, it has been reported that two SNPs in TLR9 lead to enhanced progression of HIV infection.(31)
The innate immune system is able to detect DNA from pathogens in order to activate an innate immune response. This recognition is often complex and influenced by several factors, including nucleotide sequence, subcellular localization, secondary structure, and covalent modifications of the latter.(77) TLR9 ligands are represented by unmethylated CpG-oligodeoxynucleotides (CpG-ODNs) DNA sequences. Synthetic CpG ODNs differ from the natural analogues mainly for the replacement of the phosphodiester backbone with a phosphorothioated one, which confers increased stability toward nucleases. To date, four classes of CpG ODNs have been developed: class A (also known as D-type), class B (also known as K-type), class C, and class P. Their sequences are responsible for their different activities: class A ODNs induce type I IFN production in pDCs, whereas class B ODNs stimulate B cell proliferation and DC maturation.(16) The main applications of CpG ODNs as antiviral agents are in the treatment of HIV, IAV, HPV and hepatitis infections, both as drugs and as vaccine adjuvants.(20,34) For example, CpG 1826 (5′-TCCATGACGTTCCTGACGTT-3′), which is an A class ODN, elicited a strong anti-HBV response by increasing HBsAg-specific IFN-γ and IL-2 production in mice.(16) At the same time, other class A agonists have been tested with good results as HIV or SIV vaccine adjuvants.(67) Two class B ODNs, namely, CpG 7909 (5′-TCGTCGTTTTGTCGTTTTGTCGTT-3′) and 1018 ISS (5′-TGACTGTGAACGTTCGAGATGA-3′) are currently under investigation and in use, respectively, as adjuvants in HBV vaccines (Engerix-B and HEPISLAV), suitable also for immunocompromised patients.(15) Moreover, CpG 7909 was also added to the formulation of a chimeric peptide vaccine for CMV infection, with promising outcomes from a Phase 1b trial (NCT01588015). CpG 10101 (C class, sequence not available) was tested in a Phase 1b clinical trial for the treatment of chronic HCV infection, showing encouraging results and tolerable side effects (NCT00142103). SD-101 (sequence not available), which is a second-generation C class ODN, was proved to induce potent IFN-α and IFN-γ responses in HCV patients while being well-tolerated.(12) Another class of TLR9 agonists are the so-called immune modulatory oligonucleotides (IMOs), which are synthetic DNA structures containing the dinucleotide motifs CpR or RpG, where R is a synthetic analogue of a base, characterized by a higher metabolic stability. IMO-2125 is a member of this class that showed promising results in a Phase I trial on HCV patients (NCT00728936). MGN 1703 (5′-AAAGTCTCGGGGCGTTCTTAGGTGGTAACCCCTAGGGGTTACCACCTTCATTGGAAAACGTTCTTCGGGGCGTTCTTAGGTGGTAACCCCTAGGGGTTACCACCTTCATTGG-3′) is a dsDNA sequence with a double-stem tridimensional structure including CG motifs without any chemical modification, which was shown to induce a strong antiviral innate immune response and boost NK cell-mediated suppression of HIV-1 infections in CD4+ T cells.(78) Finally, also the natural product oxymatrine (27, Figure 6), extracted from the herb Sophora alopecuraides L., seems to induce the TLR9 pathway and the secretion of antiviral cytokines, thus enhancing the effect of TLR9 ligands in chronic HBV patients.(79)
Although the main application of TLR9 antagonists is for autoimmune and inflammatory diseases, in some cases, the inhibition of this receptor may be a useful strategy to counteract viral infections. It has been reported that, by inhibiting the infiltration of CD4+ lymphocytes into the SIV infected vaginal environment a limitation of the initial systemic dissemination of the virus may occur. Thus, TLR7 and TLR9 inhibition can exert a positive role in SIV or HIV infections. For this reason, several studies explored the modification of ODNs required to exert an antagonist effect on TLR9. Fraietta et al. reported that a baseless 14-mer phosphorothioate 2′-deoxyribose backbone was endowed with a dual activity against HIV, limiting both the viral replication and the TLR9-mediated recruitment of susceptible immune cells response.(80)

TLRs and Bacterial Infection

ARTICLE SECTIONS
Jump To

As reported by several recent studies, TLRs play a fundamental role in host defense against microbial infections.(81) Studies conducted in models of Legionella pneumophila and Staphylococcus aureus infections defined the importance of MyD88-dependent responses in host protection following a TLR-signaling cascade.(82) Further evidence emerged from TLR knockout (KO) mice models exposed to various pathogens: they showed hyporesponsiveness against the infectant, a reduced release of pro-inflammatory cytokines (TNF-α, IL-6, IL-1) and, therefore, decreased host cell survival.(83) Mammalian TLRs exposed on the plasma membrane recognize bacterial cell surface components, while endosomal TLRs are responsible for the detection of intracellular nucleic acids from viruses and bacteria.(84)

TLR2/1 and TLR2/6 in Bacterial Infections and the Role of Their Modulators

Triacyl lipoproteins (from Gram-negative bacteria and some Gram-positive bacteria) and diacyl lipoproteins (from Gram-positive bacteria and mycoplasma) are known to be recognized by TLR2/1 heterodimers and TLR2/6 heterodimers, respectively. A well-characterized TLR2 agonist is 2 originally isolated from Mycoplasma fermentans. When administered in mice, by intratracheal instillation of (0.5 μg), 2 resulted in the activation and recruitment of macrophages and neutrophils into lungs. Furthermore, it reduced the pulmonary bacterial burden in Streptococcus pneumoniae infections following the increase in levels of C–C motif chemokine ligand 5 and leukocyte migration.(85) Lipopeptides derived from bacterial lipoproteins activate the innate immune system by engaging TLR2, without any apparent toxicity in ex vivo human blood models. Evidence suggests that this class of compounds may represent safe and effective vaccine adjuvants to be applied against bacterial infections.(86) Pam2Cys has been incorporated in many lipopeptide vaccine candidates, as a result, becoming a potent adjuvant. Pam2Cys plays a pivotal role in lipopeptide-based vaccines immunogenicity by enabling them to target and activate DCs.(87) A major cause of mortality that occurs with influenza virus is represented by the comorbidity of bacterial infections, as in the case of influenza accompanied by pneumonia caused by Streptococcus pneumoniae. Prophylaxis with the pegylated analogue of Pam2Cys (PEG-Pam2Cys, 20 nmol by the intranasal route 3 days before infection) determined a reduction of the impact of S. pneumoniae infections.(88) The authors of this study reported that PEG-Pam2Cys (28, Figure 7) decreased the pulmonary bacterial burden, the level of pro-inflammatory cytokines, and the permeability of lungs’ blood vessels; therefore, it was able to limit the spread of the bacteria into the blood.(88) The growing interest for this class of lipopeptide agonists prompted several efforts of different research groups in developing new derivatives characterized by simpler structures and an improved pharmacokinetic profile. Wu et al.(89) investigated the importance of the highly conserved Cys residue of these peptides, as well as the stereochemistry and geometry of the Cys-Ser dipeptide unit. They found that the thioether bridge is essential for the retention of the activity.(89) Further studies focused on optimizing the length of the acyl chain. SAR studies led Salunke et al. to synthesize a series of selective hTLR2 agonists analogues characterized by a single C16 acyl chain on the oxygen of the thioether bridge and acyl chains of different lengths and compositions on the amino group of the Cys residue.(90) In this way, they obtained a highly potent lead compound (29, EC50 = 5.52 nM) but with poor water solubility. With the aim of synthesizing a fully optimized (highly water-soluble and chemically stable) hTLR2-specific agonist, they designed a new class of compounds characterized by a C16 carbamate moiety and a tertiary amine. Compound 30, which is the prototypical compound of this series, showed an excellent safety profile and prominent adjuvant activities.(86) Given their extensive potential applications, many of these lipopeptide TLR2 agonists have been evaluated for several therapeutic uses and reached different stages in clinical trials.(91) One of the most recent and successful examples of a self-adjuvanting lipopeptide vaccine composed of two factor H binding proteins (rLP2086-A05 and rLP2086-B01) linked to a TLR2 agonist similar to Pam3Cys is Trumenba. It was developed by Pfizer, and it received U.S. Food and Drug Administration (FDA) approval in 2014 for the treatment of meningococcal meningitis (caused by Neisseria meningitidis serogroup B) in patients 10–25 years old.(92,93) For a better understanding of the TLR modulation machinery, several research groups designed new molecular entities to decipher the mechanisms responsible for TLRs dimerization and ligand binding.(94) On the basis of a high-throughput screening on a chemical library of 24 000 compounds and by using several biophysical assays, Cheng et al. synthesized and characterized a novel class of small-molecule TLR2-ligands. One of these compounds, namely, CU-T12-9 (31), was able to facilitate TLR2/1 dimerization (with an IC50 value of 54.4 nM), thereby activating the transcription of NF-κB. This event upregulates the release of pro-inflammatory cytokines and chemokines, as well as costimulatory molecules of DCs, which are crucial for T cell activation and the subsequent challenge against pathogens.(95) The discovery of 4, together with the resolution of the crystal structure of many TLRs, has paved the way for the rational design of a new class of small molecules that might overcome the problems of lipopeptide agonists, such as high molecular weight and lipophilia, as well as problems related to drug delivery.(96) Accordingly, in a recent work, Hu et al. identified a group of TLR2 agonists characterized by a dihydropyridine–quinolone carboxamide scaffold. These compounds (31a31c) turned out to be modulators of TLR2/TLR6 dimerization with EC50 values ranging from 1 μM to 10 μM. Moreover, extensive SAR studies demonstrated that (i) the carboxamide moiety is fundamental for their TLR2/TLR6 agonistic activity and (ii) these compounds are potentially useful as vaccine adjuvants in infectious diseases, similar to 1b. Further studies are ongoing to explore both the dihydropyridine and quinolone rings, in order to obtain new analogues with a better potency and pharmacokinetic profile.(97)

Figure 7

Figure 7. Chemical structures of TLR2, TLR4, and TLR5 modulators 2833 discovered for the treatment of bacterial infections.

TLR3 and TLR4 in Bacterial Infections and the Role of Their Modulators

Ribes et al. reported the stimulation of TLR3 with the viral agonist poly(I:C). Treatment with different doses of poly(I:C) (0.1, 0.3, 1, 3, 10, 30, and 100 μg/mL) and 100 U/mL of IFN-γ resulted in the enhancement of primary microglia cells ability to phagocytose and kill bacteria (E. coli K1 strain) by increasing the release of cytokines/chemokines and NO in a dose-dependent manner. They also suggested that this kind of treatment could be useful for preventing brain bacterial infections in vivo.(98) Despite these good results, further investigation by other research groups uncovered some issues related to bacterial infection treatment with poly(I:C). In fact, Jackson et al. reviewed some of these reports indicating that the release of cytokines/chemokines may lead to adverse events in the host and also to the further increase in bacterial burden.(85) Collected data suggest the need for further studies in order to explore the risks/benefits ratio of using TLR3 agonists for the treatment of bacterial infections.
TLR4 has been long described as the target for Gram-negative LPS. However, it can also be activated by various bacterial proteins, which play an important role in the generation of protective immune responses, such as some bacterial proteins from Brucella abortus, Neisseria meninigitidis, Mycobacterium paratuberculosis, and Streptococcus pneumoniae. In recent years, several other ligands have been identified from both exogenous sources and the host cells. It has been demonstrated that TLR4 activation is a complex process, depending on both TLR4 association with LPS and the further noncovalent binding with MD2 on the cell surface, which activates the dimeric complex (LPS-MD2-TLR4)2.(99,100) Lipid A represents both the membrane-anchoring moiety and the biologically active (and toxic) portion of LPS. Apart from lipid A of E. coli, which is endowed with endotoxic properties, there are many natural variants of lipid A able to determine changes in pathogenesis, bacterial physiology, and bacterial interactions with the host immune system.(101) Synthetic analogues of lipid A, obtained by dephosphorylation or substitution of the sugar backbone, resulted in low-toxicity TLR4-agonists, such as 9 and AGPs, which are currently in use as vaccine adjuvants. In a recent study, Fensterheim et al. showed that the in vivo (mice) treatment with MPLA (intraperitoneal (ip) or intravenous (iv) injection of 20 μg MPLA in 0.2 mL of lactated Ringer’s solution) resulted in an increased resistance to infection by inducing a metabolic reprogramming of macrophage cells and the subsequent enhancement of pathogen clearance. This event was induced by the overexpression of MyD88- and TRIF-dependent signaling pathways, as well as the mammalian target of rapamycin (mTOR) activation.(102) The synthetic AGPs derivative CRX-547 (32, Figure 7) revealed a TRIF-selective signaling in human cells, thus resulting in a reduced release of pro-inflammatory mediators, with respect to that associated with MyD88 signaling, and reduced toxicity. The experiment was performed in macrophages (differentiated from THP-1 cells) by stimulating the cultures with 1 μM CRX-547 for 14 h; the parameters (amounts of TRIF-dependent cytokines/chemokines and TNF-α) then were evaluated.(103) The growing interest for the modulation of TLR4 as a therapeutic target for infectious diseases drove several research groups to further investigate both natural products and synthetic derivatives as TLR4 modulators in order to determine the best features for the enhancement of the immune system response of the host against pathogens. Research advances in this field have been nicely reviewed by Peri and Pascual.(39,104) Besides the above-mentioned approaches, there are other ways to modulate TLR4 signaling that will be later discussed for the treatment of bacterial sepsis.

TLR5 and TLR9 in Bacterial Infections and the Role of Their Modulators

Several mammal cells, tissues, and organs are equipped with TLR5 for the detection of flagellin. S. pneumoniae is the main causative agent of pneumonia worldwide. Flagellin isolated from S. typhimurium (1 μg in saline solution) promoted mice survival, following S. pneumoniae infections, by recruiting neutrophils, as well as the release of IL-6, CXCL-1/2/20, and TNF-α into the airways.(85) TLR5 is also abundantly expressed on the basolateral side of intestinal epithelial cells. The overexpression of TLR5 in the gastrointestinal tract is consistent with the prominent location of bacteria in this area, in order to prevent diseases associated with intestinal inflammation. However, an excessive TLR5 response to bacterial flagellin might result in the disruption of the epithelial barrier integrity and in the further exacerbation of the inflammation process. It is also known that TLR5 plays a central role in the innate immune response against uropathogenic bacteria and Legionella pneumophila.(105) Flagellin contains two to four domains (D0, D1, D2, and D3), depending on the bacterial species. D0 and D1 domains are involved in the recognition and activation of TLR5. An arginine residue on D1 domain forms a hotspot with chemical and geometrical complementarity in the leucine-rich repeat 9 (LRR9) loop of TLR5.(106) From a therapeutic point of view, recombinant flagellin proteins have been widely used in clinical trials targeting TLR5, whereas small molecules are being tested in preclinical studies in order to investigate the consequences of TLR5-flagellin complex disruption. The use of flagellin as vaccine adjuvant could represent a valid approach in the enhancement of immune responses in elderly patients.(107) In the recent years, TLR5 became an attractive target for the modulation of the immune response, because it only detects proteins. Indeed, peptides derived from flagellin could be used as TLR5 activators, while modified analogues of the latter could inhibit TLR5.(3) Nevertheless, the discovery of compounds capable of interfering with the TLR5-flagellin complex produced only a few examples, because of the difficulties in disrupting protein–protein interactions. Recently, by a high-throughput screening, Yan et al. identified two hit compounds with a common pharmacophore that were used to successfully develop a series of small molecules as novel inhibitors of flagellin binding to TLR5.(108) Further investigations led this research team to synthesize a pyrimidine triazole thioether derivative (TH1020, 33; see Figure 7) with promising activity (IC50 = 0.85 ± 0.12 μM) and selectivity. Notably, TH1020 represents a potential lead compound for the identification of novel therapeutics targeting TLR5.(108) In addition to the important role in immunoregulation, bacteria are also able to cause local and systemic inflammation. Chronic inflammation, as well as some bacteria, such as H. pylori, have been shown to promote oncogenesis. Kauppila et al. showed that TLR5 expression levels are predictors of the survival and recurrence of patients affected by oral tongue squamous carcinoma. Therefore, TLR5 may represent a key element for the treatment of bacterial infections during oral oncogenesis.(109) Further investigations are necessary to shed new light on the role of TLR5 in both sustaining immune homeostasis and the clearance of pathogenic bacteria.
The recognition of pathogens and nonself components must be efficient in order to orchestrate an appropriate response, thereby limiting excessive inflammation and the insurgence of autoimmune diseases. Indeed, the immune system evolved in order to protect the host from pathogenic insults, but the development of uncontrolled inflammation must be avoided to prevent autoimmune diseases. Accordingly, immune responses are typically downregulated during the physiological processes of tissue remodeling to accelerate the resolution phase of inflammation.(110) The TTAGGG tandem motif ((TTAGGG)n), which is present in mammalian telomeres, regulates this immunosuppression, and this effect can be mimicked by using synthetic (TTAGGG)n-ODNs.(111,112) This event culminates in the development of an innate immune response, which can be applied to limit the spread of pathogens and enhance adaptive immunity, which can be exploited to improve vaccines.(113) Taken together, these considerations make TLR9 one of the most promising targets for fighting against infectious diseases. Chuang et al. reported that several synthetic CpG-ODNs generate potent immune stimuli by inducing the production of pro-inflammatory cytokines and a TH1-dependent immune response. This mechanism increases the expression of co-stimulatory molecules in APCs and, consequently, the activation of T, B, and NK cells. The experiment was performed by treating human PBMC cultures with a 0.3 μM concentration of different CpG-ODNs. They also demonstrated that the immunostimulatory activity is closely related to the number, spacing, and position of the bases surrounding CpG-motifs, which also determine the species-specific activity.(114) CpGs pretreatment (250 nM, 4 h before infection) resulted in effectively reducing S. aureus survival in osteoblast-like SAOS-2 cells. Since S. aureus has been recognized as the causative pathogen of osteomyelitis, scientists(115) demonstrated that this beneficial effect is ascribable to the stimulation of TLR9 with CpGs and the subsequent induction of oxidative stress in the affected cells. Therefore, the treatment with ODN2216 (5′-GGGGGACGA:TCGTCGGGGGG-3′) or ODN2006 (5′-TCGTCGTTTTGTCGTTTTGTCGTT-3′) might represent a therapeutic option for the management of this disease.(115) The emergence of methicillin-resistant strains of S. aureus, because of the excessive use of multiple antibiotics, represents a serious complication that is spreading worldwide. CpG-DNAs are known to trigger the differentiation and proliferation of B cells, thereby increasing the production of antibodies. Kwon and colleagues showed that ip injection of CpG-DNA 1826 (5′-TCCATGACGTTCCTGACGTT-3′, 50 μg) determined an increased production of bacteria-reactive IgM in both peritoneal fluid and serum through the TLR9 signaling pathway. They also proved that the monoclonal IgM antibodies enhanced the phagocytosis process of murine macrophage cells against S. aureus MW2 infection.(116) Apart from the use of a single TLR ligand, an alternative approach in protecting the host against pathogen insult provides the use of multiple TLR agonists. Indeed, the combination of the TLR2/6 agonist, 1a and the TLR9 agonist, ODN2395 (5′-TCGTCGTTTTCGGCGC:GCGCCG-3′), exerted a synergistic action against both virulent Gram-positive and Gram-negative bacteria. In this experiment, cells were treated with 20 μL of a RMPI-1640 solution containing 10 μg/mL of 1a and 20 μg/mL of ODN2395. In particular, this combination guaranteed protection against some cases of bacterial pneumonia, in which the monotherapy has failed and that are characterized by a high mortality rate worldwide. Moreover, this approach could represent an effective antimicrobial strategy for the development of vaccines able to enhance mucosal T cells immune response.(117)

TLR Modulators in Sepsis

ARTICLE SECTIONS
Jump To

The stimulation of TLRs signaling plays a central role in the immune response to microbial infections, but the pro-inflammatory molecules induced by the activation of these pathways may also be detrimental for the host when an excessive and generalized sepsis occurs. Sepsis is the most common cause of death in hospitalized patients. The management of sepsis primarily aims to support patients through the iv administration of fluids, vasoactive molecules, and antibiotics in order to fight the pathogen. To date, no drugs have been approved by FDA for the treatment of sepsis, and those that reached clinical trials failed to reduce mortality, thus indicating the need for further investigation. The main culprits of sepsis are Gram-positive and Gram-negative bacteria, such as S. aureus, S pneumoniae, E. coli, P. aeruginosa, and Klebsiella spp., as well as some fungal species (e.g., Candida spp.) and viruses (e.g., IAV). Sepsis is a multifactorial condition characterized by the activation of several complex molecular and cellular processes (e.g., NF-κB, TNF, IL-6, IL-12, IFNs, IL-1β, and IL-18) that generate micro- and macro-circulatory disorders involving vasodilatation (angiopoietin-2- and NO-mediated), capillary leakage and coagulopathy (caused by the release of neutrophil extracellular traps, the Von Willebrand factor, adenosine, bradykinin, and reactive oxygen species (ROS)). These events, together with inflammation, may result in a life-threatening multiorgan dysfunction syndrome. As opposed to these pro-inflammatory stimuli evolving during sepsis, other events that support immunosuppression are involved in the disease. The immune system undergoes a complete reprogramming of its cells by activating several immunosuppressive mechanisms: reduction in the number of lymphocytes, recruitment of anti-inflammatory immune cells, and the altered expression of sensors, such as human leukocyte antigen-DR isotype and programmed cell death protein 1 (PD1)/antiprogrammed dead ligand 1 (PD-L1), together with metabolic and epigenetic remodulations. Unfortunately, such compensatory mechanisms are not always enough to restore homeostasis in patients. The latest discoveries regarding the molecules subject of clinical trials for the treatment of both the hyperinflammatory and immunosuppressive phases of sepsis have been exhaustively reviewed by Roger, Peri, and Steinhagen. The most relevant clinical trials are those regarding the use of 8 and TAK-242 (34, Figure 8) for the treatment of patients with severe sepsis. 34 is a small molecule developed by Takeda that selectively blocks TLR4 signaling pathway by binding to the Cys747 residue in the intracellular domain of TLR4, thus preventing the interactions between TLR4 and its adaptor molecules MAL and TRAM. It has been evaluated in a randomized, double-blind phase II trial (NCT00143611), but it failed to suppress cytokine levels in patients with sepsis. Despite these unsatisfactory results, both compounds showed good safety and tolerability profiles and 8 was able to treat the cytokine storm; therefore, they are currently under evaluation in other clinical tests.(118−120) Causative pathogens of sepsis are endowed with ligands that trigger TLRs, especially TLR4, as the presence of LPS significantly contributes to sepsis development. Accordingly, various TLR inhibitors, from both semisynthetic and synthetic origins, have been evaluated and new modulating approaches are currently being devised. Preliminary studies conducted by Yin et al. led to the discovery of a new class of small-molecule TLR4 inhibitors as potential tools for sepsis treatment. They developed several derivatives with a β-aminoalcohol moiety able to disrupt the MD2/TLR4 complex, but characterized by a modest activity (in the micromolar range).(121) Further studies focused on the development of simplified analogues of lipid A. Among them, compound 35, bearing two phosphate groups, was effective in reducing TLR4 signaling. Its activity profile has been investigated by computational analysis and experiments on macrophages. It emerged that the activity of 35 was dependent on both the interaction with MD2/TLR4 complex and CD14 (which upregulates TLR4 signaling by binding to LPS).(122) The development of novel lipid A derivatives as TLR4 antagonists inspired the discovery of compounds 36a [IAXO101] and 36b [IAXO102], which are positively charged monosaccharide glycolipids, and 36c [IAXO-103], which is the analogue obtained by the replacement of the glucopyranoside core with an aromatic ring. Because of their inhibitory activity on TLR4, they were effective in treating acute sepsis and ALI induced by viral infections.(39) Moreover, several natural compounds endowed with anti-inflammatory activity—for instance, chalcone derivatives, naringenin (37), and sparstolonin B (SsnB, 38)—were shown to interfere with TLR2 and TLR4 pathways and to be potential therapeutic candidates for viral-induced sepsis.(123,124) An intensive SAR study allowed Katzenellenbogen et al. to accurately characterize the triaryl pyrazole scaffold for TLR inhibition.(125) Studies performed on several basic side chains and variations of the electronic profile of the aryl rings provided a better knowledge around the features needed for the inhibition of TLRs. They finally succeeded in obtaining compounds able to block the signaling of multiple TLRs simultaneously (39a39c), as well as selective TLR7 and TLR9 inhibitors, which are involved in the pathogenesis of sepsis. The identified compounds are endowed with good potency and toxicity profiles, and could represent a valid approach for the discovery of new molecular entities to be used in the treatment of sepsis.(125) In a work by Talukdar and Ganguly, the development of selective TLR9 inhibitors was described. Their investigation on the quinazoline scaffold led to the synthesis of compounds with favorable in vitro ADME and pharmacokinetics. Noteworthy, compound 40 showed an inhibition potency lower than 50 nM and a selectivity index for TLR9 more than 600-fold greater, with respect to TLR7.(126)

Figure 8

Figure 8. Chemical structures of the TLR modulators 3441 involved in sepsis and parasitic diseases.

TLRs Modulation for the Treatment of Malaria and Other Parasitic Diseases

ARTICLE SECTIONS
Jump To

Despite the undeniable progresses in prevention, diagnosis, and therapy of malaria, it still represents a devastating disease, that kills millions of people each year in many developing countries.(127) Current knowledge about the regulatory role played by the innate immune system in malaria still remains limited. An inadequate activation of the innate immune system could theoretically promote the growth of the parasite, whereas the hyperactivation could lead to an excessive release of pro-inflammatory mediators and a consequential worsening of the disease. Therefore, TLRs have emerged as a potential target for the modulation of host immune response during malaria infection. Among human TLRs, TLR2, TLR4, TLR7, and TLR9 can detect plasmodial antigens, thus inducing an antimalarial immune response. Accordingly, many efforts have been made in order to elucidate the involvement of TLRs in severe malaria pathogenesis and of the signaling pathway involving TLRs during infection. Kalantari has recently reviewed the mechanisms by which Plasmodium components (especially glycosylphosphatidylinositol anchors, hemozoin and DNA) are recognized by the immune system, highlighting the role of TLRs in sensing these molecules.(128,129) The major issues that limited the development of an effective vaccine or chemotherapeutic agent for malaria treatment over the years are the high antigenic variability within parasite populations and the capacity of the latter to quickly develop a resistance to drugs. In order to provide an alternative approach for the development of an effective vaccine for malaria prevention, Chua and Culletton described a protocol that potentially grants protection from parasitic invasion and simultaneously stimulates the host immune system.(130) They investigated the activity of the TLR2 agonist PEG-Pam2Cys in mouse models of malaria induced by P. voelii, in both hepatocytic and erythrocytic stages. Results showed a significant decrease in the number of malaria parasites in mice liver, following sporozoites invasion. Moreover, 28 was able to completely clear parasites from the liver if administered into full-blown malaria. Further investigation also showed a reduction in the number of infective mosquitoes, following their blood feeding on gametocytaemic mice, thus indicating that this TLR2 agonist could be used for both treating the liver stage of malaria and for the prevention of malaria itself.(130) Further attempts to exploit TLR agonists as potential antimalarial vaccine adjuvants have been recently reviewed by Salunke and Coban.(131,132) The recent advances in malaria vaccines formulations involved the incorporation of TLR2 agonists (Pam2Cys and Pam3Cys), TLR3 agonists (poly(IC:LC)), TLR4 agonists (3-O-deacylated-MPLA (3D-MPLA) and GLA), TLR5 agonists (flagellin), TLR7/8 agonists (imiquimod), and TLR9 agonists (CpG-ODNs). Among these, one of the most important examples is represented by the TLR4 agonist 3D-MPLA (41, Figure 8). Indeed, it has been employed as an adjuvant in the production of the experimental RTS,S/AS01 malaria vaccine (Mosquirix) by GlaxoSmithKline. Since February 2019, it has been undergoing clinical evaluation to investigate its safety profile in Ghana, Kenya, and Malawi (NCT03806465).(131,132) Besides being used as vaccine adjuvants, TLR ligands hold another potential application as mitigating agents for the inflammatory profile related to the disease. Therefore, considering the involvement of multiple TLRs in the recognition of plasmodial components, it is conceivable that the pan-TLR inhibitors developed by Pollock et al. could represent an alternative approach for the management of malaria.(125) Other parasitic diseases, such as trypanosomiasis, leishmaniasis, and schistosomiasis, represent a huge socioeconomic burden and leading causes of death, in endemic areas.(133,134) To date, no vaccine has been approved for the prevention of these major problems, thus indicating the need for a better understanding of the pathogenesis of such diseases and even more of the mechanism by which the host immune system recognizes and faces the parasites.(135) Nowadays, research efforts led to the identifications of the PAMPs recognized by host immune system and the pathways involved in the inflammation and resolution processes (reviewed by Babu et al.).(136) Unfortunately, the application of TLR agonists/antagonists led to few or unsatisfactory results in parasites clearance. On the other hand, the use of TLR ligands resulted in the enhancement of the efficacy of experimental vaccines,(137) thus underlying, once again, the pivotal role played by TLRs in driving the immune system in the fight against micro-organisms.

TLRs Modulation for the Treatment of Fungal Infections

ARTICLE SECTIONS
Jump To

Fungal pathogens have been less extensively studied, compared to viruses in relation to TLRs. Nevertheless, some TLRs seem to be involved in fungal infections, especially by Candida spp., Cryptococcus neoformans, and Aspergillus fumigatus, which cause life-threatening diseases. Indeed, heterodimers of TLR2 with TLR1 and TLR6 are associated with the recognition of widespread fungal PAMPs, such as β-glucans, and other species-specific molecules, e.g., phospholipomannans of Candida albicans and glucuronoxylomannan (GXM) of Cryptococcus neoformans. Nevertheless, other evidence suggest a dual role for TLR2 signaling in Candida spp., since the pattern of ILs expressed by TLR2-deficient mice is associated with an increased resistance to the infection.(25)Aspergillus fumigatus, in both the conidia and hyphae forms, is able to stimulate TLR2 signaling, although the mechanism and the related PAMPs are still unclear.(138) Interestingly, an increased susceptibility to A. fumigatus infection has been related to SNPs in TLR1 and TLR6.(31,139) Only a few reports suggest a role for TLR3 in the detection of fungal PAMPs, but it is confirmed that A. fumigatus dsRNA from conidia is sensed by this PRR in lung epithelial cells.(138) TLR4 also is stimulated by fungal PAMPs, such as C. albicans O-linked mannosyl chains present in the cell walls or C. neoformans GXM; moreover, A. fumigatus conidia are able to present yet unknown ligands to activate TLR4 signaling.(138,139) Interestingly, only TLR7, but not TLR8, seems to be involved in the immune response against fungal pathogens, since murine bone-marrow DCs detect Candida spp. and other fungal ssRNA through this receptor.(138,139) Moreover, since unmethylated CpG motifs can be found also in genome DNA of several fungal species, A. fumigatus and C. neoformans among the others, also TLR9 may play a role in the recognition of fungal pathogens.(138) To further support the antifungal role of this receptor, recent studies showed the importance of two SNPs, namely, 1237C/T and P99L, in promoting susceptibility to pulmonary aspergillosis.(31)
Currently, only a few compounds have been developed to fight fungal infections, and the majority of them are synthetic small molecules originally identified with other purposes. It has been shown that prolonged exposure of C57BL/6 mice to 1b protects the kidneys and spleen from C. albicans invasion during systemic infection.(140) Moreover, 1b promoted a marked increase of intracellularly killed C. neoformans in microglial cells, compared to control cells, thus suggesting TLR2 agonists as potential candidates for the prevention and treatment of CNS infections caused by C. neoformans.(141) To the best of our knowledge, no TLR ligands have been specifically developed to fight fungal infections. Indubitably, further studies are needed to better elucidate the antifungal potential of TLR modulation, thus prompting a way for the design of compounds to be able to address this unmet medical need.

TLRs and Inflammation

ARTICLE SECTIONS
Jump To

Inflammation has been established as a pivotal issue in several pathological conditions, such as sepsis, cancer, and diabetes. Since TLRs are widely expressed in endothelial cells (ECs), they can influence the pathogenesis and outcomes of certain inflammatory disorders where these cells are involved. The TLR signaling pathways behave differently upon stimulation from monocytes or macrophages. Following TLR stimulation, ECs secrete IFN-β, IL-1α, IL-6, IL-10, IL-28, IL-29, granulocyte-colony stimulating factor (G-CSF), and granulocyte macrophage colony stimulating factor (GM-CSF) as major cytokines; meanwhile, leukocytes secrete G-CSF, IL-1α, IL-1β, IL-2, IL-6, IL-9, IL-10, IL-12 (p35, p40, p70), IL-13, IL-15, IFN-α, IFN-β, IFN-γ, transforming growth factor-β1 (TGF-β1), and TNF-α. TLR3 is highly expressed in ECs and involved in the secretion of embryonic alkaline phosphatase after treatment with the agonist poly(I:C).(142) Overactivation of TLR4 signaling upon pathogen- or host-derived PAMPs and DAMPs is strongly associated with the insurgence of a wide variety of inflammation-related diseases, such as septic shock, acute lung injury (ALI), asthma, chronic obstructive pulmonary disease (COPD), airway epithelium inflammation, liver failure, bowel chronic inflammations, allergies, and others.(25,123,143) TLR7 and TLR8 have been recognized as IFN-α inducers and they are expressed in myeloid DCs, monocytes, and monocyte-derived DCs; they evoke distinct cytokine responses, depending on the involved tissue. In particular, TLR7 has been validated as a potential target in asthma management.(144) These considerations demonstrated that TLR modulators represent a promising strategy to treat inflammation. Recently, starting from a computational approach, several TLR ligands have been discovered and assayed under inflammatory conditions.(94) In the context of allergies and asthma, an inappropriate TH2 T-cell response to environmental antigens is usually observed. The functions and cell development of TH2 can be compensated by cytokines released from TH1 T cells, thus modulating these inflammatory conditions. In this context, TLR4 and 9 agonists (monophosphoryl lipids, and CpG-ODN) resulted as a strong inducer of TH1 response and have been evaluated as potential agents against allergic rhinitis. Moreover, TLR7/8 agonists (including imidazoquinolines) showed efficacy in animal model against allergic asthma, by switching the cytokine profile from TH2 to TH1.(2,8)

TLR2/1, TLR2/6, and TLR3 Modulators against Inflammatory Disorders

One of the most studied antagonists of TLR2 heterodimers was CU-CPT22 (42; see Figure 9). Discovered in 2012, it prevents the inflammatory cascade by disrupting both TLR2/TLR1 and TLR2/TLR6 heterodimers. Furthermore, the natural polyphenolic compound phloretin (43) significantly inhibited 1b-induced TLR2/1 signaling in RAW264.7 cells, by blocking NF-κB-p65 expression, with a consequent reduction in the secretion of TNF-α and IL-8.(145) SMU-8c (44), which is a gallic acid derivative, exhibited the most potent anti-inflammatory profile in RAW264.7 macrophages, with an IC50 value of 22.5 ± 2.6 μM. It inhibited the formation of TLR1/TLR2 and TLR2/TLR6 heterodimers and downregulated the expression of nitric oxide (NO) and TNF-α. In the monocytic inflammatory MUTZ-3-cell model, in which inflammation is mediated by TLR2–TLR4 signaling, soyasaponin I (45) suppressed pro-inflammatory cytokine and chemokine secretions in a dose-dependent manner (5–100 μg/mL), by influencing both TLR2 and TLR4 activity.(146)

Figure 9

Figure 9. Chemical structures of TLR2/1, TLR2/6 and TLR3 modulators 4246 involved in inflammatory diseases.

Oleanolic acid acetate (OAA, 46), a triterpenoid compound extracted from Vigna angulariz, was able to downregulate the expression of poly(I:C)-induced pro-inflammatory cytokines and chemokines genes, such as monocyte chemotactic protein-1 (MCP-1), IL-1β, IL-8, vascular cell adhesion molecule-1 (VCAM-1), and intracellular adhesion molecule-1 (ICAM-1). OAA behaved as an TLR3 antagonist, limiting the activation of NF-κB/MAPK/IKKα/β signaling pathway in monocyte THP1-XBlue cells.(147)

TLR4 Antagonists to Treat Inflammatory Disorders

The main examples of TLR4 antagonists are 8 and 34; indeed, the latter compound has recently been proposed as a potential therapeutic candidate for the treatment of liver failure-induced systemic inflammation, of post-hemorrhagic brain edema and BBB disruption.(143,148) Moreover, the interest for 34 prodrugs is increasing due to their potential to be delivered to a specific target, as in the case of pancreatic islets, in order to protect them from inflammatory response during transplantation.(149) Extensive SAR studies of LPS or lipid A derivatives led to the discovery of new agonists and antagonists endowed with better pharmacokinetic and therapeutic profiles. CRX-526 (47, Figure 10), an AGP showed beneficial effects on colonic inflammation in mice models.(104) The diphosphorylated diacylated monosaccharide 14 was proposed to treat ALI and sterile inflammation disesases.(150) RS-LPS, an under-acylated form of Rhodobacter sphaeroides LPS, was shown to improve asthma symptoms by reducing the release of pro-inflammatory cytokines.(25) Beside TAK-242, several other compounds unrelated to LPS have been designed in order to treat sterile inflammation and related pathologies: AV411 (48), T5342126 (49), and NCI 126224 (50) are three small molecules potentially able to treat a wide variety of inflammatory diseases, including chronic fatigue syndrome and RA.(21) Two DNA aptamers, called ApTLR#1R and ApTLR#4F, and their corresponding optimized forms (ApTLR#1RT and ApTLR#4FT), were identified through a computational screening as selective TLR4 antagonist in HEK-Blue-hTLR4 cells showing the maximal inhibition at 20 nM. Moreover, it was shown that at least ApTLR#4F and ApTLR#4FT ameliorated stroke symptoms in different animal models, thus suggesting them as potential candidates for the treatment of diseases, which are worsened by TLR4-dependent signaling.(151) In 2015, Flacher and co-workers assessed the anti-inflammatory activity of two mannoside glycolipid conjugates (MGCs), 51a and 51b with promising anti-inflammatory and lung protective effects mediated by TLR4 inhibition.(152) Interestingly, several natural compounds already known for their anti-inflammatory properties have been suggested to act, at least in part, through the inhibition of TLR4 signaling. Many examples from a wide variety of natural sources have been reviewed by others.(39,123) Lu et al. reported an interesting anti-inflammatory activity for the water and methanolic extracts of the mushroom Cordyceps cicadae and demonstrated that its components, namely, adenosine, cordycepin (3′-deoxyadenosine) and N6-(2-hydroxyethyl)-adenosine (HEA, 52a52c, respectively), inhibited the LPS-induced expression of TNF-α and prostaglandin E2 (PGE2) in RAW264.7 macrophages at 2.5, 1, and 5 μg/mL, respectively. Moreover, HEA was shown to reduce the expression of TLR4 and to decrease NF-κB translocation to the nucleus, thus downregulating the production of several pro-inflammatory proteins.(153) Similarly, parthenolide (53), which is a sesquiterpene lactone extracted from the herb Tanacetum parthenium, abolished in a dose-dependent matter the LPS-induced upregulation of pro-inflammatory cytokines and NO in THP-1 cells (human monocytic cells). Flow cytometry assays proved the ability of this compound to inhibit TLR4 expression (IC50 = 1.4 μM), thus suggesting that the anti-inflammatory activity of 53 could be exerted through the modulation of this pathway.(154) In 2019, Ye et al. reported that chlojaponilactone B (54), which is a sesquiterpenoid extracted from Chloranthus japonicum, was able to reduce the LPS-induced production of several cytokines and inflammation-related enzymes through the suppression of NF-κB, similarly to 34. Moreover, docking studies suggested the possibility for this natural compound to bind TLR4 in the same pocket as TAK-242.(155) In the same year, another traditional Chinese medicinal herb, namely, Salvia miltiorrhiza, was investigated for its anti-inflammatory properties. It was found that one component, diethyl blechnic ester (55), showed no toxicity on RAW264.7 cells, and exerted an anti-inflammatory activity by inhibiting the LPS-induced expression of inducible nitric oxide synthase (iNOS), cyclooxygenase 2 (COX2), and several cytokines by disrupting NF-κB translocation to the nucleus and TLR4/MyD88 pathway.(156) Further in vitro studies elucidated the positive effects of soya phosphatidylcholines (PCs) in asthma models of mice sensitized with ovalbumin and treated with LPS. Moreover, soya PCs reduced the symptoms of asthma in a comparable manner as dexamethasone, without influencing glucose serum levels.(157) The marine environment provided the indole alkaloid hypaphorine (56), which was shown to inhibit the production of pro-inflammatory cytokines upon LPS treatment of HMEC-1 cells (human microvascular ECs line-1) through the suppression of TLR4 signaling both at protein and mRNA levels.(158) Interestingly, some bacterial cell wall components have been shown to exert anti-inflammatory activity through TLR4 signaling blockade. Indeed, LPS from the Gram negative bacterium Bartonella quintana abolished, for a prolonged time, the production of pro-inflammatory cytokines in human peripheral blood mononuclear cells (PBMCs) upon treatment with E. coli LPS.(159) Natural compounds have also been studied in the discovery of novel derivatives with improved properties. For instance, Shih et al. designed a series of halo-substituted chalcones and azachalcones (57a, 57b), which represent the most promising analogues able to improve the cytokine expression pattern in macrophages upon LPS treatment, thus making them promising anti-inflammatory nutraceuticals.(160) At the same time, 38 showed potent anti-inflammatory and antiviral activities, thus driving the research toward the design of novel derivatives with improved properties.(161) Some TLR4 agonists, such as 9, poly-γ-glutamic acid (58), and ER803022 (59), have been proposed as potential candidates for the treatment of inflammatory diseases such as asthma and allergies.(162)

Figure 10

Figure 10. Chemical structures of TLR4 modulators 4759 studied against inflammation.

Inflammatory Disorders and Effect of TLR7 and TLR8 Modulators

8-Oxoadenine derivatives bearing saturated oxygen or nitrogen heterocycles at the N-9 position demonstrated good efficacy in inducing IFN-α. This observation triggered the development of GSK2245035 (60, Figure 11) as intranasal formulation. This molecule was able to activate TLR7 with a pEC50 value of 5.7 μM. Furthermore, it suppressed TH2-mediated cytokine responses to allergens.(163) From a SAR study on imidazoquinolines, compound 61 demonstrated a selective TLR7 agonism and negligible activity on TLR8. The compound showed IFN-α induction in human PBMCs and minimal pro-inflammatory cytokine production.(164)

Figure 11

Figure 11. Chemical structures of TLR7 and TLR8 modulators 6064 studied against inflammation.

Nitrogen-derived compounds have been fully investigated in the field of TLRs and demonstrated a particular efficacy as TLR8 selective agonists. Indeed, 1-pentyl-4-phenyl-1H-imidazol-2-amine turned out to be a suitable scaffold for the development of TLR8 agonist. In particular, compound 62 showed an EC50 value of 2.48 μM and attenuated the secretion of inflammatory cytokines in ex vivo human blood models.(165) Subsequently, a multiplexed high-throughput screening led to the identification of N4-butyl-5-iodo-6-methylpyrimidine-2,4-diamine as a new scaffold for TLR8 agonists development. The best EC50 value (0.30 μM) has been obtained with compound 63, which potently induced T helper 1 (TH1)-biasing IFN-γ and IL-12 in human blood, together with lower levels of the pro-inflammatory cytokines IL-1β, IL-6, and IL-8.(166) Recently, a series of triazole-based antagonists has been synthesized to specifically interfere with TLR8 homodimerization. The best compound TH1027 (64, IC50 = 30 nM) presents a switched substitution of the 3,4,5-tri-Cl in the aromatic core, which determined an increased inhibitory activity. This SAR studies conducted on 64 suggested that this compound may interact better with the hydrophobic pocket, located between the two TLR8 monomers, thereby preventing TLR8 activation.(167)

The Role of TLRs in Cancer

ARTICLE SECTIONS
Jump To

Chemotherapy and molecular targeted therapy represent the mainstay for cancer treatment; however, in the last decades, immunological therapies have shown invaluable potential as antitumor strategies. The main role of cancer immunotherapy consists of stimulating the host immune system to fight and kill cancerous cells. Among the large number of targets studied to date (such as stimulator of interferon genes, chemokine receptor etc.), TLR modulators proved a pivotal role in this field.(168) In fact, the TLR7 agonist 15 has been approved by FDA for the treatment of superficial basal cell carcinoma, while many other TLR modulators are currently under evaluation in several clinical trials in patients with various tumor conditions.(3)
Recent studies have uncovered a double-edged sword role for the involvement of TLRs in cancer.(169) In particular, based on type of cancer cell and tissues involved, TLR activation can either lead to tumor regression or the promotion of cancer cell growth. TLR2 and TLR3 activation leads to a greater cytotoxicity of CD8+ T lymphocytes or to the stimulation of NK cells. Moreover, TLR7/8 activation can induce caspase-mediated apoptosis in cancer cells. Furthermore, 15 demonstrated the ability to inhibit angiogenesis in the tumor microenvironment. An increased number of CD8+ T lymphocytes and M1 macrophages has also been observed in a neuroblastoma model, following TLR9 activation by CpG-ODN, thus determining a decrease in tumor proliferation and the activation of the apoptotic cascade. Nevertheless, we should consider that cancer patients are usually treated with classic chemotherapeutic agents, which determine immunosuppression, making it harder to induce a positive immune response by TLR modulation that could result in an effect strong enough to reduce tumors. These factors may explain and justify the failure of many clinical trials with TLR agonists.(170)
On the other hand, chronic inflammation can promote carcinogenesis in a TLR-dependent manner. For example, an increased release of NF-κB, mediated by TLRs, promotes the upregulation of inflammatory cytokines such as in IL-1β, IL-6, and TNF-α. These cytokines are pro-carcinogenic in liver, skin, intestine, and stomach tissues. Moreover, NF-κB is believed to be one of the most important antiapoptotic modulators, which can be activated by both MyD88-dependent and MyD88-independet mechanisms. TLR7-expressing cancer cells showed high levels of Bcl-2 (an antiapoptotic factor). In pancreatic cancer cells, an overexpression of TLR7 and TLR8 was recently observed. TLR4 inhibition in xenograft mice with colon cancer determined a reduced tumor growth. Furthermore, the overexpression of TLR3, TLR5, and TLR9 have been associated with the progression of colon, cervical, and prostatic cancers.(1,171)
To date, many clinical trials have been performed to study the newly developed TLR modulators in cancer patients. The beneficial properties of these compounds were investigated alone, in combination with chemotherapeutics and/or as vaccine adjuvants. In particular, 15 has been tested against many different cancers such as breast, melanoma, actinic keratosis, and basal cell carcinoma.(3,171) Other imidazoquinolines acting as TLR7/8 agonists under clinical investigation are 852A (65, Figure 12), 16, Telratolimod (66), and Motolimod (67). 65 has been evaluated in two phase II trials (NCT00276159 and NCT00319748) in patients with breast, ovarian, endometrial, and cervical cancers and different types of leukemia. 16 is currently under phase II clinical trials for the treatment of colorectal cancer, glioma, astrocytoma, melanoma, and other tumors (NCT00960752, NCT01204684, and NCT00960752). The imidazoquinoline derivative 66, which acts as a TLR7/8 agonist, was evaluated in a phase I clinical trial (NCT02556463) for solid tumors and cutaneous T cell lymphoma in association with the monoclonal antibody durvalumab. 67 is currently under phase I and II clinical trials in patients with ovarian, head, and neck carcinoma (NCT02431559 and NCT03906526). Together with TLR7/8 agonists tested for cancer treatment, lipoproteins such as CBLB612 (a TLR2 agonist) and the IgG monoclonal antibody against TLR2, such as OPN-305, have been recently evaluated in phase II clinical trials in patients affected by breast cancer, myelodysplastic syndrome and pancreatic cancer (NCT02363491, NCT03337451 and NCT02778763). The TLR3 agonist poly(IC:LC) has been widely used in clinical trials as vaccines adjuvants against many cancer types including B-cell lymphoma, melanoma, brain tumors and head and neck squamous cell carcinoma (NCT01976585, NCT01079741, NCT01204684 and NCT02643303). Lipid VI-A and derivatives such as GLA (68) and 9 are TLR4 modulators that were widely used in anticancer clinical trials. Accordingly, the TLR4 agonist 68 was investigated as a vaccine adjuvant in phase I trials in patients affected by skin melanoma or sarcoma (NCT02320305 and NCT02180698). The recombinant flagellin proteins Entolimod and Mobilan are TLR5 agonists that have been tested as adjuvants in clinical trials with patients affected by prostate cancer and other solid tumors (NCT02654938 and NCT01527136). Numerous CpG-ODN, acting as TLR9 modulators (such as SD-101, GNKG168, CpG 10104, etc.), have been evaluated in patients with esophageal cancer, leukemias, squamous cell carcinoma of head and neck, etc. (NCT00669292, NCT01040832 and NCT01743807).(3,170)

Figure 12

Figure 12. Chemical structures of some of the most-relevant TLR modulators 6568 investigated in clinical trials against cancer.

The interest in developing new TLR ligands for cancer treatment has increased in the last years, leading to the generation of different classes of modulators that will be discussed in the following sections, divided by TLR class.

TLR2/TLR1 and TLR2/TLR6 Modulators as Anticancer Agents

Compounds 1a and 1b were able to prolong the survival of patients with inoperable pancreatic cancer.(172) Many efforts have been conducted in the past decade for developing new lipoproteins as vaccine adjuvants, comprising of novel PamCSK4 derivatives or conjugated molecules. Ingale et al. described the synthesis of a self-adjuvanting vaccine (69; see Figure 13) composed by a tumor-associated MUC-1 glycopeptide B-epitope (a T-cell-epitope) and a TLR2 ligand (2) and its investigation as a potential pharmacological tool in anticancer therapy. This compound stimulated the production of TNF-α, and, in mice (3 μg), it prompted the release of high titers of IgG antibodies able to recognize the MUC-1 glycopeptide that is usually overexpressed on MCF-7 cells (breast cancer).(173) Successively, the same research group investigated the role of different classes of TLR agonists implemented in the structure of this self-adjuvanting vaccine. In particular, by replacing the TLR2 (Pam3CysSK4) inducer with a TLR9 (CpG-ODN 1826) agonist, the authors reported a reduced antigenic cellular response when compared to the TLR2-MUC-1 compound.(174) Shi et al. investigated the structural features of a MUC-1-glycopeptide carrying a Pam3CysSK4 portion. They evaluated the roles of (i) the configuration of the chiral center of the glycerol moiety, (ii) the glycosylation site on the MUC-1, and (iii) the antigen bound to the MUC-1 tandem repeat. No significant difference was observed in immune response induced by the two epimers, while modification of the glycosylation site and the different antigen bound to MUC-1 generated significant differences in antibody titers. The best bioconjugated molecule possesses a sialyl-N-acetyl-d-galactosamine alpha-O-threonine (STn) antigen on Thr9 of the MUC-1 tandem repeat sequence (70).(175)

Figure 13

Figure 13. Chemical structures of Pam3CysSK4-MUC-1 conjugated 6971 and UPam derivatives 72a72e.

In 2014, new Pam3CysSK4 derivatives were developed by using the co-crystal structure of TLR2/TLR1 heterodimer in complex with the original ligand. The new compounds, named UPams (72a72e), bear an ureidic N-tetradecylcarbamyl moiety, which replaces one of the original N-palmitoyl chains of Pam3CysSK4, and several natural and non-natural amino acids to replace the original serine. The best compounds, at low concentration values (ranging from 3 nM to 30 nM), exhibited a marked increase in immunostimulatory activity, which was measured as the production of IL-12p40, that is strictly correlated with DC maturation. The enhanced activity is linked to the improved affinity of the ligand for the receptor, determined by an additional hydrogen bond with the TLR1 monomer.(176) Successively, one of the best compounds of the series, namely, Amplivant (72a), was further subjected to other biological studies to assess its anticancer properties. Therefore, in 2018, the authors evaluated in in vivo studies the antitumoral properties of 72a, in conjugation and not with synthetic long peptides (SLPs). It emerged that SLPs conjugated to Amplivant (5 nmol in 50 μL) stimulated DCs maturation, T cells priming, calculated as the amount of IFN-γ, TNF-α, IL-12, and other factors related to antitumor immunity. Note that 72a in solution with the SLPs determined a reduced induction of these indicators; also, the replacement of Amplivant with Pam3CSK4 further determined a lower response to the treatment. Modulation of the macrophage population in a tumor microenvironment was observed; 72a in combination with cisplatin or photodynamic therapy determined a synergic action in TC-1 mice (lung cancer).(177)
Novel potential TLR2 agonists as adjuvants for cancer vaccines have been described by Lu et al. The authors reported that homologated versions of the Pam2Cys molecules have a similar potency, with respect to the original TLR2 agonist. The Pam2CSK4 unit was linked to the SLLMWITQV linear peptide sequence (NY-ESO-1 epitope), which is known to stimulate CD8+ T cells in cancer models. The best compounds of this new series (73a73d, EC50 range from 0.28 nM to 0.38 nM; see Figure 14) have the glycerol moiety in R configuration and a length of the homologated chain varying from one to four carbons. In addition, the authors observed that the N-acetylation of the Cys did not reduce the activity of the molecules. Huynh et al. developed 13 new TLR2 agonists and identified 74a as the most potent with an EC50 value of 20 nM and a binding affinity of 25 nM. This compound was also able to stimulate the immune system in vivo (generation of antigen-specific CD8+ T cells) suggesting this product as a valid immune adjuvant to be applied in cancer immunotherapy. Successively, 74a was conjugated with near-infrared (NIR) fluorescent dye obtaining compound 74b, which showed EC50 and Ki values of 34 and 11 nM, respectively. This product was employed as a probe to detect the selectivity of the ligand for TLR2 in xenograft mice bearing pancreatic cancer. By using this assay, compound 74b revealed a high selectivity for pancreatic cancer cells.(178)

Figure 14

Figure 14. Chemical structures of the homologated Pam2CysSK4–NY-ESO-1 73a73d and of the Pam2Cys derivative 74a and 74b.

Yamamoto et al. developed a new trehalose 6,6′-dimycolates (TDMs)-based compound named Vizantin (75; see Figure 15). TDMs are known as inducers of the innate immune response through TLR2 and possess potent antitumor activity in in vivo models.(179) The anticancer properties of 75 were evaluated in an in vivo mouse model; 75 stimulated cytokine production and the macrophages phagocytic activity against cancer tissues at a concentration of 50 μM.(180) In 2018, two molecules—namely, diprovocim-1 and diprovocim-2—were reported as potent TLR2/TLR1 agonists. Noteworthy, these compounds do not share structure similarity with any other reported synthetic or natural TLR agonists. The most potent compound (76) possessed a high affinity for TLR1/2 (EC50 of 110 pM) in human THP-1 cells supplemented by a strong TNF-α release. Preliminary studies conducted in mice, using 76 (10 mg/kg) as a vaccine adjuvant, showed a systemic protection against melanoma; moreover, in conjugation with the immune checkpoint inhibitor anti-PD-L1, it completely inhibited tumor growth. Long-term anticancer memory was induced, thus prolonging the survival of tumor-bearing mice.(181−183) SMU-Z1 (77) is a TLR2/TLR1 agonist possessing an EC50 value of 4.88 nM, which was discovered from a screening performed on a library of more than 14 000 compounds. Imidazole 77 was found to promote the release of NF-κB, TNF-α, IL-1β, and other cytokines in several cell lines in a dose-dependent manner. 77 also determined a higher expression of CD8+ T, NK and DCs cells were observed in murine leukemia model, thus providing a significant antitumor effect. Indeed, a strong reduction of tumoral mass was observed after the treatment of leukemia xenograft mice with 77 (0.3 mg).(184) By the application of virtual screening techniques using ∼10.5 million of compounds, the TLR2/TLR1 agonist SMU127 (78) was discovered. When tested, it showed an EC50 value of 550 nM and it stimulated TNF-α and NF-κB release in human macrophages and mononuclear cells. A strong tumor immunizing effect against breast cancer in vivo was observed after ip administration of 78 (0.1 mg) in mice.(185) In 2003, the proapoptotic properties of two polyphenols (purpurogallin and gossypol) targeting Bcl-2 proteins in leukemia cells were discovered.(186) Successively, it was demonstrated that purpurogallin (79) was able to inhibit TLR1/TLR2 activation by 70% at 3.0 μM in RAW 264.7 (macrophages) cells. Starting from this molecule, a SAR study was performed by Cheng et al. to improve the potency of the hit compound. Among the 26 newly developed compounds, 42 resulted as the best TLR1/TLR2 inhibitor of the series, showing an IC50 value of 0.58 μM. Further studies demonstrated that 42 was able to compete with 1b to bind the heterodimer with a Ki of 0.41 μM. A dose-dependent reduction of IL-1β and TNF-α release was observed after the treatment of RAW264.7 cells with 1b and increasing doses of 42, thus confirming its anti-TLR2/TLR1 activity.(187)

Figure 15

Figure 15. Chemical structures of TLR1/2 modulators 7579 as anticancer agents.

TLR3 Modulators as Anticancer Agents

Until now, the best TLR3 modulators investigated under several pathological conditions, other than cancer, are dsRNA analogues (1.5–8 kbp). For example, poly(I:C) was able to activate NK cells, to release DC and CD8+ T lymphocytes and to activate anticarcinogenic processes (apoptosis and necroptosis) in mice models.(1) However, in clinical trials, it revealed an insufficient stability of this molecule under physiological conditions, resulting in a rapid metabolic inactivation and, consequently, poor anticancer activity.(171) BM-06, which is another dsRNA acting as a TLR3 agonist, was able to decrease tumor growth and cell proliferation by inducing apoptosis. It also showed a higher anticancer effect against rat hepatocellular cell carcinoma than poly(I:C).(188) When used as a vaccine adjuvant, poly(IC:LC) demonstrated a high potency in in vivo assays; therefore, it has been evaluated in several clinical trials. Poly(I:C12U) has been evaluated as a vaccine adjuvant in cancer therapy and, to date, 13 Phase I/II clinical trials are ongoing in patients with different tumors.(171) IPH-3102 is another TLR3 agonist that is able to activate a NF-κB signaling pathway in in vitro studies and to induce type I-IFN responses, thus exerting a cytotoxic activity against breast cancer cells. It has been reported to behave as a strong immunostimulatory agent in mice.(189) A DNA-capped dsRNA modulator has been recently evaluated as a vaccine candidate in cancer therapy. The structure of this molecule, named ARNAX, includes 120–140 bp dsRNA, derived from the measles virus vaccine strain, linked to a GpC-type phosphorothioated oligodeoxynucleotide at the 5′-site. Studies in murine models revealed the ability of ARNAX, combined with tumor-associated antigen (TAA), to induce the generation of tumor-specific cytotoxic T lymphocytes (CTLs) that determined the reduction of the tumoral mass. Moreover, in the murine model, the association of ARNAX+TAA with anti-PD-1/PD-L1 antibodies induced tumor-specific memory CD8+ T cells and a strong anticancer effect, higher than that observed with ARNAX+TAA alone.(190,191)

TLR4 Modulators as Anticancer Agents

The best TLR4 modulators are LPSs, which are usually derivatives of lipid A. In a very exhaustive review by Peri and Calabrese, the structures and the activities of these compounds were nicely described, along with other small molecules reported up to 2013.(39) In addition, the performed and ongoing clinical trials on these compounds have been reviewed by Anwar et al.(3) Therefore, in this section, we will describe only the latest discovery on TLR4 modulators endowed with endowed with anticancer activity.
CXC195 (80, Figure 16) showed a significant antiproliferative effect in LPS-induced human hepatocellular carcinoma cells. In HepG2 cells, 80 suppressed the release of pro-inflammatory cytokines such as TNF-α, IL-1β, IL-6, etc., through the inhibition of TLR4 pathway and TLR4 downregulation.(192) Atractylenolide 1 (81) is a natural sesquiterpene lactone capable of downregulating the expression of TLR4 and MyD88/NF-κB in ovarian cancer. This event is accompanied by the secretion of cytokines by EOC SKOV3 cells, thus reverting EOC cell-mediated immunosuppression, following the activation of T lymphocytes.(193) The TLR4 inhibitor 34 has been recently reinvestigated as an antitumoral agent. It induced a cytotoxic effect against ovarian and breast cancer cell lines (the best results were obtained with SKOV3 and 2008C13 cell lines) with IC50 values in the μM range. A strong correlation between TLR4/MyD88 expression and anticancer cell response was observed: the higher the expression, the lower the IC50 value. Furthermore, 34 decreased the invasive properties of these tumors in other tissues. The properties of this compound were also investigated in association with other FDA-approved drugs (cisplatin and paclitaxel). This study revealed an increased sensitivity of both ovarian and breast cancer cells to the two drugs when combined with 34, thus confirming that TLR4 overexpression on cancer cells may contribute to chemoresistance. This validates TLR4 inhibitors as valuable tools in combination with other drugs for cancer therapy. Kashani et al. investigated 34 against ovarian cancer in combination with LPS. The activation of TLR4 by LPS resulted in an enhanced proliferation and invasive properties of the tumor cells, which were reverted upon the co-administration of TAK-242. Moreover, disruption of the cell cycle and the induction of apoptosis were observed after treatment with 34. The combination of this molecule with doxorubicin increased the antitumoral activity of this latter compound.(194−196) Triptolide (82) is a diterpenoid epoxide that was able to reduce the TLR4/NF-κB signaling in vitro.(197) The antitumoral activity of 82, in combination with gemcitabine (GEM), against LPS-activated PANC-1 cells (pancreatic cancer) in xenografts mice was investigated by Ma et al. The reduction of TLR4/NF-κB signaling by 82 (0.4 mg/kg in mice) reversed the low sensitivity of LPS-activated PANC-1 cells to GEM (25 mg/kg), resulting in induction of apoptosis and a significant reduction in tumor volume.(198) The activity of paeonol (83) against osteosarcoma was evaluated in a work by Zhou et al. This compound proved to have the ability to inhibit the activation of TLR4/MAPK/NF-κB pathway and block the proliferation of several cancer cells. The administration of 83 in osteosarcoma cells resulted in cell proliferation suppression by inducing apoptosis in a dose-dependent manner. Moreover, 83 was able to block the invasive and migratory properties of cancer cells. From in vivo studies, it emerged that paeonol (200 mg/kg) was able to decelerate the growth of the tumor growth and reduce TLR4 expression in mice.(199)

Figure 16

Figure 16. Chemical structures of TLR4 modulators 8085 investigated as anticancer agents.

Three molecules—namely, diaporine (84), sophoridine (85), and a polysaccharide extracted from Strongylocentrotus nudus eggs—were able to exert an anticancer action by activating the TLR4 pathway. This profile is consistent with the previously explained double-edged sword role that TLRs may play in tumoral cells, which are mostly dependent on the type of cancer and on the expression of TLRs on the tumoral cells. The investigation of the antiproliferative properties of 84 were discussed in a work by Ge et al. In breast cancer xenograft-mice, 84 (0.2 mg/kg) determined the switch of the phenotype of tumor-associated macrophages (TAMs) from M2 to M1 by triggering the TLR4-MAPK pathway. M1 are the macrophages involved in the activation of TH1 cells, which are responsible for killing pathogens and tumors.(200)85 is a quinolizidine with a recognized antitumoral activity against different cancers. In gastric cancer, it induced the TLR4/IRF3 pathway determining an increased polarization of TAMs to M1, thus suppressing M2 generation. The release of iNOS, IFN-β, and IL-12α was upregulated, while Arg1, CD206, and IL-10 were downregulated. The M1 polarization determined CD8+ T cells proliferation and an increased cytotoxic activity that were promoted by these cells.(201) The activity against pancreatic and other cancer cells of a polysaccharide extracted from Strongylocentrotus nudus eggs was evaluated in a work by Xie et al., and a reduced proliferation was observed after the treatment with this product. This event was correlated to an increased number of CD4+ and CD8+ T cells, and by the release of IL-2 and TNF-α. This polysaccharide could hamper pancreatic cancer growth by activating NK cells both in vitro and in vivo by triggering the TLR4/MAPK/NF-κB signaling pathway. At a 40 mg/kg dose in xenograft mice, this polysaccharide reduced the tumor growth by 50%; when used in combination with GEM, the inhibitory rate increased to 68%.(202)

TLR5, TLR7, TLR8, and TLR9 Modulators as Anticancer Agents

Flagellin and its derivatives are the only TLR5 modulators that have been investigated as potential antitumoral agents in several clinical trials.(3)
Several TLR7/8 modulators developed during the last years have been thoroughly and recently reviewed by Patinote et al.(2) Accordingly, in this section, we will update the TLR7/8 modulators outcome, followed by a discussion about TLR9 modulators and nonselective TLR ligands.
Novel bistriazolyl acyclonucleoside compounds were developed by Xia et al. as TLR7 agonists. These compounds revealed strong antiproliferative effect specific cell lines, together with an immunomodulatory activity. The best compound of the series (86, Figure 17) stimulated the immune response in DCs via TLR7 signaling and resulted cytotoxic against several cancer cell lines (IC50 values of ∼10 μM) by activating the apoptotic process.(203) From a cell-based high-throughput screening designed to discover novel NF-κB signaling inhibitors, two hit scaffolds were selected. 69 derivatives were synthesized, and among them, compound 87 resulted in being the most active. This latter was able to inhibit the TLR7-mediated NF-κB activation with an IC50 value of 260 nM and to suppress the PI3K/Akt and IKK/IκB pathways. In addition, administration of 87 to LPS-stimulated RAW 264.7 cells determined a significant suppression of TNF-α and NO levels. 87 showed significant growth inhibition against HeLa cells with a GI50 value of 1.35 μM after 48 h of exposure, resulting from the induction of apoptosis. The same study highlighted both the anticancer and anti-inflammatory activities of 87.(204)

Figure 17

Figure 17. Chemical structures of TLR modulators 8688b endowed with anticancer activity.

As previously mentioned, CpG-ODN is the more deeply investigated class of TLR9 agonist. From preclinical studies, these compounds showed a good anticancer profile, alone or in combination with other chemotherapeutics or radiations, against many tumor models, such as cervical and colon cancers, rhabdomyosarcoma, and neuroblastoma.(205) Therefore, many IMOs have been developed and used in preclinical and clinical investigations for cancer treatment, alone or as vaccine adjuvants.(170,206) From the Web site clinicaltrials.gov, we could retrieve 24 studies regarding TLR9 modulators against cancer in the last decades. Among these, compounds CpG7909, SD-101, and IMO-2125 were the most investigated; however, none of these products overcame phase III trials.(171) In this context, we will describe the latest CpG that have been discovered and applied in preclinical cancer research. KSK-CpG is a phosphorothioated CpG-ODN with the following sequence: 5′-TCGTCGTTTTCGTCGTCGTTTT-3′. As a cancer immunotherapeutic agent, this product showed an activity slightly higher than other previously developed CpG-ODN. From in vivo studies on melanoma cancer cells, KSK-CpG (10 μg, ip administration) showed a marked increase in the activity of CTLs and NK cells, along with TH1 cells activation and IL-6 and IL-12 induction. These factors determined longer mice survival and a reduction in the number of tumor nodules.(207) In another study, the same product was investigated against lymphoma (A20 and EL4 cell lines). KSK-CpG had a direct cytotoxicity against these cells by inducing the TLR9 pathway, which determined the activation of apoptosis, the cell cycle arrest in G1-phase, and the release of IFN-γ in a time- or dose-dependent manner.(208) Another phosphorothioated CpG-ODN, namely, ODN M362 (5′-TCGTCGTCGTTC:GAACGACGTTGAT-3′), was studied as a potential cancer therapeutic. When administered in human HCC cell lines (0.5 μg/mL), this CpG determined the release of inflammatory cytokines, such as IFN-α, IFN-β, TNF-α, IL-6, and IL-8 and the activation of a TLR9-independent apoptotic process. The injection of ODN M362 in a human HCC xenograft mouse model (5 μg), directly at the tumor level, slowed the tumor growth and prevented the enlargement of the lymphoid tissue.(209) A class C CpG-ODN, YW002 (sequence 5′-TCGCGAACGTTCGCC:GCGTTCGAACGCGG-3′), was investigated and determined to exhibit a strong reduction or complete healing in breast tumor-bearing mice after the injection of 25 μg at the tumor-draining lymph-node area.(210) In another study, YW002 was formulated with MF59 (an oil-in-water nanoemulsion used as an adjuvant in an influenza vaccine) as a vaccine adjuvant for HSP65-MUC1 (a recombinant fusion protein incorporating HSP65 and mucin-1-derived peptide) to induce anti-MUC-1 tumor immunity. When administered as a preventive treatment, the MF59-YW002 adjuvant containing HSP65-MUC1 inhibited the growth of MUC1+ B16 melanoma and prolonged the survival of tumor-bearing mice. It is important to highlight that the absence of YW002 in the formulation did not provide any inhibition in tumor growth rate.(211) The synergistic effect of cyclophosphamide with the TLR9 agonist CpG-1826 (5′-TCCATGACGTTCCTGACGTT-3′) was evaluated in a mouse glioma model. An increased number of tumor-associated macrophages, B cells, DCs, and cytotoxic T cells was observed. After the injection of CpG-1826 (100 μg/50 μL) and cyclophosphamide (90 mg/kg), glioma regression and immune memory against this tumor were observed. A moderate response to the same treatment was observed in the B16F10 melanoma mouse model.(212) The same CpG-ODC, in association with radio-frequency ablation (RFA), was evaluated against thymic lymphoma in a work by Xu et al. Intratumorally administered CpG-1862 (10 μg in 30 μL) after RFA treatment determined a higher number of M1 macrophages, CD4+ and CD8+ T-cells, leading to a potent inhibition of primary, distant, and lung metastasis in mice bearing large EG7 tumors.(213) In a work by Babaer et al., three CpG-ODN—namely, ODN2216, ODN2006, and ODN M362 (class A, class B, and class C, respectively)—were tested as anticancer agents. The potential role of these compounds as vaccine adjuvants, that are able to enhance the activity of mammaglobin-A (MamA) peptide-specific cytotoxic CD8+ T lymphocyte responses against breast cancer, was evaluated. MamA peptide is overexpressed in the largest part of breast cancers and it has been applied as cancer vaccine in clinical trials with modest increase in MamA-specific CD8+ T lymphocyte activation. Therefore, this peptide was used to activate immature CD8+ T cells, co-administered with one of the previously described CpG (10 μM). In comparison with MamA peptide alone, a stronger activity against AU565 breast cancer cells was observed when ODN2006 (5′-TCGTCGTTTTGTCGTTTTGTCGTT-3′) or ODN M362 were co-administered.(214) Enantiomeric DNA-based immunomodulators (EnanDIM) represent a new family of TLR9 agonists bearing nuclease-resistant l-deoxyribose nucleotides that replace the d-deoxyribose at the 3′-ends. Different molecules belonging to this class were analyzed in a work by Kapp et al., in both in vitro and in vivo models. These compounds revealed a broad range of immune cells activation, promoting T cell infiltration into CT26 colon carcinoma, followed by a marked reduction in tumor growth. Furthermore, EnanDIM-C (250 μg in 50 μL) determined regression in other tumors, such as B16 melanoma, MC38 colon carcinoma, EMT-6 breast cancer, and A20 lymphoma in murine models. Significantly, EnanDIM-C against A20 and EMT-6 tumors cured the largest part of the animals, establishing a persistent antitumor immune memory.(215) A self-designed CpG-ODN (GACGCGCGTC GACGATCGCGAATTCGAACGTACGCT) was evaluated in combination with pimozide (a neuroleptic drug, acting as a STAT5 inhibitor and possessing antimelanoma activity) against melanoma in a mouse model. This combination determined a strong inhibition in melanoma growth, prolonging the survival of melanoma-bearing mice. A stronger infiltration of CD4+ and CD8+ T cells in the tumor was observed, along with an increased count with regard to the number of these and NK cells.(216)
From a cell-based high-throughput screening, compound 88a was chosen as a hit compound for TLR3 activation (EC50 = 22.3 μM). Starting from this molecule, SAR studies were performed and the best compound (CU-CPT17e, 88b), with an EC50 value of 4.8 μM, significantly improved NF-κB activation by 13.9-fold in HEK293 cells (human embryonic kidney). Surprisingly, this compound was also able to trigger TLR8 and TLR9 with EC50 values of 13.5 and 5.7 μM, respectively. In THP-1 cells, 88b stimulated cytokines release, such as TNF-α, IL-6, and IL-12, after 12 h in a dose-dependent manner. Moreover, this molecule resulted in a cytotoxic effect to HeLa cells in a dose-dependent manner, thanks to the activation of the apoptotic process.(217)

TLRs in Autoimmune Diseases

ARTICLE SECTIONS
Jump To

Autoimmune diseases are a family of chronic inflammatory disorders characterized by alterations in the homeostasis of the immune system and the subsequent break of tolerance to self-antigens.(218) An autoimmune response is the result of genetic and environmental factors, and it is mediated by several biological processes, in which TLRs play a fundamental role. TLRs are implicated in different autoimmune diseases, such as multiple sclerosis (MS), systemic lupus erythematosus (SLE), and rheumatoid arthritis (RA). The expression of these receptors in immune cells is enhanced and they can trigger pro/anti-inflammatory mechanisms by releasing several cytokines, which are the main mediators in the inflammatory processes. In this scenario, the modulation of TLRs may represent an interesting pharmacological approach for the treatment of autoimmune diseases.(219,220) However, the relationships among the various TLR pathways in these diseases is highly complex.

TLRs in Multiple Sclerosis

MS is an autoimmune disease characterized by loss of neuronal communication as a result of myelin sheath deterioration. In the pathogenesis of MS, both neurodegeneration and neuroinflammation are involved. Myelin lesions hamper the diffusion of electrical signals among neurons in CNS, leading to several motor and psychiatric symptoms such as pain, sensory loss, cognitive decline, and fatigue.(221) TLRs are usually localized on the cell or endosomal membranes of immune cells, including T-cells, B-cells, astrocytes, macrophages, and microglia cells.(222) The overactivation of these cells by TLRs, during neuroinflammatory processes, contributes to the pathogenesis of MS.(223) In 2019, Clements et al. demonstrated, in experimental autoimmune encephalitis (EAE, the most common model of MS in mice), that TLR2 and TLR4 are involved in the genesis of MS secondary symptoms (such as neuropathic pain, depression, anhedonia, anxiety), which are determined by the release of IL-1β. In this work, the treatment with TLR2 and TLR4 antagonist led to an improvement of the above-mentioned symptoms.(224) Moreover, poly(I:C)-treated EAE mice showed partial disease remission, thus highlighting the importance of TLR3 activation in MS.(225) TLR9 stimulation with CpG-ODN pointed out the role of this receptor in B-cells, resulting in changes of their cytokine profile. In particular, the levels of IL-10 decreased after TLR9 activation by this agonist.(226) Several novel TLR modulators have been identified for the treatment of MS in the past decade, whose pharmacological properties will be summarized in the following section.

TLR Modulators in Multiple Sclerosis

Inhibition of TLR2, TLR4, TLR7, TL8, and TLR9 can prevent MS initiation and progression; on the other hand, TLR3 stimulation seems to promote the MS course. MyD88 deficiency in EAE models permits a partial slowdown in the onset of the disease, highlighting that MyD88 might be considered a pharmacological target in CNS inflammation. It was discovered that the linear heptameric peptide RDVLPGT, corresponding to the region between the βB strand and the αB helix of MyD88 (called BB loop), competitively inhibits MyD88 dimerization. Taking into account the low metabolic stability and selectivity of linear peptides, Shira et al. identified two cyclic mimetic peptides—namely, c(MyD 4–4) and c(MyD6–6) (89a and 89b; see Figure 18)—that were able to disrupt human and mouse TLR2/4 signaling by inhibiting MyD88. In EAE models, this event inhibited the TH1/TH17 cells differentiation, thereby reducing the severity of the disease.(227) Rabeximod (90) is a small molecule that downstreamed the TLR2/4 stimulation, leading to a decreased activation of inflammatory cells. Its immunomodulatory activity was tested by Hultqvist et al. in vivo for RA and MS. Subcutaneous (20 mg/kg) or oral (40 mg/kg) administration of 90 in mice reduced EAE severity.(228) Since TLR3 plays an important immune-protective role, TLR3 agonists could represent valid therapeutic tools in MS. The most investigated compound in MS treatment is poly(I:C12U), which prevented inflammation and the demyelination process by TLR3-mediated IFN-β production. (+)-Naltrexone (91, NTX), a nonopioid TLR2, TLR4 antagonist, was studied in MS models, resulting in the inhibition of the NF-κB signaling pathway.(224) Compound 91 underwent randomized trials to determine low-dose effects in the treatment of MS patients (NCT00501696). In 2015, Crowley et al. discovered that baclofen (92), which is a γ-aminobutyric receptor B modulator, is able to inhibit the TLR3 and TLR4 signaling pathways. In murine glia cells PBMCs (isolated from patients with a relapse-remitting form of MS), it showed an anti-inflammatory effect. Compound 92 reduced the levels of NF-κB and TNF-α in a dose-dependent manner, thus regulating the innate immune response in MS.(229) This inhibitor has been applied in 10 clinical trials, subsequently reaching phase III in six studies (NCT00139789, NCT01743651, NCT00488839, NCT03319732, NCT03290131, NCT01359566). Interestingly, the water-soluble artemisinin analogue SM934 (93) showed immunosuppressive properties in EAE murine models by inhibiting TLR9. The administration of 93 in EAE mice resulted in a strong suppression of TH17 and TH1 and, at the same time, promoted Treg expansion.(230)

Figure 18

Figure 18. Chemical structures of TLR modulators 8993 investigated against MS.

TLRs in Rheumatoid Arthritis

RA is a common autoimmune disease characterized by localized and systemic symptoms, including synovial inflammation and hyperplasia, “swelling”, cartilage, bone and joint destruction, pain, and cardiovascular, pulmonary, and psychological disorders. The clinical outcome of RA is the result of abnormal immune response in which both synovial cells—fibroblast-like synoviocytes (FLS) and immune cells—are involved. Plasma cells produce autoantibodies (Abs), such as rheumatoid factors and/or anticyclic citrullinated peptides Abs, which activate the immune response, determining the above-mentioned symptoms.(231,232) TLRs amplify the immune cells response in RA by producing pro-inflammatory cytokines in the synovial, promoting FLS and macrophage-like synoviocytes activity and Abs production. Several studies demonstrated the involvement of TLR2 in the pathogenesis of RA. The stimulation of synovial fibroblasts (SFs) in RA patients with pro-inflammatory cytokines (such as IL-1β and TNF-α), LPS, and synthetic bacterial lipopolysaccharides considerably increased TLR2 mRNA expression. This determined an improved TLR2-mediated production of pro-inflammatory cytokines in the synovial cells, contributing to bone and cartilage destruction.(233) It is consistently demonstrated that the synovial macrophages (SMs) are the main source of TNF-α, IL-1β, and IL-8 in RA. Huang et al. showed the crucial role of TLR2 and TLR4 from SMs in the persistence and progression of RA disease. Moreover, an increased expression of TLR2 and TLR4 was observed in SMs isolated from joints of RA and other forms of inflammatory arthritis patients. Stimulation of these macrophages with TLR2 or TLR4 agonists, respectively, peptidoglycan and LPS showed a higher production of pro-inflammatory cytokine in SMs of RA patients. These results highlight the primary role mediated by TLR2 and TLR4 in promoting the inflammation and joint destruction in RA.(234) High levels of TLR3 and TLR4 were identified in SFs of patients in the early stages of RA. These values resulted in being comparable with TLR3 and TLR4 expression in patients with long-standing RA, highlighting the importance of TLR signaling pathway in developing joint destruction.(235) Moreover, Roelofs et al. evaluated, in RA patients, the expression of TLR3 and TLR7 in the synovium and the TLR-mediated cytokines production from DCs. TLR2, TLR3, TLR4, TLR7, and TLR8 were stimulated in DCs with Pam3Cys, poly(I:C), LPS, and R848, respectively, resulting in the release of TNF-α, IL-6, IL-10, and IL-12. TLR3 and TLR7 were overexpressed in synovial tissue of RA patients and cytokines production in RA DCs was more pronounced, if compared to that of the healthy control. These factors enhanced pro-inflammatory response and favored a breakdown of tolerance in RA.(236) It was also noted that low-dose administration of TLR7 agonists induced tolerance or hyporesponsiveness to TLR2, TLR7, and TLR9 activators, reducing inflammation in a passive antibody-mediated arthritis model. These findings suggest that the induction of TLR7 tolerance might be a new therapeutic approach to overcome inflammation in autoimmune diseases.(237) As reported by Sacre et al., TLR8 is involved in RA pathogenesis; in fact, by treating human synovial RA cells with TLR8 antagonists, a significant reduction in TNF production was observed.(238) In addition, Lacerte et al. reported that TLR2 and TLR9 stimulation by EBV may contribute to the pathogenesis of RA.(239)
Considering the involvement of several TLRs in RA pathogenesis, many TLR antagonists, including monoclonal antibodies or small molecules, might represent potential therapeutic agents.

TLR Modulators in Rheumatoid Arthritis

OPN-301 and NI-0101 are monoclonal antibodies that act as TLR antagonists applied in RA therapy, as TLR2 and TLR4 ligands, respectively.(240−242) OPN-301 is a novel mouse IgG1 monoclonal anti-TLR2 antibody that was able to block 1b-dependent cytokine production in RA synovial tissues. OPN-301 efficiently penetrated into the synovia and its anti-inflammatory activity was comparable to that of Adalimumab (an anti-TNF-α antibody). After OPN-301 administration in RA patients, 62% of the subjects showed a moderate to good response.(240) NI-0101 is a humanized IgG monoclonal antibody that is able to block TLR4 dimerization, thus promoting inhibition of the TLR4 pathway. In a phase II clinical trial, Monnet et al. treated RA patients (which poorly responded to Methotrexate (MTX)) with NI-0101 (5 mg/kg). However, no patients showed an improvement after the administration of NI-0101, proving that the TLR4 inhibition alone was insufficient to obtain a therapeutic effect in RA patients.(241) Auranofin (94, Figure 19) is a small molecule widely used in RA treatment; its mechanism of action seems to involve TLR pathways at different levels. It blocked TLR4 dimerization after the stimulation of this receptor with LPS. At the same time, 94 suppressed TRIF-dependent signaling pathway by reducing TLR3-mediated NF-κB production.(243) The TLR2/4 antagonist 92 considerably reduced RA severity after oral (40 mg/kg) and subcutaneous (40 mg/kg) administration in mice.(228) Furthermore, Hultqvist et al. demonstrated that 92 efficiently reduced collagen antibody-induced arthritis in mice, by suppressing immune cells, mostly macrophages, in a time-dependent manner.(244) In 2020, Samarpita et al. evaluated the application of the TLR4 inhibitor 34 as a potential anti-RA molecule. 34 reduced the expression of adjuvant-induced arthritis in a rat model by inhibiting inflammatory cytokines release in LPS-stimulated FLS, thus exhibiting interesting anti-RA properties.(245) PF-0665083 (95) is an IRAK4 inhibitor developed by Pfizer, which, in 2019, overcame two randomized phase I studies (NCT02224651, NCT02485769) aimed at evaluating its safety, pharmacokinetics, and pharmacodynamics. The compound was generally well-tolerated, showing mild adverse effects such as headache, gastrointestinal disorders, and acne.(246) These data supported the successive evaluation in a phase II clinical trial in RA (NCT02996500) patients with poor response to MTX. In 2018, Zhang et al. identified a very potent TLR8 inhibitor, named CU-CPT9a (96, IC50 = 0.50 nM), by a SAR study on pyrazolo[1,5-a]pyrimidine series. 96 stabilized the inactive state of TLR8 and antagonized the binding of TLR8 activators, also suppressing, in a dose-dependent manner, TNF-α production in PBMC harvested from RA patients, exerting an important anti-inflammatory effect.(247) Antimalarial drugs, such as 26 and hydroxychloroquine (HCQ, 97), have been applied in the treatment of autoimmune diseases, including RA and SLE. 26 and 97 can modulate both the TLR7 and TLR9 activity by altering endosomal pH and/or preventing TLR7 andTLR9 activation by binding their ligands (DNA and RNA respectively). These mechanisms of action led to a reduced production of pro-inflammatory cytokines, such as IL-1, IL-6, TNF, and IFN, with significant improvements in the treatment of autoimmune RA.(248)

Figure 19

Figure 19. Chemical structures of TLR modulators 9498 investigated against RA and SLE treatment.

TLRs in Systemic Lupus Erythematosus

SLE is a multiorgan autoimmune disease characterized by loss of self-tolerance against ubiquitous autoantigens, involving numerous mechanisms of adaptive immunity. SLE has a progressive/remitting form and it shows different symptomatology, depending on which organs are affected. It can target kidneys, joints, the nervous system, and hematopoietic organs. The main hallmark of SLE is a massive autoantibody production that targets dsDNA and nucleosomes of the cells in the involved tissues. This is due to a dysregulation of cytokine levels, lymphocyte T and B hyperactivity, and APC abnormalities.(249) SLE patients exhibit glomerulonephritis (GN) caused by immune complex deposits and an insufficient clearance of apoptotic cells debris, which can activate TLRs and therefore elicit autoantibody production.(250,251) TLRs can contribute in different ways to the SLE pathogenesis. Studies conducted on TLR2- and TLR4-deficient lupus prone mice were performed to analyze the phenotype, autoantibody productions, and renal injury related to the disease. It resulted that TLR4-deficient (and, to a lesser extent, TLR2-deficient) mice showed a drastic reduction in GN and autoantibody production.(252) As additional evidence of the involvement of TLR4 in SLE pathogenesis, Liu et al. showed that HSPs act as chaperones in inducing hyperresponsiveness after TLR4-LPS interaction. This increased response elicited a breakdown of immunological tolerance and, at the same time, TLR4 upregulation induced a similar lupus-like autoimmune GN.(253) TLR3 expression in APCs and glomerular mesangial cells resulted in an increase in MRLlpr/lpr mice characterized by lymphadenopathy associated with aberrant production of T cells and used to evaluate SLE therapy, exacerbating GN conditions. Poly(I:C) aggravated lupus nephritis by stimulating TLR3 in glomerular mesangial cells and APCs in the same mouse model. However, poly(I:C) injections did not increase antibodies production, suggesting that TLR3 is involved in SLE pathogenesis in a B-cell-independent mechanism.(254) The key role of endosomal TLRs in SLE pathogenesis was assessed by inducing lupus-like disease in TLR-deficient mice, which showed an important reduction in antibodies.(255) A 2014 ethnic-epidemiological study on lupus- and non-lupus-affected women demonstrated that SLE patients presented an upregulation of both TLR7 and TLR9 and an increased level of IFN-α and IL-6, which induced the release of B-cell activating factor in DC with the consequent activation of autoreactive B-cells.(256) Not much is known about TLR8 implications in SLE. In 2014, Tran et al. studied the effects on TLR8 gene deletion in lupus-prone mice, which underwent an accelerated disease progression, because of an increased number of antibodies, active monocytes, and an exacerbated cell response to TLR7 ligands. Therefore, TLR8 regulates TLR7-mediated immune responses.(257) Currently, SLE therapy mainly consists of anti-inflammatory drugs, antimalarials, steroids, and immunosuppressors. By virtue of the strong TLRs-mediated immune response, a selective TLRs inhibition could prevent the initiation or progression of SLE.

TLR Modulators in Systemic Lupus Erythematosus

Because of the main role of endosomal TLRs in the pathogenesis of SLE, TLR7/8/9 inhibitors are the best therapeutic options, as demonstrated by Patinote et al. in a very detailed review on such inhibitors. The CpG-ODNs (dual TLR7/9 inhibitors) IMO-3100, INH-ODN-24888 (T*C*C*T*G*G*C*mE*G*G*G*A*A*G*T, where * denotes phosophorothioate bonds) and mE is 7-deaza-2′-O-methyl-guanosine) and IRS 954 (5′-TGCTCCTGGAGGGGTTGT-3′) are indicated in the treatment of SLE.(2) The above-mentioned TLR7/9 antagonists 93 and 95 are all indicated as potential drugs in the treatment of SM and SLE.(2,246) The TLR7/9 inhibitors 26 and 97 are both used as immunosuppressors in the treatment of RA and SLE.(248) The peptidomimetic compound ST2825 (98) mimics the MyD88 BB-loop domain (RDVLPGT). It was used by Capolunghi et al. in a study on PBMC extracted from SLE patients. In particular, these cells were treated with 98 (1, 3, 10, 30, or 60 μM) in the presence (or in the absence) of a TLR9 agonist, namely, ODN 2006 (2.5 μg/mL). Results showed that TLR9 inhibition by 98 blocked the de novo generation of plasma cell and the secretion of autoantibodies.(258)

TLRs in Cardiovascular Diseases

ARTICLE SECTIONS
Jump To

Cardiovascular disease (CVD) represents one of the leading causes of death worldwide. Atherosclerosis is the major pathology associated with cardiovascular dysfunctions, often mediated by inflammatory stimuli. Seminal data show that TLRs and the innate immune system play a key role in the initiation and development of CVDs. The main TLRs involved in CVDs are the TLR1/2 heterodimer and TLR4, whose presence in atherosclerotic plaques accelerates the progression of the disease, while the disruption of the signaling affects its progression.(259) TLRs are mostly expressed in ECs, VSMCs, B cells, neutrophils, fibroblasts, macrophages, monocytes, NK cells, and platelets. Several studies highlighted the pivotal role of TLRs during the development of atherosclerotic plaques, myocardial ischemia/reperfusion injury, and platelet aggregation.(260) The TLR1/2 agonist 1b triggered the growth of profuse abdominal atherosclerosis in low-density lipoprotein receptors null mice (LDLr–/–). TLR3 activation led to the formation of atherosclerotic plaques, by partially regulating the activity of matrix metallo-proteinases (MMP) 2 and 9 in macrophages and by enhancing the production of ROS.(261) LPS is known as a TLR4 activator able to enhance the inflammatory response in patients with atherosclerosis. It prompted platelets adhesion to neutrophils, which is a fundamental event in the development of atherosclerosis.(262) In addition, the treatment with a TLR4 antibody decreased ROS production and the expression of IL-6 in mesenteric resistance arteries from hypertensive rats.(263) TLR5 expression is upregulated in atherosclerotic lesions, while the deficiency of this receptor resulted in a reduction of high fat-induced atherosclerosis.(264) In patients affected by acute ischemic stroke, the high expression of TLR7 in peripheral blood is associated with poor outcomes and strong inflammatory responses. The deficiency of this receptor accelerated the development of atherosclerotic plaques by reducing the release of pro-inflammatory cytokines. In a rabbit model fed with HFD, TLR8 is upregulated and related with the progression of atherosclerosis.(260) Finally, TLR9 pathway activation is implicated in the management of atherosclerosis. Indeed, genetic deletion or pharmacologic blockade of TLR9 attenuated atherogenesis in the aortic arch and reduced the accumulation of lipid and macrophages in atherosclerotic plaques in mice models.(265) Moreover, TLR9 inhibition led to a decrease in blood pressure, whereas its activation induced vascular dysfunction and increased blood pressure in normotensive rats.(261)

TLR Modulators in Cardiovascular Diseases

The TLR2 agonist 1b was able to protect the myocardium following ischemia/reperfusion (I/R) injury. The same behavior was observed prior to brain ischemia, with a significant reduction in infarct size and mortality rate in a mouse model of cerebral I/R injury, possibly through a TLR2/PI3K/PKB-dependent mechanism.(266) In LDLr–/– mice, the TLR2/6 agonist 2 induced an intense inflammatory process, by increasing plasma levels of pro-inflammatory cytokines IL-12/IL-23p40. Therefore, MALP-2 treatment induced a remarkable increase in heart valve lesions.(260) Vitamin K2 (99, Figure 20) served as an inhibitor of HFD-induced aortic intimal calcification in apolipoprotein E KO mice, by suppressing the expression of TLR2 and 4.(267) TLR6 is involved in thrombus formation, because it favors the generation of oxLDL cholesterol, which is responsible for plaque development. These events were limited by simvastatin (100) treatment, which acts as a suitable TLR4/TLR6 antagonist.(268)

Figure 20

Figure 20. Chemical structures of TLR modulators 99103 investigated against CVDs.

Melatonin (101) showed an antagonistic TLR3/TLR4 activity demonstrating protective effects on liver ischemia in a rat model and prevented necrosis and apoptosis in hepatic cells, by balancing the endothelin-1/NO ratio. Despite the TLR3 agonist poly(I:C) impaired endothelium-dependent vasodilation, it was able to reduce right ventricular failure in established pulmonary hypertension.(269) Moreover, poly(IC:LC) showed a protective effect in renal and cerebral I/R injury in vitro and in vivo, by reducing the release of inflammatory cytokines, including IL-1, IL-6, and IL-12, and decreasing the infarct size.(270)
The TLR4 antagonist LPS-RS inhibited monocyte and macrophage recruitment and collagen accumulation in the intima and, consequently, inhibited atherosclerosis in diabetic LDLr–/– mice.(262) Palmitic acid (102) administration resulted in a significant upregulation of KCa3.1 and KCa2.3 channels and downregulation of TNF-α and IL-1β expression, hence highlighting the potential of TLR4 antagonists as blood pressure regulators.(271) In a model of abdominal aortic aneurysm, the TLR4 antagonist 36b inhibited MAPK and NF-κB p65 phosphorylation associated with TLR4 downregulation. Furthermore, IAXO-102 decreased Angiotensin II-induced aortic expansion.(272) After intracerebral hemorrhage-evoked injuries, the TLR4 antagonist 34 significantly reduced brain water content, neurological deficit scores, and inflammatory factors levels, as a result of the reduced expression of IκBα and NF-κB. The selective TLR4 inhibitor 34 downregulated the expression of TLR4, MyD88, IL-1β, TNF-α, and Bax, and upregulated IκB-α and Bcl-2 expression, thus proving to be a useful tool in stroke management.(273)
The flagellin-analogue Entolimod (CBLB-502) has been shown to be protective in I/R injury by decreasing the accumulation of ROS. In renal I/R injury, pretreatment with CBLB-502 inhibited neutrophil infiltration during the reperfusion period, eliciting a beneficial role.(260)
Fluvastatin (103) decreased atherosclerotic plaque, calcium deposition, intraplaque hemorrhage, and macrophage infiltration, but increased smooth muscle cells in plaques of aortic segments by downregulating TLR2, TLR3, TLR4, and TLR8.(274)
The administration of the TLR9 modulator CpG-ODN 1668 (5′-TCCATGACGTTCCTGATGCT-3′) determined a reduced severity of atherosclerotic plaque lesions.(275) Moreover, 26, which is a TLR9 antagonist, increased the expression of MyD88-dependent proteins, thus decreasing blood pressure, as well as reducing circulating T cells and vascular infiltrating leukocytes.(276)

TLRs in Diabetes

ARTICLE SECTIONS
Jump To

Type 2 diabetes mellitus (T2DM) is a multifactorial metabolic disorder that is essentially due to an incorrect alimentary lifestyle, which leads to several complications, including retinopathies and diabetic foot ulcers.(277,278) Several evidence highlighted the regulatory role of TLRs in promoting the inflammatory process during T2DM course. TLR2 and TLR4 are enhancers of islet inflammation in T2DM, leading to the activation of macrophages and the subsequent islet endocrine cell dysfunction.(279) Increased concentrations of saturated fatty acids led to the activation of TLR2 and TLR4, potentially inducing inflammatory events, although other studies demonstrated the insulin–secretagogue properties of polyunsaturated fatty acids.(280) Noteworthy, the endogenous TLR ligands HSP60 and HSP70 (reported to be higher in T2DM patients) induced the production of pro-inflammatory cytokines via activation of TLR2 and TLR4. The ability of TLRs to initiate and propagate inflammation makes them attractive therapeutic targets in T2DM management. It has been demonstrated that TLR2 downregulation in wounds of T2DM patients, compared to nondiabetic patients, may lead to the development of nonhealing chronic ulcers.(281) Moreover, gestational diabetes patients showed a high TLR2 expression, thus confirming a suitable role for TLR2 antagonists in the management of the disease.(282) The TLR2 agonist zymosan led neutrophils to ROS release with the subsequent T2DM initiation; on the other hand, GIT2, which is a nonspecific TLR inhibitor, decreased NF-κB and Nox4 levels and improved tissue lipid metabolism and insulin resistance.(283) From a therapeutic point of view, the upregulation of insulin is an important mechanism that suppresses the expression of TLR2, thus suggesting the possibility to explore new TLR2 antagonists for the management of diabetes.(284)
TLR3 is a regulator of immune cells, pancreatic β-cells, and glucose homeostasis. Studies reported how the TLR3 agonist poly(I:C) plays a negative role in the proliferation of pancreatic β-cells. The loss of TLR3 function led to improved glucose tolerance and declined liver steatosis in obese mice.(285)
Fatty acids, such as lauric and palmitic acids, are capable of stimulating an inflammatory response through TLR4 signaling pathway; however, at the same time, omega-3 fatty acids can oppose the action of classic TLR4 agonists, such as LPS and derivatives.(286) TLR4 activation is responsible for the excessive inflammation that rapidly leads to the chronic behavior of nonhealing wounds that occur in diabetic patients, often coexisting with ischemia.(287) Thus, TLR4 ablation is responsible for the reduction of inflammation in diabetic mice.

TLR Modulators in Diabetes

Treatment of Leydig cells (derived from diabetic mice) with the TLR4 antagonist 34 (10 nM for 24 h) attenuated oxidative stress and restored the levels of phospho-ERK1/2.(288) In a model of diabetic liver injury, vitamin D3 administration for 16 weeks (0.3 μg/kg/day) downregulated the expression of TLR4, NF-κB, and TNF-α, thus attenuating hepatic inflammation and fibrosis.(289) Another feature of T2DM is diabetic nephropathy. In this context, rapamycin (104, Figure 21) was able to attenuate the inflammation via inhibition of the TLR4 signaling pathway and consequent reduction in IL-17 levels, limiting the disease at an early stage.(290) Under the same conditions, the TLR4 antagonist CRX-526 (47) significantly reduced albuminuria and blood urea nitrogen without altering blood glucose and systolic blood pressure in diabetic mice; this TLR4 inhibition was associated with a reduction of TGF-β overexpression and NF-κB activation.(291) Phytochemicals such as curcumin (105), helenalin (106), and cinnamaldehyde (107) inhibited TLR4 activation by interfering with cysteine-residue-mediated receptor dimerization. Other antagonists such as resveratrol (108), epigallocatechin gallate (109), and luteolin (110) specifically reduced TLR4 signaling by targeting TRAF-associated NF-κB activator-binding kinase 1 and receptor interacting protein 1 (RIP1) in the TRIF complex. All of these compounds showed anti-inflammatory effects, thus limiting the progression of metabolic diseases.(292) Therefore, the development of new TLR4 antagonists could provide an alternative approach for diabetic wounds.

Figure 21

Figure 21. Chemical structures of TLR modulators 104110 investigated against diabetes.

TLRs in Neurodegenerative Diseases and Retinal Degeneration

ARTICLE SECTIONS
Jump To

TLRs are widely expressed in the CNS, including neurons, astrocytes, and microglia. Mice, rats, and human microglia express TLRs to detect their related ligands. Astrocytes mainly express TLR1, TLR3, and TLR4; neurons express TLR2, TLR3, TLR4, TLR8, and TLR9; oligodendrocytes express TLR2 and TLR3; cerebral endothelial cells constitutively express TLR2, TLR4, and TLR9. There is increasing evidence of the involvement of TLRs, especially TLR2, TLR4, and TLR9, in neurodegenerative diseases, such as Alzheimer’s disease (AD) and Parkinson’s disease (PD). Several factors, involved in the pathogenesis of neurodegenerative diseases, have been reported to be modulated by TLR ligands. Accordingly, they might represent useful tools for the development of new therapeutic agents for such pathologies. Kainic acid (KA), which is a TLR2 activator, was able to induce excitotoxicity, which was decreased in TLR2 KO mice. In the collagenase-induced mouse intracerebral hemorrhage model of stroke, TLR2 KO reduced the typical stroke inflammatory conditions. These investigations showed that an antagonistic pharmacological approach could reduce neuroinflammation.(293) Several studies showed that TLR2 activation in microglia enhances pathological β-amyloid (Aβ) uptake, while others showed that TLR2 inhibition decreased glial cells reactivity, leading to a reduction of Aβ deposits and an improved cognitive performance in mice.(294) Moreover, TLR2 activation induces an abnormal α-synuclein accumulation by impairing autophagy, and it also modulates α-synuclein transmission, which, in turn, induces several diseases, including PD and dementia with Lewy bodies. Treatment with the TLR2 functional blocking antibody T2.5 reduced astrogliosis and microgliosis, with impaired expression of TNF-α and IL-6, and it ameliorated neuronal loss in synucleinopathy mice.(295) The systemic treatment with the TLR3 agonist poly(I:C) induced the production of inflammatory mediators, which increased Aβ levels in the hippocampus, which is a feature linked to cognitive dysfunction. TLR4 activation is able to increase the expression of inflammatory mediators, activating molecular pathways, which leads to neurodegenerative conditions. In AD, TLR4 promotes the abnormal accumulation of Aβ that contributes to neuroinflammation.(296) In PD, α-synuclein induces inflammatory responses in glial cells through the TLR4 pathway, causing neuronal death.(296)
Since retinal degeneration shares many hallmarks with neurodegeneration (i.e., the expression of inflammatory and oxidative markers), there is the opportunity to treat inherited retinal diseases as CNS pathologies. A study using the TLR2 antibody showed that the blockade of TLR2 transduction preserved tight junction expression and promoted retinal pigment epithelium resistance to fragmentation.(297) mRNA levels of TLR4 were found to be higher in mice with retinal degeneration. Furthermore, TLR4 favored microglial activation by endogenous photoreceptor proteins, which, in turn, prompted retinal cell death.(298) In the retinas of the degenerative rd1 mice, microglia underwent necroptosis through RIP1- and RIP3-dependent pathways. In addition, necroptotic microglia produced larger amounts of pro-inflammatory cytokines, in response to LPS-mediated TLR4 activation.(299)

TLR Modulators in Neurodegenerative Diseases

In a model of cerebral I/R, 83 reduced the expression of TLR2–TLR4, thus limiting the production of IL-1β and the number of apoptotic cells.(300) In a model of injured cornea, poly(I:C) treatment enhanced the migration of endothelial progenitor cells and the expression of the stromal cell-derived factor 1, resulting in neovascularization.(301) The neuroprotective effect of TLR3 was also evaluated against cardiopulmonary bypass-induced injury: the treatment with sevoflurane (111) reduced the number of apoptotic hippocampal neurons via TLR3 activation. Only the agonist MPLA was able to prevent the accumulation of Aβ in AD mice models.(302) In aluminum-chloride-induced AD, a TLR4 overexpression was documented. In this study, ethyl pyruvate treatment (112, 50, 100, 200 mg/kg/day) rescued TLR4 overexpression and associated oxidative stress in brain tissues.(303) In inflamed microglia, treatment with the TLR4 antagonist 34 (1 μM) suppressed LPS-induced microglial activation, improving levels of neurogenesis.(304) Noteworthy, 34, acting via TLR4-MyD88/TRIF-NF-κB signaling pathway, was able to reduce traumatic brain injury-induced neurons loss, brain edema, and neurobehavioral impairment in rats, subsequently inhibiting neuronal autophagy and neuroinflammation responses in the hippocampus.(305) In inflammation-induced primary microglia, dihydrotestosterone (113) acted as a TLR4 antagonist by limiting LPS-mediated activation, NF-κB, and MAPK p38 signaling pathways and attenuating the release of TNF-α, IL-1β, IL-6, iNOS, COX-2, NO, and PGE2.(306) In another work, the cyanobacteria-derivative TLR4 inhibitor VB3323 was able to decrease microglial activation and morphological alterations of spinal cord neurons.(307) In an AD model, the mechanism of action of hesperetin (114) was shown to be related to the modulation of TLR4/Nrf2/NF-κB signaling, providing a new therapeutic opportunity in AD.(308) 2,2′,5′-Trihydroxychalcone (2,2′,5′-THC, 115) is a ROS scavenger that downregulates TLR4 expression and inhibits apoptosis in stimulated primary rat neuronal cultures by reducing TNF-α and IL-6 secretion.(309) Phytocompounds from licorice showed interesting neuroprotective properties via inhibition of the TLR4 signaling pathway. For example, isoliquiritigenin (116) pretreatment in KA-induced epileptic rats reduced the release of CCL3, TNF-α, and IL-1β; moreover, the blockade of MyD88 signaling attenuated KA-induced neuroinflammation and neuronal damage in the hippocampus.(310) In AD, CpG-ODNs activate TLR9, enhancing Aβ ingestion by microglia, reducing Aβ aggregation, and ameliorating memory impairment. In addition, TLR9 activity attenuated aberrant neurogenesis in the hippocampus and reduced seizure mediated by KA.(296) In the PD model, TLR9 activation is mediated by glucocorticoid receptors, which are responsible for dopamine neuron loss. This behavior was limited by COV08-0064 (117), which is a selective TLR9 inhibitor, opening the way for further studies with the aim to discover new drug candidates for PD.(311)Figure 22 shows the chemical structures of TLR modulators 111117.

Figure 22

Figure 22. Chemical structures of TLR modulators 111117 useful in neurodegenerative diseases.

Conclusions and Perspectives

ARTICLE SECTIONS
Jump To

Since the discovery of TLRs, many research efforts have been accomplished to select promising hit compounds for each TLR family member. TLR activity underpins many disorders, including infectious and autoimmune diseases, cancer, cardiovascular and neurodegenerative disorders. Accordingly, alteration of TLR functioning is deeply involved in the progression of several diseases, as changes in TLRs activity during their pathogenesis have been widely demonstrated. The modulation of TLRs by small molecules or natural compounds could be exploited to attain a therapeutic effect. In this context, the majority of TLRs’ modulators so far undergone in clinical evaluation have been investigated as potential vaccine adjuvants (65%) while the remaining have been developed as therapeutic drugs (small molecules).
Table 1 summarizes the most promising TLR modulators among the compounds herein discussed. Compounds 1a, 1b, and their derivatives are the most studied TLR1/2 and 2/6 agonists, which have been evaluated in several diseases. Another important TLR2 modulator worthy of particular mention is the picomolar agonist 76, endowed with significant antitumor against melanoma. On the other hand, the TLR2 antagonists 42 and 44 are characterized by a potential anti-inflammatory activity. Poly(IC:LC) and poly(I:C12U) are the most explored poly(I:C) derivatives in clinical trials as TLR3 modulators. Derivatives of the natural TLR4 ligand lipid A, such as 8 and 9, are the most representative TLR4 agonists and antagonists, respectively. In particular, 9, as well as AGPs, have been approved in cancer immunotherapy as vaccine adjuvants. Notably, a small molecule, the TLR4 antagonist 34, represents one of the most important small molecules employed against many pathologies, including inflammation, sepsis, cancer, RA, CVDs, diabetes, and neurodegenerative disorders. Flagellin and its derivatives are the most studied TLR5 ligands. Entolimod is a promising TLR5 agonist, widely evaluated in cancer and infectious diseases. Since the discovery of imidazoquinolines as potent TLR7 and TLR8 agonists, many derivatives have been developed and the most representative analogue (15) was approved for the treatment of superficial basal cell carcinoma and genital warts. In this context, structural modifications of the imidazoquinoline core, by removal of the five-membered ring (i.e., 15 vs 96) inferred an activity switch from agonism to antagonism. Notably, the TLR8 antagonist 96 is under clinical evaluation for inflammation, MS, SLE and other autoimmune diseases. In a repurposing approach, 26 and 97 stood out as TLR7 and TLR8 inhibitors for the treatment of RA, SLE, sepsis, viral infections, and autoimmune diseases. The wide class of CpG-ODNs encompassed the best TLR9 modulators which are in clinical trials against various diseases.
Table 1. Summary of the Most Promising TLR Modulators Described in the Previous Sections
TLRliganddiseasemechanism/biological effectref(s)
Agonists
TLR2/1 and TLR2/6Pam2/3CSK4, 1a, 1bHBVinhibition of replication and capsid formation(22)
TLR2/1 and TLR2/6Pam2/3CSK4, 1a, 1bbreast cancerproduction of TNF-α(173)
TLR2/1 and TLR2/6Pam2/3CSK4, 1a, 1bischemia/reperfusioninduction of survival factor PI3K/PKB(260)
TLR2/1 and TLR2/6Trumenbameningococcal meningitisinduction of inflammation(92)
TLR2/1 and TLR2/6PEG-Pam2Cys, 28malaria and infectious diseasesdecrease in the number of parasites(130)
TLR2/1 and TLR2/6UPam 72alung cancerincreased release of IL-12 and p40(177)
TLR2/1 and TLR2/6Diprovocim-1, 76melanomaincreased release of TNF-α(181,183)
TLR2/1 and TLR2/6SMU-Z1, 77leukemiaNF-κB, TNF-α, IL-1β induction(184)
TLR2/1 and TLR2/6Zymosandiabetesincreased release of ROS(284)
     
TLR3poly(I:C)several virusesimmune system stimulation(20)
TLR3poly(I:C)E. coliphagocytosis increasing the release of cyto-/chemokines and NO(98)
TLR3poly(I:C)MSIFN-β and TNF-α induction(225)
TLR3poly(I:C)pulmonary hypertensionincreased release of IL-10(269)
TLR3poly(I:C)diabetic woundsgrowth factors amplification(312)
TLR3BM-06hepatocellular cell carcinomainduction of apoptosis(188)
TLR3Sevoflurane, 111cardiopulmonary bypass-induced injuryreduction of the apoptotic hippocampal neurons(296)
TLR3poly(IC:LC)IAV, RSV, SARS-CoVstimulation of the immune system(12)
TLR3poly(IC:LC)HBV, HIVincreased expression of IFNs and stimulation of innate immune response(15)
TLR3IPH-3102breast canceractivation of NF-κB signaling pathway and induction of type I-IFN responses(189)
TLR3poly(I:C12U)MSactivation of IFNs and p68(32)
     
TLR4MPLA, 9cancer immunotherapyTh-1-mediated immune response(39)
TLR4MPLA, 9bacterial infectionsincreased resistance to bacteria(102)
TLR4MPLA, 9ADAβ accumulation prevention(302)
TLR4GLA, 68HIVenhanced immunization(3)
TLR4GLA, 68melanoma and sarcomaDCs, monocytes, and macrophages stimulation(3,170)
TLR4Sophoridine, 85gastric cancerrelease of iNOS, IFN-β and IL-12α(201)
TLR41Z105, 11IAVregulation of TH1- and TH2-type immune response(49)
     
TLR5Entolimodhepatic cancer and melanomareduction of metastasis(313)
TLR5FlagellinS. pneumoniaeincreased release of IL-6 and TNF-α(85)
     
TLR7GSK2245035, 60inflammationsuppression of TH2-mediated cytokine responses to allergens(163)
TLR761inflammationIFNα induction(164)
TLR7Imiquimod, 15several virusesenhance the T cell response(25)
TLR7Imiquimod, 15superficial basal cell carcinomaIFN-α, IL-6 and TNF-α(3)
TLR7SMIP-7.7HSV-2reduction of replication and enhancement of immune response(58)
TLR786various cancersinduction of apoptosis(203)
     
TLR7/8Resiquimod, 16HSV-2, HCV, HIVreduction of replication and enhancement of immune response(58,67)
TLR7/823HBVreduction of replication(72)
TLR7/8852A, 65various cancersreduction of metastasis(170)
     
TLR862inflammationreduction of cytokines(165)
TLR863inflammationinduced TH1-biasing IFN-γ and IL-12(166)
     
TLR8/9CU-CPT17e, 88bcervical cancerinduction of apoptosis(217)
     
TLR9MGN 1703HIVincreased innate immune response(78)
TLR9various CpG-ODNsbacterial infectionspro-inflammatory cytokines induction and (TH1)-dependent immune response(114)
TLR9various CpG-ODNsneuroblastomainduction of apoptosis(170)
TLR9ODN2395bacterial pneumoniaenhanced mucosal T cells immune response(117)
TLR9KSK-CpGmelanomaincrease activity of CTLs and NK cells, TH1 activation and IL-6 and IL-12 induction(207)
TLR9CpG-1826gliomatumor-associated macrophages, B cells, DCs and cytotoxic T cells induction(212)
Antagonists
TLR2/1CU-CPT22, 42macrophage inflammationreduction of NF-κB signaling(94)
TLR2/1SMU-8c, 44macrophage inflammationdown-regulation of NO and TNF-α(314)
TLR2/1E567, 6HSV-1reduction of inflammation(20)
     
TLR2/4Rabeximod, 92MSreduction of EAE severity(228)
TLR2/4Vitamin K2, 99atherosclerosisinhibition of aortic intimal calcification(267)
     
TLR2/6GIT2diabetesdecreased NF-κB and Nox4 levels(281)
     
TLR3OAA, 46inflammationreduction of the activation of NF-κB/MAPK/IKKα/β(281)
     
TLR3/4Baclofen, 90MSreduction of NF-κB and TNF-α levels(229)
TLR3/4Auranofin, 94RAreduction of NF-κB production(243)
TLR3/4melatonin, 101liver ischemiaprevention of necrosis and apoptosis by balancing the endothelin-1/NO ratio(261)
     
     
TLR4TAK-242, 34various inflammatory conditionsreduction of cytokines expression(143,148)
TLR4TAK-242, 34RAreduction of cytokines(245)
TLR4TAK-242, 34neuroinflammationsuppression of LPS-induced microglial activation(304)
TLR4IAXO series, 36a36cHIV, HSV, IAVreduction of acute sepsis and acute lung injury(12)
TLR4IAXO series, 36a36cabdominal aortic aneurysminhibition of MAPK and NF-κB p65 phosphorylation(272)
TLR4Eritoran, 8sepsisreduction of cytokines(118,120)
TLR4CXC195, 80hepatocellular carcinomasuppression of cytokines release (TNF-α, IL-1β, IL-6)(192)
TLR4Triptolide, 82pancreatic cancerreduction of NF-κB signaling and apoptosis promotion(198)
TLR4LPS-RSatherosclerosisinhibition of monocytes and macrophages recruitment and collagen accumulation(262)
TLR4CRX-526, 47diabetesreduction of TGF-β overexpression and NF-κB activation(287)
     
TLR7/8HCQ, 97RA, SLE, sepsis, HIV, IAV, DENVsuppression of autoantigen presentation and decreased cytokine production(2,315)
TLR7/8CQ, 26RA, SLE, sepsis, HIV, IAV, DENVsuppression of autoantigen presentation and decreased cytokine production(2,315)
TLR7/8SM934, 93inflammatory and autoimmune diseasesIFN-γ and IL-17 production(2)
     
TLR8CU-CPT9a, 96inflammatory and autoimmune diseasesreduction of TNF-α(247)
TLR8ST2825, 98SLEblockage of the de novo generation of plasma cells and autoantibodies secretion(258)
TLR8COV08-0064, 117PDreduction of dopamine neurons degeneration(311)
To complement the data reported by Anwar et al., Table 2 summarizes the latest clinical trials launched in the last two years about TLR modulators. The majority of these studies are on infectious diseases and cancer. These studies exploited TLR modulators belonging to different classes, including poly(IC:LC), LPS, imdazoquinolines (Vesatolimod), and CPG-ODNs.(316)
Table 2. Summary of the Latest Clinical Trials Involving TLR Modulators
TLRmodulatoractivityconditionphaseNCT
TLR3poly(IC:LC)Agonistmelanoma vaccinePhase 1NCT04364230
TLR3poly(IC:LC)Agonistmelanoma vaccinePhase 2NCT04364230
TLR3poly(I:C12U)Agonistbreast cancerPhase 1NCT04081389
      
TLR4AS04AgonistHIV infectionPhase 1NCT04301154
TLR4AP 10-701AgonistschistosomiasisPhase 1NCT03910972
TLR4AP 10-701AgonistschistosomiasisPhase 2NCT03910972
TLR4GLA, 68AgonistschistosomiasisPhase 2NCT03799510
      
TLR7VesatolimodAgonistHIV infectionPhase 2NCT04364035
TLR7Imiquimod, 15Agonistinflammatory bowel diseasePhase 2NCT04083157
TLR7Imiquimod, 15AgonistHepatitis BPhase 3NCT04083157
      
TLR8VTX-2337, 67Agonistsquamous cells carcinomaPhase 1NCT03906526
      
TLR9IMO-2125AgonistmelanomaPhase 2NCT04126876
TLR9SD-101Agonistpancreatic cancerPhase 1NCT04050085
With regard to the natural compounds reported herein as TLR ligands, they are summarized in Table 3. Note that they are, by a vast majority, represented by fragments of bacterial cell wall components, pathogenic nucleic acids, and other PAMPs or extracted from plants. This part also holds promise, from a medicinal chemistry perspective, and there is enough room for further improvements and discoveries. In our view, it is thus important to keep exploring the activity of new additional natural products, to assess their potential TLR modulatory activity and therapeutic effects.
Table 3. Summary of Natural-Derived Compounds Explored as TLR Modulators
TLRnatural liganddescriptiontherapeutic indicationref(s)
Agonists
TLR2/1 and TLR2/6MALP-2, 2Lipopeptide isolated from Mycoplasma fermentasantibacterial(85)
     
TLR4Lipid Amembrane-anchoring moiety of LPSnot explored for any diseases due to toxicity(39)
TLR4Lipid Aantifungal drug extracted from Streptomyces nodosusantiviral(54)
TLR4Amphotericin B, 13antifungal drug extracted from Streptomyces nodosusantiviral(54)
TLR4Diaporine, 84fungal metabolic productbreast cancer(200)
TLR4Sophoridine, 85quinolizidine isolated from Sophora flavescensantitumoral activity(201)
TLR4PSPextracted from Coriolus versicolorantiviral(50)
TLR4FimHconstituent of E. coli type 1 fimbriaeimmune-stimulating activity against IAV and CVB3(52,53)
     
TLR5STF2Salmonella typhimurium flagellinIAV as vaccines adjuvant(3,20)
TLR5Flagellinmain component of bacterial flagellaanticancer and antibacterial activity(85,313)
     
TLR9Oxymatrine, 27extracted from Sophora alopecuraideschronic HBV patients(79)
Antagonists
TLR2/1Phloretinpolyphenolanti-inflammatory(145)
     
TLR2 and TLR4Soyasaponin I, 45soy derivative monodesmoside saponinanti-inflammatory(146)
TLR2 and TLR4Vitamin K2, 99human and bacterial metabolic productatherosclerosis(267)
TLR2 and TLR4Sparstolonin B, 38 Naringenin, 37chalconeviral sepsis(123,124,161)
TLR3OAA, 46triterpenoid derived from Vigna angularizanti-inflammatory(147)
     
TLR3 and TLR4melatonin, 101human hormoneliver ischemia(270)
     
TLR4Adenosine, Codycepin, HEA, 52acextracted from mushroom Cordyceps cicadaeanti-inflammatory(153)
TLR4Parthenolide, 53sesquiterpene lactone extracted from Tanacetum partheniumanti-inflammatory(154)
TLR4Palmitic acid, 102common saturated fatty acid found in animals, plants and microorganismsCVDs(271)
TLR4Rapamycin, 104isolated from Streptomyces hygroscopicusdiabetes(290)
TLR4Curcumin, 105diarylheptanoid isolated from Curcuma longadiabetes(292)
TLR4Resveratrol, 108stilbenoid obtained from several plantsdiabetes(292)
TLR4Epigallocatechin gallate, 109catechin of teadiabetes(292)
TLR4Luteolin, 110flovonoid isolated from Reseda luteoladiabetes(292)
TLR4Helenalin, 106sesquiterpene lactone isolated from Arnica montanadiabetes(292)
TLR4Cinnamaldeyde, 107isolated from the bark of cinnamon treediabetes(292)
TLR4Chlojaponilactone B, 54sesquiterpenoid extracted from Chloranthus japonicumanti-inflammatory(155)
TLR4Diethyl blechnic, 55extracted from Salvia miltiorrhizaanti-inflammatory(156)
TLR4Hypaphorine, 56indole alkaloid isolated Extracted from Caraganaanti-inflammatory(158)
TLR4Dihydrotestosterone, 113androgen gonadal steroidantineuroinflammatory(306)
TLR4Hesperetin, 114flavanone isolated from Citruspotential use in AD(308)
TLR42,2′,5′-THC, 115chalcone derivativesneuroprotection(309)
TLR4Isoliquiritigenin, 116chalcone derivatives extracted from licoriceneuroprotection(310)
TLR4Triptolide, 82diterpenoide isolated from Tripterygium wilfordiiantitumoral activity(197,198)
TLR4Paeonol, 83phenolic compoundantitumoral activity(199)
The beneficial effects of TLR modulation have been extensively demonstrated against viral and bacterial infections, cancer, and autoimmune diseases. However, because of the ability of TLR to either ameliorate the progression of several diseases or worsen the inflammatory state, we must underline the importance of planning a wise therapeutic approach, which will not overactivate or overinhibit the immunomodulatory signaling. Among the most promising therapeutic options, combined therapies represent a valuable and widely explored approach. Recent studies also point in the direction of using combinations of multiple TLR agonists or TLR antagonists with appropriate pathway modulators. Accordingly, several reports and trials describe the benefits of the association of monoclonal antibodies, chemotherapeutics, or radiations with TLR modulators in cancer patients (NCT02643303, NCT01421017, etc.), as well as the association of TLR modulators and antiviral drugs (NCT00823862, NCT04225715).
The design of many clinical trials involving the use of TLR modulators, and the approval of some of these drugs by FDA and EMA, should encourage researchers to keep exploring these fascinating targets, in order to develop new and more potent modulators that may represent key pharmacological tools for the treatment of various human diseases. In this context, the evaluation of biological samples such as anti-TLR antibodies or TLR fragments peptide-conjugated is providing mounting evidence of their possible leading role in the development of specific, potent, and less-toxic TLR-modulators.(317,318) In this frame, the availability of modern computational protocols and chemoproteomic profiling may help researchers in the development of improved TLR modulators endowed with a safer profile to be also applied in personalized medicine.
The pandemic SARS-CoV-2 outbreak of December 2019 pulled researchers to join their efforts to find effective therapeutic approaches to eradicate this virus. In this context, we have previously discussed the implication of TLR3, TLR7, and TLR8 modulators against 2003 SARS-CoV. Furthermore, a possible correlation between TLRs and the new coronavirus has been recently discovered. Particularly, TLR2, TLR3, TLR7, and TLR8 of epithelial and myeloid cells can stimulate the production of antiviral pro-inflammatory mediators (IL-6, IL-8, IFNs), following the activation of NF-κB.(319) Moreover, a therapeutic role for TLR5 has been proposed very recently by Chakraborty et al.; it can be used as an immunomodulator that is able to activate the immune system to fight the SARS-CoV-2.(320) Interestingly, in a 2020 preprint research article, the use of a combination of inhaled 1a and CpG-ODNs in mice to stimulate their immune system against SARS-CoV-2 has been reported.(321) For these reasons, a wider exploration of TLRs and their modulators may drive the discovery of new potential drugs or vaccine adjuvants to be applied against SARS-CoV-2. As recently reported by Conti et al., the binding of SARS-CoV-2 to TLR2, TLR3, or TLR4 determines the release of inflammatory cytokines such as IFN-α, TNF, and IL-1. These mediators stimulate inflammasome activation and the production of active mature IL-1β, which is a mediator of fever, lung inflammation, and fibrosis. Hence, the inhibition of TLR-mediated inflammation could represent another therapeutic strategy in the management of SARS-CoV-2 infection.(322)
For some pathologies (e.g., diabetes and neurodegenerative disorders), the discovery of effective TLR modulators has been hampered by the lack of solid pharmacological models, and a clear understanding of the role of these receptors in the progression of the specific disease. In these cases, we advise that, in a repurposing-like approach, the application of known TLR modulators might contribute to establish the role of these receptors during disease progression, paving the way for the discovery of novel pharmacological tools and TLRs-based therapeutic options.

Author Information

ARTICLE SECTIONS
Jump To

  • Corresponding Authors
  • Authors
    • Stefano Federico - Department of Biotechnology, Chemistry and Pharmacy, Department of Excellence 2018−2022, University of Siena, via Aldo Moro 2, 53100, Siena, Italy
    • Luca Pozzetti - Department of Biotechnology, Chemistry and Pharmacy, Department of Excellence 2018−2022, University of Siena, via Aldo Moro 2, 53100, Siena, Italy
    • Alessandro Papa - Department of Biotechnology, Chemistry and Pharmacy, Department of Excellence 2018−2022, University of Siena, via Aldo Moro 2, 53100, Siena, Italy
    • Gabriele Carullo - Department of Biotechnology, Chemistry and Pharmacy, Department of Excellence 2018−2022, University of Siena, via Aldo Moro 2, 53100, Siena, ItalyOrcidhttp://orcid.org/0000-0002-1619-3295
    • Sandra Gemma - Department of Biotechnology, Chemistry and Pharmacy, Department of Excellence 2018−2022, University of Siena, via Aldo Moro 2, 53100, Siena, ItalyOrcidhttp://orcid.org/0000-0002-8313-2417
    • Nicola Relitti - Department of Biotechnology, Chemistry and Pharmacy, Department of Excellence 2018−2022, University of Siena, via Aldo Moro 2, 53100, Siena, ItalyOrcidhttp://orcid.org/0000-0001-9783-8966
  • Author Contributions

    These authors contributed equally

  • Notes
    The authors declare no competing financial interest.

Biographies

ARTICLE SECTIONS
Jump To

Stefano Federico

Stefano Federico obtained his Master’s Degree in Chemical and Pharmaceutical Sciences at the University of Siena in 2017, under the supervision of Prof. Stefania Butini. Since 2018, he has been working as a Ph.D. student (in Chemical and Pharmaceutical Sciences) at the same university, under the guidance of Prof. Giuseppe Campiani. His research activity involves the development of multistage drugs to fight poverty-related and neglected parasitic diseases, especially directed against Plasmodium, Leishmania, and Schistosoma life stages.

Luca Pozzetti

Luca Pozzetti graduated cum laude in Chemical and Pharmaceutical Sciences at University of Pavia in 2019 under the supervision of Prof. Simona Collina. He is currently pursuing his Ph.D. in Pharmaceutical Sciences at the University of Siena, mentored by Prof. Giuseppe Campiani. His research activity encompasses the development and application of analytical and synthetic methodologies for investigating nutraceutical products and bioactive molecules. Particularly, he is currently involved in the development of novel anticancer and antiparasitic agents.

Alessandro Papa

Alessandro Papa obtained his Master’s Degree in Chemical and Pharmaceutical Sciences in 2019 at University of Siena, under the supervision of Prof. Stefania Butini. He is currently pursuing his Ph.D. in Pharmaceutical Sciences at the University of Siena, under the supervision of Prof. Stefania Butini. His research activity is focused on the synthesis of novel compounds that are able to modulate the endocannabinoid system, control inflammation, and promote neuroprotection and myelin repair.

Gabriele Carullo

Gabriele Carullo obtained is Ph.D. in Translational Medicine-Design of New Therapeutic Tools, at the University of Calabria in 2020, with an international mobility period at the University of Seville. His research interests have focused on the development of GPR40 and GPR120 agonists, which are useful in type 2 diabetes and diabetic wounds, and also new KCa1.1 activators and Cav1.2 blockers for the treatment of hypertension, starting from natural products. Since 2020, he has been a Research Fellow in Medicinal Chemistry at the University of Siena, and he is involved in the research of new small molecules for the treatment of inherited retinal diseases.

Sandra Gemma

Sandra Gemma is an Associate Professor of Medicinal Chemistry at the University of Siena. She graduated in Chemical and Pharmaceutical Sciences at the University of Siena in 1998, where she also received her Ph.D. degree (2003). She was a postdoctoral fellow at the Department of Chemistry at the University of Illinois at Chicago in the research group of Prof. Arun K. Ghosh. She also visited the Department of Chemistry at Purdue University as a research assistant in the Ghosh group. Her research activity is currently focused on the structure- and ligand-based design and synthesis of therapeutic agents, comprising anti-infective and antiparasitic compounds, anticancer agents, and compounds active at the CNS. She has authored more than 100 papers in these fields.

Stefania Butini

Stefania Butini is an Associate Professor of Medicinal Chemistry at the University of Siena. She graduated from the University of Siena in 1997 and obtained her Ph.D. in Pharmaceutical Sciences in 2000. From 1999 to 2000, she interned at the University of Groningen, in The Netherlands, working on the development of novel agents for the treatment of Parkinson’s disease, under the supervision of H. W. Wikström. In 2004, she was appointed as a Senior Researcher at the University of Siena. Her research activity (reported in more than 110 manuscripts) includes target selection, rational design of innovative drugs, the development of new synthetic methodologies, and structure–activity relationship studies, with a primary focus on CNS diseases, as well as antiparasitic and antitumor agents.

Giuseppe Campiani

Giuseppe Campiani is a full professor of Medicinal Chemistry at the University of Siena. After his Ph.D. in Pharmaceutical Sciences, Dr. Campiani performed postdoctoral research at Mayo Clinic Jacksonville, in the group directed by Prof. Alan Kozikowski, and at Columbia University in New York City, working in Koji Nakanishi’s research group. He was also appointed as a Visiting Professor at Trinity College Dublin. Dr. Campiani is presently leading a drug discovery research group at the Department of Excellence of Biotechnology, Chemistry, and Pharmacy at the University of Siena. His broad interest in medicinal chemistry and drug discovery encompasses the development of modulators of epigenetic targets and the discovery of biologically active compounds to combat rare diseases, cancer, neuropsychiatric and neurodegenerative disorders, and infectious diseases.

Nicola Relitti

Nicola Relitti obtained his Ph.D. in Chemical and Pharmaceutical Sciences at the University of Siena in 2016. His research focused on the development of novel antiparasitic compounds. He later went on to pursue postdoctoral research at Purdue University (2016–2018), where he developed novel anticancer agents. Since 2018, Dr. Relitti has been a postdoctoral researcher at the University of Siena, involved in the research of new antitumoral and modulators of the autophagic process of esophageal squamous cell carcinoma.

Acknowledgments

ARTICLE SECTIONS
Jump To

We acknowledge MIUR Grant Dipartimento di Eccellenza (N0. 2018–2022 (l. 232/2016)) to the Department of Biotechnology, Chemistry and Pharmacy, University of Siena and the Tuscany strategic project (No. POR-FSE 2014 to 2020), “Medicina di Precisione e Malattie Rare” (MePreMaRe), (ACE-ESCC). This work was supported by Ministero dell’Istruzione, dell’Università e della Ricerca (MIUR) PRIN Project No. 20154JRJPP.

Abbreviations Used
Abs

autoantibodies

AD

Alzheimer’s disease

AGPs

aminoalkylglucosaminide 4-phosphates

ALI

acute lung injury

AMOs

anti-miRNA oligonucleotides

AmpB

amphotericin B

AP1

activated protein 1

APCs

antigen-presenting cells

AS04

adjuvant system 04

β-amyloid

KA

kainic acid

Bax

Bcl-2-associated X protein

CCL3

chemokine (C–C motif) ligand 3

CD80

cluster of differentiation 80

CHIKV

Chikungunya virus

CLRs

C-type lectin receptors

CNS

central nervous system

COPD

chronic obstructive pulmonary disease

COX2

cyclooxygenase 2

CpG

cytosine–phosphate–guanine

CQ

chloroquine

CTLs

cytotoxic T lymphocytes

CVB3

coxsackievirus B3

CVDs

cardiovascular diseases

DAMPs

damage-associated molecular patterns

DCs

dendritic cells

DENV

Dengue virus

EAE

experimental autoimmune encephalitis

EBOV

Ebola virus

EBV

Epstein-Barr virus

ECD

extracellular domain

ECs

endothelial cells

EMCV

encephalomyocarditis virus

EnanDIM

enantiomeric DNA-based immunomodulators

EV-A71

enterovirus-A71

FimH

Fimbriae H

FLS

fibroblast-like synoviocytes

G-CSF

granulocyte-colony stimulating factor

GEM

gemcitabine

GLA

glucopyranosyl lipid adjuvant

GM-CSF

granulocyte macrophage colony stimulating factor

GN

glomerulonephritis

GXM

glucuronoxylomannan

HAdV

human adenovirus

HBsAg

hepatitis B antigen

HBV

hepatitis B virus

HCMV

human cytomegalovirus

HCQ

hydroxychloroquine

HCV

hepatitis C virus

HEA

N6-(2-hydroxyethyl)-adenosine

HEV

hepatitis E virus

HFD

high fatty diet

I/R

ischemia/reperfusion

HIV

human immunodeficiency virus

HPV

human papilloma virus

HSP

heat shock protein

HSV

Herpes Simplex virus

HTLV-1

human T-lymphotropic virus type 1

HV

Hantaan virus

i.p.

intraperitoneal

i.v.

intravenous

IAV

influenza A virus

IC:LC

interstitial cajal-like cell

ICAM-1

intracellular adhesion molecule-1

IFNs

interferons

Ig

immunoglobulin

IKKα

IκB kinase α

p38

protein 38

IL

interleukin

IMOs

immune modulatory oligonucleotides

IMQ

imiquimod

iNOS

inducible nitric oxide synthase

IRAKs

IL-1 R-associated kinase

IRF-3

IFN-regulatory factor 3

IκB

inhibitor of κB

JEV

Japanese encephalitis virus

JNK

c-Jun-N-terminal kinase

KO

knockout

KSHV

Kaposi’s sarcoma-associated herpesvirus

LDLr

low density lipoprotein receptors

LEC

lowest effective concentration

LMMGFs

low molecular weight mannogalactofucans

LOS

lipooligosaccharides

LPS

lipopolysaccharides

LRR9

leucine-rich repeat 9

MAL

MyD88 adapter-like protein

MALP-2

microsomal lipopeptide macrophage activating lipopeptide 2

MamA

mammaglobin-A

MAPK

mitogen-activated protein kinase

MCP-1, VCAM-1

vascular cell adhesion molecule-1

MD2

myeloid differentiation 2

MDA5

melanoma differentiation-associated protein 5

MGCs

mannoside glycolipid conjugates

MHC

major histocompatibility complex

MMP

matrix metallo-proteinases

MPLA

monophosphoryl lipid A

MS

multiple sclerosis

mTOR

mammalian target of rapamycin

MyD88

myeloid differentiation primary response protein 88

NEMO

NF-κB essential modulator

p68

protein kinase 68

NF-κB

nuclear factor κB

NK

natural killer

NO

nitric oxide

NODs

domain-like receptors

Nox

NADPH oxidase

NS3

nonstructural protein 3

OAA

oleanoic acid acetate

ODNs

oligodeoxynucleotides

ORNs

oligoribonucleotides

Pam

palmitoyl

Pam2Cys

S-[2,3-bis(palmitoyloxy)propyl] cysteine

Pam3cys

S-[2,3-bis(palmitoyloxy)propyl]-N-palmitoyl-cysteine

PAMPs

pathogen-associated molecular patterns

PBMCs

human peripheral blood mononuclear cells

PCs

phosphatidylcholines

PD

Parkinson’s disease

PD1

programmed cell death protein 1

PD-L1

antiprogrammed dead ligand 1

PEG-Pam2Cys

pegylated Pam2Cys

PGE2

prostaglandin E2

poly(I:C)

polyinosinic:polycytidylic acid

PRRs

pattern recognition receptors

PSP

Polysaccharide peptide

PTV

Punta Toro virus

RA

rheumatoid arthritis

RABV

rabies virus

RFA

radio-frequency ablation

RIP1

receptor interacting protein 1

RIPK-1

receptor interacting protein kinase 1

RLRs

RIG-1 like receptors

ROS

reactive oxygen species

RSV

respiratory syncytial virus

SAR

structure–activity relationship

SARS-CoV

severe acute respiratory syndrome-corona virus

SFs

synovial fibroblasts

SIV

simian immunodeficiency virus

SLE

systemic lupus erythematosus

SLPs

synthetic long peptides

SMs

synovial macrophages

SNP

single nucleotide polymorphisms

STAT3

signal transducer and activator of transcription 3

T2DM

type 2 diabetes mellitus

TAA

tumor-associated antigen

TAK1

transforming growth factor β-activated kinase

TAMs

tumor-associated macrophages

TBEV

tick-borne encephalitis virus

TGF-β1

transforming growth factor-β1

TH1

T helper 1

TIR

toll/IL-1 receptor

TLRs

toll-like receptors

TNF

tumor necrosis factor

TRAF6

TNF receptor-associated factor 6

TRAM

TRIF-related adapter molecule

TRIF

TIR-domain-containing adapter-inducing IFN-β

VSMCs

vascular smooth muscles

VSV

vesicular stomatitis virus

VV

vaccinia virus

LCMV

lymphocytic choriomeningitis virus

VZV

Varicella Zoster virus

WNV

West Nile virus

YFV

yellow fever virus

ZIKV

Zika virus

References

ARTICLE SECTIONS
Jump To

This article references 322 other publications.

  1. 1
    Khajeh Alizadeh Attar, M.; Anwar, M. A.; Eskian, M.; Keshavarz-Fathi, M.; Choi, S.; Rezaei, N. Basic Understanding and Therapeutic Approaches to Target Toll-like Receptors in Cancerous Microenvironment and Metastasis. Med. Res. Rev. 2018, 38 (5), 14691484,  DOI: 10.1002/med.21480
  2. 2
    Patinote, C.; Karroum, N. B.; Moarbess, G.; Cirnat, N.; Kassab, I.; Bonnet, P. A.; Deleuze-Masquéfa, C. Agonist and Antagonist Ligands of Toll-like Receptors 7 and 8: Ingenious Tools for Therapeutic Purposes. Eur. J. Med. Chem. 2020, 193, 112238,  DOI: 10.1016/j.ejmech.2020.112238
  3. 3
    Anwar, M. A.; Shah, M.; Kim, J.; Choi, S. Recent Clinical Trends in Toll-like Receptor Targeting Therapeutics. Med. Res. Rev. 2019, 39 (3), 10531090,  DOI: 10.1002/med.21553
  4. 4
    Wang, Y.; Zhang, S.; Li, H.; Wang, H.; Zhang, T.; Hutchinson, M. R.; Yin, H.; Wang, X. Small-Molecule Modulators of Toll-like Receptors. Acc. Chem. Res. 2020, 53, 1046,  DOI: 10.1021/acs.accounts.9b00631
  5. 5
    Xu, Y.; Tao, X.; Shen, B.; Horng, T.; Medzhitov, R.; Manley, J. L.; Tong, L. Structural Basis for Signal Transduction by the Toll/Interleukin-1 Receptor Domains. Nature 2000, 408 (6808), 111115,  DOI: 10.1038/35040600
  6. 6
    Marciani, D. J. Vaccine Adjuvants: Role and Mechanisms of Action in Vaccine Immunogenicity. Drug Discovery Today 2003, 8 (20), 934943,  DOI: 10.1016/S1359-6446(03)02864-2
  7. 7
    Halperin, S. A.; Dobson, S.; McNeil, S.; Langley, J. M.; Smith, B.; McCall-Sani, R.; Levitt, D.; Van Nest, G.; Gennevois, D.; Eiden, J. J. Comparison of the Safety and Immunogenicity of Hepatitis B Virus Surface Antigen Co-Administered with an Immunostimulatory Phosphorothioate Oligonucleotide and a Licensed Hepatitis B Vaccine in Healthy Young Adults. Vaccine 2006, 24 (1), 2026,  DOI: 10.1016/j.vaccine.2005.08.095
  8. 8
    Kanzler, H.; Barrat, F. J.; Hessel, E. M.; Coffman, R. L. Therapeutic Targeting of Innate Immunity with Toll-like Receptor Agonists and Antagonists. Nat. Med. 2007, 13 (5), 552559,  DOI: 10.1038/nm1589
  9. 9
    Kurt-Jones, E. A.; Popova, L.; Kwinn, L.; Haynes, L. M.; Jones, L. P.; Tripp, R. A.; Walsh, E. E.; Freeman, M. W.; Golenbock, D. T.; Anderson, L. J.; Finberg, R. W. Pattern Recognition Receptors TLR4 and CD14 Mediate Response to Respiratory Syncytial Virus. Nat. Immunol. 2000, 1 (5), 398401,  DOI: 10.1038/80833
  10. 10
    Lester, S. N.; Li, K. Toll-like Receptors in Antiviral Innate Immunity. J. Mol. Biol. 2014, 426 (6), 12461264,  DOI: 10.1016/j.jmb.2013.11.024
  11. 11
    Carriere, J.; Rao, Y.; Liu, Q.; Lin, X.; Zhao, J.; Feng, P. Post-Translational Control of Innate Immune Signaling Pathways by Herpesviruses. Front. Microbiol. 2019, 10, 2647,  DOI: 10.3389/fmicb.2019.02647
  12. 12
    Patel, M. C.; Shirey, K. A.; Pletneva, L. M.; Boukhvalova, M. S.; Garzino-Demo, A.; Vogel, S. N.; Blanco, J. C. G. Novel Drugs Targeting Toll-like Receptors for Antiviral Therapy. Future Virol. 2014, 9 (9), 811829,  DOI: 10.2217/fvl.14.70
  13. 13
    Devhare, P. B.; Chatterjee, S. N.; Arankalle, V. A.; Lole, K. S. Analysis of Antiviral Response in Human Epithelial Cells Infected with Hepatitis E Virus. PLoS One 2013, 8 (5), e63793,  DOI: 10.1371/journal.pone.0063793
  14. 14
    Martínez-Aguado, P.; Serna-Gallego, A.; Marrugal-Lorenzo, J. A.; Gómez-Marín, I.; Sánchez-Céspedes, J. Antiadenovirus Drug Discovery: Potential Targets and Evaluation Methodologies. Drug Discovery Today 2015, 20 (10), 12351242,  DOI: 10.1016/j.drudis.2015.07.007
  15. 15
    Ma, Z.; Cao, Q.; Xiong, Y.; Zhang, E.; Lu, M. Interaction between Hepatitis B Virus and Toll-like Receptors: Current Status and Potential Therapeutic Use for Chronic Hepatitis B. Vaccines 2018, 6 (1), 6,  DOI: 10.3390/vaccines6010006
  16. 16
    Du, K.; Liu, J.; Broering, R.; Zhang, X.; Yang, D.; Dittmer, U.; Lu, M. Recent Advances in the Discovery and Development of TLR Ligands as Novel Therapeutics for Chronic HBV and HIV Infections. Expert Opin. Drug Discovery 2018, 13 (7), 661670,  DOI: 10.1080/17460441.2018.1473372
  17. 17
    Jung, H. E.; Kim, T. H.; Lee, H. K. Contribution of Dendritic Cells in Protective Immunity against Respiratory Syncytial Virus Infection. Viruses 2020, 12 (1), 102,  DOI: 10.3390/v12010102
  18. 18
    Jin, M. S.; Kim, S. E.; Heo, J. Y.; Lee, M. E.; Kim, H. M.; Paik, S. G.; Lee, H.; Lee, J. O. Crystal Structure of the TLR1-TLR2 Heterodimer Induced by Binding of a Tri-Acylated Lipopeptide. Cell 2007, 130 (6), 10711082,  DOI: 10.1016/j.cell.2007.09.008
  19. 19
    Shukla, N. M.; Chan, M.; Hayashi, T.; Carson, D. A.; Cottam, H. B. Recent Advances and Perspectives in Small-Molecule TLR Ligands and Their Modulators. ACS Med. Chem. Lett. 2018, 9 (12), 11561159,  DOI: 10.1021/acsmedchemlett.8b00566
  20. 20
    Shah, M.; Anwar, M. A.; Kim, J. H.; Choi, S. Advances in Antiviral Therapies Targeting Toll-like Receptors. Expert Opin. Invest. Drugs 2016, 25 (4), 437453,  DOI: 10.1517/13543784.2016.1154040
  21. 21
    Zhu, G.; Xu, Y.; Cen, X.; Nandakumar, K. S.; Liu, S.; Cheng, K. Targeting Pattern-Recognition Receptors to Discover New Small Molecule Immune Modulators. Eur. J. Med. Chem. 2018, 144, 8292,  DOI: 10.1016/j.ejmech.2017.12.026
  22. 22
    Lucifora, J.; Bonnin, M.; Aillot, L.; Fusil, F.; Maadadi, S.; Dimier, L.; Michelet, M.; Floriot, O.; Ollivier, A.; Rivoire, M.; Ait-Goughoulte, M.; Daffis, S.; Fletcher, S. P.; Salvetti, A.; Cosset, F. L.; Zoulim, F.; Durantel, D. Direct Antiviral Properties of TLR Ligands against HBV Replication in Immune-Competent Hepatocytes. Sci. Rep. 2018, 8 (1), 111,  DOI: 10.1038/s41598-018-23525-w
  23. 23
    Kim, W. J.; Choi, J. W.; Jang, W. J.; Kang, Y. S.; Lee, C. W.; Synytsya, A.; Park, Y. Il. Low-Molecular Weight Mannogalactofucans Prevent Herpes Simplex Virus Type 1 Infection via Activation of Toll-like Receptor 2. Int. J. Biol. Macromol. 2017, 103, 286293,  DOI: 10.1016/j.ijbiomac.2017.05.060
  24. 24
    Santone, M.; Aprea, S.; Wu, T. Y. H.; Cooke, M. P.; Mbow, M. L.; Valiante, N. M.; Rush, J. S.; Dougan, S.; Avalos, A.; Ploegh, H.; De Gregorio, E.; Buonsanti, C.; D’Oro, U. A New TLR2 Agonist Promotes Cross-Presentation by Mouse and Human Antigen Presenting Cells. Hum. Vaccines Immunother. 2015, 11 (8), 20382050,  DOI: 10.1080/21645515.2015.1027467
  25. 25
    Arora, S.; Ahmad, S.; Irshad, R.; Goyal, Y.; Rafat, S.; Siddiqui, N.; Dev, K.; Husain, M.; Ali, S.; Mohan, A.; Syed, M. A. TLRs in Pulmonary Diseases. Life Sci. 2019, 233, 116671,  DOI: 10.1016/j.lfs.2019.116671
  26. 26
    West, J. A.; Gregory, S. M.; Damania, B. Toll-like Receptor Sensing of Human Herpesvirus Infection. Front. Cell. Infect. Microbiol. 2012, 2, 122,  DOI: 10.3389/fcimb.2012.00122
  27. 27
    Li, Y.; Qu, C.; Yu, P.; Ou, X.; Pan, Q.; Wang, W. The Interplay between Host Innate Immunity and Hepatitis E Virus. Viruses 2019, 11 (6), 541,  DOI: 10.3390/v11060541
  28. 28
    Said, E. A.; Tremblay, N.; Al-Balushi, M. S.; Al-Jabri, A. A.; Lamarre, D. Viruses Seen by Our Cells: The Role of Viral RNA Sensors. J. Immunol. Res. 2018, 2018, 9480497,  DOI: 10.1155/2018/9480497
  29. 29
    Verma, R.; Bharti, K. Toll like Receptor 3 and Viral Infections of Nervous System. J. Neurol. Sci. 2017, 372, 4048,  DOI: 10.1016/j.jns.2016.11.034
  30. 30
    Lee, I.; Bos, S.; Li, G.; Wang, S.; Gadea, G.; Desprès, P.; Zhao, R. Y. Probing Molecular Insights into Zika Virus–Host Interactions. Viruses 2018, 10 (5), 233,  DOI: 10.3390/v10050233
  31. 31
    Mukherjee, S.; Huda, S.; Sinha Babu, S. P. Toll-like Receptor Polymorphism in Host Immune Response to Infectious Diseases: A Review. Scand. J. Immunol. 2019, 90 (1), e12771,  DOI: 10.1111/sji.12771
  32. 32
    Gambuzza, M. E.; Soraci, L.; Sofo, V. A New Era for Immunotherapeutic Approaches in Multiple Sclerosis Treatment. J. Clin. Trials 2016, 6 (1), 1012,  DOI: 10.4172/2167-0870.1000253
  33. 33
    Piret, J.; Boivin, G. Innate Immune Response during Herpes Simplex Virus Encephalitis and Development of Immunomodulatory Strategies. Rev. Med. Virol. 2015, 25 (5), 300319,  DOI: 10.1002/rmv.1848
  34. 34
    Mousavi, T.; Sattari Saravi, S.; Valadan, R.; Haghshenas, M. R.; Rafiei, A.; Jafarpour, H.; Shamshirian, A. Different Types of Adjuvants in Prophylactic and Therapeutic Human Papillomavirus Vaccines in Laboratory Animals: A Systematic Review. Arch. Virol. 2020, 165 (2), 263284,  DOI: 10.1007/s00705-019-04479-4
  35. 35
    Bardel, E.; Doucet-Ladeveze, R.; Mathieu, C.; Harandi, A. M.; Dubois, B.; Kaiserlian, D. Intradermal Immunisation Using the TLR3-Ligand Poly (I:C) as Adjuvant Induces Mucosal Antibody Responses and Protects against Genital HSV-2 Infection. npj Vaccines 2016, 1, 16010,  DOI: 10.1038/npjvaccines.2016.10
  36. 36
    Saxena, M.; Sabado, R. L.; La Mar, M.; Mohri, H.; Salazar, A. M.; Dong, H.; Correa Da Rosa, J.; Markowitz, M.; Bhardwaj, N.; Miller, E. Poly-ICLC, a TLR3 Agonist, Induces Transient Innate Immune Responses in Patients with Treated HIV-Infection: A Randomized Double-Blinded Placebo Controlled Trial. Front. Immunol. 2019, 10, 725,  DOI: 10.3389/fimmu.2019.00725
  37. 37
    Zhang, Y.; Zhang, S.; Li, W.; Hu, Y.; Zhao, J.; Liu, F.; Lin, H.; Liu, Y.; Wang, L.; Xu, S.; Hu, R.; Shao, H.; Li, L. A Novel Rabies Vaccine Based-on Toll-like Receptor 3 (TLR3) Agonist PIKA Adjuvant Exhibiting Excellent Safety and Efficacy in Animal Studies. Virology 2016, 489, 165172,  DOI: 10.1016/j.virol.2015.10.029
  38. 38
    Guo, F.; Mead, J.; Aliya, N.; Wang, L.; Cuconati, A.; Wei, L.; Li, K.; Block, T. M.; Guo, J. T.; Chang, J. RO 90–7501 Enhances TLR3 and RLR Agonist Induced Antiviral Response. PLoS One 2012, 7 (10), e42583,  DOI: 10.1371/journal.pone.0042583
  39. 39
    Peri, F.; Calabrese, V. Toll-like Receptor 4 (TLR4) Modulation by Synthetic and Natural Compounds: An Update. J. Med. Chem. 2014, 57 (9), 36123622,  DOI: 10.1021/jm401006s
  40. 40
    Olejnik, J.; Hume, A. J.; Mühlberger, E. Toll-like Receptor 4 in Acute Viral Infection: Too Much of a Good Thing. PLoS Pathog. 2018, 14 (12), e1007390,  DOI: 10.1371/journal.ppat.1007390
  41. 41
    Abouelasrar Salama, S.; Lavie, M.; De Buck, M.; Van Damme, J.; Struyf, S. Cytokines and Serum Amyloid A in the Pathogenesis of Hepatitis C Virus Infection. Cytokine Growth Factor Rev. 2019, 50, 2942,  DOI: 10.1016/j.cytogfr.2019.10.006
  42. 42
    Hendrickx, R.; Stichling, N.; Koelen, J.; Kuryk, L.; Lipiec, A.; Greber, U. F. Innate Immunity to Adenovirus. Hum. Gene Ther. 2014, 25 (4), 265284,  DOI: 10.1089/hum.2014.001
  43. 43
    Chen, K. R.; Ling, P. Interplays between Enterovirus A71 and the Innate Immune System. J. Biomed. Sci. 2019, 26 (1), 95,  DOI: 10.1186/s12929-019-0596-8
  44. 44
    Bahramabadi, R.; Dabiri, S.; Iranpour, M.; Kazemi Arababadi, M. TLR4: An Important Molecule Participating in Either Anti-Human Papillomavirus Immune Responses or Development of Its Related Cancers. Viral Immunol. 2019, 32 (10), 417423,  DOI: 10.1089/vim.2019.0061
  45. 45
    Tantawy, E. A.; El-Beyali, A. A.; Gohar, M. K.; Ibrahim, Z. S.; Nasr, M.; Marei, A. Association of TLR2 and TLR4 Gene Polymorphism with Susceptibility to Wart Infections and Their Response to Candida Antigen Immunotherapy. J. Dermatol. Treat. 2020,  DOI: 10.1080/09546634.2020.1732285
  46. 46
    Vasou, A.; Sultanoglu, N.; Goodbourn, S.; Randall, R. E.; Kostrikis, L. G. Targeting Pattern Recognition Receptors (PRR) for Vaccine Adjuvantation: From Synthetic PRR Agonists to the Potential of Defective Interfering Particles of Viruses. Viruses 2017, 9 (7), 186,  DOI: 10.3390/v9070186
  47. 47
    Chan, M.; Hayashi, T.; Mathewson, R. D.; Nour, A.; Hayashi, Y.; Yao, S.; Tawatao, R. I.; Crain, B.; Tsigelny, I. F.; Kouznetsova, V. L.; Messer, K.; Pu, M.; Corr, M.; Carson, D. A.; Cottam, H. B. Identification of Substituted Pyrimido[5,4-b]Indoles as Selective Toll-like Receptor 4 Ligands. J. Med. Chem. 2013, 56 (11), 42064223,  DOI: 10.1021/jm301694x
  48. 48
    Hayashi, T.; Crain, B.; Yao, S.; Caneda, C. D.; Cottam, H. B.; Chan, M.; Corr, M.; Carson, D. A. Novel Synthetic Toll-Like Receptor 4/MD2 Ligands Attenuate Sterile Inflammation. J. Pharmacol. Exp. Ther. 2014, 350 (2), 330340,  DOI: 10.1124/jpet.114.214312
  49. 49
    Goff, P. H.; Hayashi, T.; Martínez-Gil, L.; Corr, M.; Crain, B.; Yao, S.; Cottam, H. B.; Chan, M.; Ramos, I.; Eggink, D.; Heshmati, M.; Krammer, F.; Messer, K.; Pu, M.; Fernandez-Sesma, A.; Palese, P.; Carson, D. A. Synthetic Toll-Like Receptor 4 (TLR4) and TLR7 Ligands as Influenza Virus Vaccine Adjuvants Induce Rapid, Sustained, and Broadly Protective Responses. J. Virol. 2015, 89 (6), 32213235,  DOI: 10.1128/JVI.03337-14
  50. 50
    Rodríguez-Valentín, M.; López, S.; Rivera, M.; Ríos-Olivares, E.; Cubano, L.; Boukli, N. M. Naturally Derived Anti-HIV Polysaccharide Peptide (PSP) Triggers a Toll-like Receptor 4-Dependent Antiviral Immune Response. J. Immunol. Res. 2018, 2018, 8741698,  DOI: 10.1155/2018/8741698
  51. 51
    Li, M.; Jiang, Y.; Gong, T.; Zhang, Z.; Sun, X. Intranasal Vaccination against HIV-1 with Adenoviral Vector-Based Nanocomplex Using Synthetic TLR-4 Agonist Peptide as Adjuvant. Mol. Pharmaceutics 2016, 13 (3), 885894,  DOI: 10.1021/acs.molpharmaceut.5b00802
  52. 52
    Abdul-Careem, M. F.; Firoz Mian, M.; Gillgrass, A. E.; Chenoweth, M. J.; Barra, N. G.; Chan, T.; Al-Garawi, A. A.; Chew, M. V.; Yue, G.; van Roojen, N.; Xing, Z.; Ashkar, A. A. FimH, a TLR4 Ligand, Induces Innate Antiviral Responses in the Lung Leading to Protection against Lethal Influenza Infection in Mice. Antiviral Res. 2011, 92 (2), 346355,  DOI: 10.1016/j.antiviral.2011.09.004
  53. 53
    Fan, X.; Yue, Y.; Xiong, S. Incorporation of a Bi-Functional Protein FimH Enhances the Immunoprotection of Chitosan-PVP1 Vaccine against Coxsackievirus B3-Induced Myocarditis. Antiviral Res. 2017, 140, 121132,  DOI: 10.1016/j.antiviral.2017.01.020
  54. 54
    Salyer, A. C. D.; Caruso, G.; Khetani, K. K.; Fox, L. M.; Malladi, S. S.; David, S. A. Identification of Adjuvantic Activity of Amphotericin B in a Novel, Multiplexed, Poly-TLR/NLR High-Throughput Screen. PLoS One 2016, 11 (2), e0149848,  DOI: 10.1371/journal.pone.0149848
  55. 55
    Shirey, K. A.; Lai, W.; Scott, A. J.; Lipsky, M.; Mistry, P.; Pletneva, L. M.; Karp, C. L.; McAlees, J.; Gioannini, T. L.; Weiss, J.; Chen, W. H.; Ernst, R. K.; Rossignol, D. P.; Gusovsky, F.; Blanco, J. C. G.; Vogel, S. N. The TLR4 Antagonist Eritoran Protects Mice from Lethal Influenza Infection. Nature 2013, 497 (7450), 498502,  DOI: 10.1038/nature12118
  56. 56
    Prantner, D.; Shirey, K. A.; Lai, W.; Lu, W.; Cole, A. M.; Vogel, S. N.; Garzino-Demo, A. The θ-Defensin Retrocyclin 101 Inhibits TLR4- and TLR2-Dependent Signaling and Protects Mice against Influenza Infection. J. Leukocyte Biol. 2017, 102 (4), 11031113,  DOI: 10.1189/jlb.2A1215-567RR
  57. 57
    Hossain, M. S.; Ramachandiran, S.; Gewirtz, A. T.; Waller, E. K. Recombinant TLR5 Agonist CBLB502 Promotes NK Cell-Mediated Anti-CMV Immunity in Mice. PLoS One 2014, 9 (5), e96165,  DOI: 10.1371/journal.pone.0096165
  58. 58
    Jahanban-Esfahlan, R.; Seidi, K.; Majidinia, M.; Karimian, A.; Yousefi, B.; Nabavi, S. M.; Astani, A.; Berindan-Neagoe, I.; Gulei, D.; Fallarino, F.; Gargaro, M.; Manni, G.; Pirro, M.; Xu, S.; Sadeghi, M.; Nabavi, S. F.; Shirooie, S. Toll-like Receptors as Novel Therapeutic Targets for Herpes Simplex Virus Infection. Rev. Med. Virol. 2019, 29 (4), e2048,  DOI: 10.1002/rmv.2048
  59. 59
    Pickens, J. A.; Tripp, R. A. Verdinexor Targeting of CRM1 Is a Promising Therapeutic Approach against RSV and Influenza Viruses. Viruses 2018, 10 (1), 48,  DOI: 10.3390/v10010048
  60. 60
    Matz, K. M.; Guzman, R. M.; Goodman, A. G. The Role of Nucleic Acid Sensing in Controlling Microbial and Autoimmune Disorders. In International Review of Cell and Molecular Biology, Vol. 345; Elsevier, 2019; Chapter 2, pp 35136,  DOI: 10.1016/bs.ircmb.2018.08.002 .
  61. 61
    Uppal, T.; Sarkar, R.; Dhelaria, R.; Verma, S. C. Role of Pattern Recognition Receptors in KSHV Infection. Cancers 2018, 10 (3), 85,  DOI: 10.3390/cancers10030085
  62. 62
    Guo, H. Y.; Zhang, X. C.; Jia, R. Y. Toll-like Receptors and RIG-I-like Receptors Play Important Roles in Resisting Flavivirus. J. Immunol. Res. 2018, 2018, 6106582,  DOI: 10.1155/2018/6106582
  63. 63
    Macedo, A. B.; Novis, C. L.; Bosque, A. Targeting Cellular and Tissue HIV Reservoirs With Toll-Like Receptor Agonists. Front. Immunol. 2019, 10, 2450,  DOI: 10.3389/fimmu.2019.02450
  64. 64
    Das, D.; Sengupta, I.; Sarkar, N.; Pal, A.; Saha, D.; Bandopadhyay, M.; Das, C.; Narayan, J.; Singh, S. P.; Chakrabarti, S.; Chakravarty, R. Anti-Hepatitis B Virus (HBV) Response of Imiquimod Based Toll like Receptor 7 Ligand in Hbv-Positive Human Hepatocelluar Carcinoma Cell Line. BMC Infect. Dis. 2017, 17 (1), 112,  DOI: 10.1186/s12879-017-2189-z
  65. 65
    Lebold, K. M.; Jacoby, D. B.; Drake, M. G. Toll-Like Receptor 7-Targeted Therapy in Respiratory Disease. Transfus. Med. Hemotherapy 2016, 43 (2), 114119,  DOI: 10.1159/000445324
  66. 66
    Vanwalscappel, B.; Tada, T.; Landau, N. R. Toll-like Receptor Agonist R848 Blocks Zika Virus Replication by Inducing the Antiviral Protein Viperin. Virology 2018, 522, 199208,  DOI: 10.1016/j.virol.2018.07.014
  67. 67
    Sui, Y.; Berzofsky, J. A. Myeloid Cell-Mediated Trained Innate Immunity in Mucosal AIDS Vaccine Development. Front. Immunol. 2020, 11, 315,  DOI: 10.3389/fimmu.2020.00315
  68. 68
    Miller, S. M.; Cybulski, V.; Whitacre, M.; Bess, L. S.; Livesay, M. T.; Walsh, L.; Burkhart, D.; Bazin, H. G.; Evans, J. T. Novel Lipidated Imidazoquinoline TLR7/8 Adjuvants Elicit Influenza-Specific Th1 Immune Responses and Protect Against Heterologous H3N2 Influenza Challenge in Mice. Front. Immunol. 2020, 11, 406,  DOI: 10.3389/fimmu.2020.00406
  69. 69
    Macedo, A. B.; Novis, C. L.; De Assis, C. M.; Sorensen, E. S.; Moszczynski, P.; Huang, S. H.; Ren, Y.; Spivak, A. M.; Jones, R. B.; Planelles, V.; Bosque, A. Dual TLR2 and TLR7 Agonists as HIV Latency-Reversing Agents. JCI insight 2018, 3 (19), e122673,  DOI: 10.1172/jci.insight.122673
  70. 70
    Hu, Y.; Tang, L.; Zhu, Z.; Meng, H.; Chen, T.; Zhao, S.; Jin, Z.; Wang, Z.; Jin, G. A Novel TLR7 Agonist as Adjuvant to Stimulate High Quality HBsAg-Specific Immune Responses in an HBV Mouse Model. J. Transl. Med. 2020, 18 (1), 112,  DOI: 10.1186/s12967-020-02275-2
  71. 71
    Chan, M.; Hayashi, T.; Kuy, C. S.; Gray, C. S.; Wu, C. C. N.; Corr, M.; Wrasidlo, W.; Cottam, H. B.; Carson, D. A. Synthesis and Immunological Characterization of Toll-Like Receptor 7 Agonistic Conjugates. Bioconjugate Chem. 2009, 20 (6), 11941200,  DOI: 10.1021/bc900054q
  72. 72
    McGowan, D.; Herschke, F.; Pauwels, F.; Stoops, B.; Last, S.; Pieters, S.; Scholliers, A.; Thoné, T.; Van Schoubroeck, B.; De Pooter, D.; Mostmans, W.; Khamlichi, M. D.; Embrechts, W.; Dhuyvetter, D.; Smyej, I.; Arnoult, E.; Demin, S.; Borghys, H.; Fanning, G.; Vlach, J.; Raboisson, P. Novel Pyrimidine Toll-like Receptor 7 and 8 Dual Agonists to Treat Hepatitis B Virus. J. Med. Chem. 2016, 59 (17), 79367949,  DOI: 10.1021/acs.jmedchem.6b00747
  73. 73
    Embrechts, W.; Herschke, F.; Pauwels, F.; Stoops, B.; Last, S.; Pieters, S.; Pande, V.; Pille, G.; Amssoms, K.; Smyej, I.; Dhuyvetter, D.; Scholliers, A.; Mostmans, W.; Van Dijck, K.; Van Schoubroeck, B.; Thone, T.; De Pooter, D.; Fanning, G.; Jonckers, T. H. M.; Horton, H.; Raboisson, P.; McGowan, D. 2,4-Diaminoquinazolines as Dual Toll-like Receptor (TLR) 7/8 Modulators for the Treatment of Hepatitis B Virus. J. Med. Chem. 2018, 61 (14), 62366246,  DOI: 10.1021/acs.jmedchem.8b00643
  74. 74
    McGowan, D. C.; Herschke, F.; Pauwels, F.; Stoops, B.; Smyej, I.; Last, S.; Pieters, S.; Embrechts, W.; Khamlichi, M. D.; Thoné, T.; Van Schoubroeck, B.; Mostmans, W.; Wuyts, D.; Verstappen, D.; Scholliers, A.; De Pooter, D.; Dhuyvetter, D.; Borghys, H.; Tuefferd, M.; Arnoult, E.; Hong, J.; Fanning, G.; Bollekens, J.; Urmaliya, V.; Teisman, A.; Horton, H.; Jonckers, T. H. M.; Raboisson, P. Identification and Optimization of Pyrrolo[3,2-d]Pyrimidine Toll-like Receptor 7 (TLR7) Selective Agonists for the Treatment of Hepatitis B. J. Med. Chem. 2017, 60 (14), 61376151,  DOI: 10.1021/acs.jmedchem.7b00365
  75. 75
    Wang, H.-f.; Wang, S.-s.; Tang, Y.-J.; Chen, Y.; Zheng, M.; Tang, Y.-l.; Liang, X.-h. The Double-Edged Sword—How Human Papillomaviruses Interact with Immunity in Head and Neck Cancer. Front. Immunol. 2019, 10, 653,  DOI: 10.3389/fimmu.2019.00653
  76. 76
    Martinelli, E.; Cicala, C.; Van Ryk, D.; Goode, D. J.; Macleod, K.; Arthos, J.; Fauci, A. S. HIV-1 Gp120 Inhibits TLR9-Mediated Activation and IFN-α Secretion in Plasmacytoid Dendritic Cells. Proc. Natl. Acad. Sci. U. S. A. 2007, 104 (9), 33963401,  DOI: 10.1073/pnas.0611353104
  77. 77
    Kaminski, J. J.; Schattgen, S. A.; Tzeng, T.; Bode, C.; Klinman, D. M.; Fitzgerald, K. A. Synthetic Oligodeoxynucleotides Containing Suppressive TTAGGG Motifs Inhibit AIM2 Inflammasome Activation. J. Immunol. 2013, 191 (7), 38763883,  DOI: 10.4049/jimmunol.1300530
  78. 78
    Noh, J. Y.; Yoon, S. R.; Kim, T. D.; Choi, I.; Jung, H. Toll-Like Receptors in Natural Killer Cells and Their Application for Immunotherapy. J. Immunol. Res. 2020, 2020, 2045860,  DOI: 10.1155/2020/2045860
  79. 79
    Chen, L.; Yu, J. Modulation of Toll-like Receptor Signaling in Innate Immunity by Natural Products. Int. Immunopharmacol. 2016, 37, 6570,  DOI: 10.1016/j.intimp.2016.02.005
  80. 80
    Fraietta, J. A.; Mueller, Y. M.; Do, D. H.; Holmes, V. M.; Howett, M. K.; Lewis, M. G.; Boesteanu, A. C.; Alkan, S. S.; Katsikis, P. D. Phosphorothioate 2′ Deoxyribose Oligomers as Microbicides That Inhibit Human Immunodeficiency Virus Type 1 (HIV-1) Infection and Block Toll-like Receptor 7 (TLR7) and TLR9 Triggering by HIV-1. Antimicrob. Agents Chemother. 2010, 54 (10), 40644073,  DOI: 10.1128/AAC.00367-10
  81. 81
    Udgata, A.; Dolasia, K.; Ghosh, S.; Mukhopadhyay, S. Dribbling through the Host Defence: Targeting the TLRs by Pathogens. Crit. Rev. Microbiol. 2019, 45 (3), 354368,  DOI: 10.1080/1040841X.2019.1608904
  82. 82
    Oliveira-Nascimento, L.; Massari, P.; Wetzler, L. M. The Role of TLR2 in Infection and Immunity. Front. Immunol. 2012, 3, 117,  DOI: 10.3389/fimmu.2012.00079
  83. 83
    Vidya, M. K.; Kumar, V. G.; Sejian, V.; Bagath, M.; Krishnan, G.; Bhatta, R. Toll-like Receptors: Significance, Ligands, Signaling Pathways, and Functions in Mammals. Int. Rev. Immunol. 2018, 37 (1), 2036,  DOI: 10.1080/08830185.2017.1380200
  84. 84
    Fitzgerald, K. A.; Kagan, J. C. Toll-like Receptors and the Control of Immunity. Cell 2020, 180 (6), 10441066,  DOI: 10.1016/j.cell.2020.02.041
  85. 85
    Mifsud, E. J.; Tan, A. C. L.; Jackson, D. C. TLR Agonists as Modulators of the Innate Immune Response and Their Potential as Agents against Infectious Disease. Front. Immunol. 2014, 5, 79,  DOI: 10.3389/fimmu.2014.00079
  86. 86
    Salunke, D. B.; Connelly, S. W.; Shukla, N. M.; Hermanson, A. R.; Fox, L. M.; David, S. A. Design and Development of Stable, Water-Soluble, Human Toll-like Receptor 2 Specific Monoacyl Lipopeptides as Candidate Vaccine Adjuvants. J. Med. Chem. 2013, 56 (14), 58855900,  DOI: 10.1021/jm400620g
  87. 87
    Tan, A. C. L.; Deliyannis, G.; Bharadwaj, M.; Brown, L. E.; Zeng, W.; Jackson, D. C. The Design and Proof of Concept for a CD8+ T Cell-Based Vaccine Inducing Cross-Subtype Protection against Influenza A Virus. Immunol. Cell Biol. 2013, 91 (1), 96104,  DOI: 10.1038/icb.2012.54
  88. 88
    Mifsud, E. J.; Tan, A. C.; Short, K. R.; Brown, L. E.; Chua, B. Y.; Jackson, D. C. Reducing the Impact of Influenza-Associated Secondary Pneumococcal Infections. Immunol. Cell Biol. 2016, 94 (1), 101108,  DOI: 10.1038/icb.2015.71
  89. 89
    Wu, W.; Li, R.; Malladi, S. S.; Warshakoon, H. J.; Kimbrell, M. R.; Amolins, M. W.; Ukani, R.; Datta, A.; David, S. A. Structure-Activity Relationships in Toll-like Receptor-2 Agonistic Diacylthioglycerol Lipopeptides. J. Med. Chem. 2010, 53 (8), 31983213,  DOI: 10.1021/jm901839g
  90. 90
    Salunke, D. B.; Shukla, N. M.; Yoo, E.; Crall, B. M.; Balakrishna, R.; Malladi, S. S.; David, S. A. Structure-Activity Relationships in Human Toll-like Receptor 2-Specific Monoacyl Lipopeptides. J. Med. Chem. 2012, 55 (7), 33533363,  DOI: 10.1021/jm3000533
  91. 91
    Steinhagen, F.; Kinjo, T.; Bode, C.; Klinman, D. M. TLR-Based Immune Adjuvants. Vaccine 2011, 29 (17), 33413355,  DOI: 10.1016/j.vaccine.2010.08.002
  92. 92
    Luo, Y.; Friese, O. V.; Runnels, H. A.; Khandke, L.; Zlotnick, G.; Aulabaugh, A.; Gore, T.; Vidunas, E.; Raso, S. W.; Novikova, E.; Byrne, E.; Schlittler, M.; Stano, D.; Dufield, R. L.; Kumar, S.; Anderson, A. S.; Jansen, K. U.; Rouse, J. C. The Dual Role of Lipids of the Lipoproteins in Trumenba, a Self-Adjuvanting Vaccine Against Meningococcal Meningitis B Disease. AAPS J. 2016, 18 (6), 15621575,  DOI: 10.1208/s12248-016-9979-x
  93. 93
    Seib, K. L.; Scarselli, M.; Comanducci, M.; Toneatto, D.; Masignani, V. Neisseria Meningitidis Factor H-Binding Protein FHbp: Key Virulence Factor and Vaccine Antigen. Expert Rev. Vaccines 2015, 14 (6), 841859,  DOI: 10.1586/14760584.2015.1016915
  94. 94
    Murgueitio, M. S.; Rakers, C.; Frank, A.; Wolber, G. Balancing Inflammation: Computational Design of Small-Molecule Toll-like Receptor Modulators. Trends Pharmacol. Sci. 2017, 38 (2), 155168,  DOI: 10.1016/j.tips.2016.10.007
  95. 95
    Cheng, K.; Gao, M.; Godfroy, J. I.; Brown, P. N.; Kastelowitz, N.; Yin, H. Specific Activation of the TLR1-TLR2 Heterodimer by Small-Molecule Agonists. Sci. Adv. 2015, 1 (3), e1400139,  DOI: 10.1126/sciadv.1400139
  96. 96
    Botos, I.; Segal, D. M.; Davies, D. R. The Structural Biology of Toll-like Receptors. Structure 2011, 19 (4), 447459,  DOI: 10.1016/j.str.2011.02.004
  97. 97
    Hu, Z.; Banothu, J.; Beesu, M.; Gustafson, C. J.; Brush, M. J. H.; Trautman, K. L.; Salyer, A. C. D.; Pathakumari, B.; David, S. A. Identification of Human Toll-like Receptor 2 - Agonistic Activity in Dihydropyridine – Quinolone Carboxamides. ACS Med. Chem. Lett. 2019, 10, 132136,  DOI: 10.1021/acsmedchemlett.8b00540
  98. 98
    Ribes, S.; Adam, N.; Ebert, S.; Regen, T.; Bunkowski, S.; Hanisch, U. K.; Nau, R. The Viral TLR3 Agonist Poly(I:C) Stimulates Phagocytosis and Intracellular Killing of Escherichia Coli by Microglial Cells. Neurosci. Lett. 2010, 482 (1), 1720,  DOI: 10.1016/j.neulet.2010.06.078
  99. 99
    Molteni, M.; Gemma, S.; Rossetti, C. The Role of Toll-Like Receptor 4 in Infectious and Noninfectious Inflammation. Mediators Inflammation 2016, 2016, 6978936,  DOI: 10.1155/2016/6978936
  100. 100
    Kumar, S.; Sunagar, R.; Gosselin, E. Bacterial Protein Toll-like-Receptor Agonists: A Novel Perspective on Vaccine Adjuvants. Front. Immunol. 2019, 10, 1144,  DOI: 10.3389/fimmu.2019.01144
  101. 101
    Needham, B. D.; Trent, M. S. Fortifying the Barrier: The Impact of Lipid A Remodelling on Bacterial Pathogenesis. Nat. Rev. Microbiol. 2013, 11, 467481,  DOI: 10.1038/nrmicro3047
  102. 102
    Fensterheim, B. A.; Young, J. D.; Luan, L.; Kleinbard, R. R.; Stothers, C. L.; Patil, N. K.; Mcatee-pereira, A. G.; Guo, Y.; Trenary, I.; Hernandez, A.; Fults, J. B.; Williams, D. L.; Sherwood, E. R.; Bohannon, J. K. The TLR4 Agonist Monophosphoryl Lipid A Drives Broad Resistance to Infection via Dynamic Reprogramming of Macrophage Metabolism. J. Immunol. 2018, 200, 37773789,  DOI: 10.4049/jimmunol.1800085
  103. 103
    Bowen, W. S.; Minns, L. A.; Johnson, D. A.; Mitchell, T. C.; Hutton, M. M.; Evans, J. T. Selective TRIF-Dependent Signaling by a Synthetic Toll-Like Receptor 4 Agonist. Sci. Signaling 2012, 5 (211), ra13,  DOI: 10.1126/scisignal.2001963
  104. 104
    Garcia, M. M.; Goicoechea, C.; Molina-Álvarez, M.; Pascual, D. Toll-like Receptor 4: A Promising Crossroads in the Diagnosis and Treatment of Several Pathologies. Eur. J. Pharmacol. 2020, 874, 172975,  DOI: 10.1016/j.ejphar.2020.172975
  105. 105
    Yang, J.; Yan, H. TLR5: Beyond the Recognition of Flagellin. Cell. Mol. Immunol. 2017, 14, 10171019,  DOI: 10.1038/cmi.2017.122
  106. 106
    Song, W. S.; Jeon, Y. J.; Namgung, B.; Hong, M.; Yoon, S. Il. A Conserved TLR5 Binding and Activation Hot Spot on Flagellin. Sci. Rep. 2017, 7, 40878,  DOI: 10.1038/srep40878
  107. 107
    Taylor, D. N.; Treanor, J. J.; Strout, C.; Johnson, C.; Fitzgerald, T.; Kavita, U.; Ozer, K.; Tussey, L.; Shaw, A. Induction of a Potent Immune Response in the Elderly Using the TLR-5 Agonist, Flagellin, with a Recombinant Hemagglutinin Influenza-Flagellin Fusion Vaccine (VAX125, STF2.HA1 SI). Vaccine 2011, 29 (31), 48974902,  DOI: 10.1016/j.vaccine.2011.05.001
  108. 108
    Yan, L.; Liang, J.; Yao, C.; Wu, P.; Zeng, X.; Cheng, K.; Yin, H. Pyrimidine Triazole Thioether Derivatives as Toll-Like Receptor 5 (TLR5)/Flagellin Complex Inhibitors. ChemMedChem 2016, 11 (8), 822826,  DOI: 10.1002/cmdc.201500471
  109. 109
    Kauppila, J. H.; Mattila, A. E.; Karttunen, T. J.; Salo, T. Toll-like Receptor 5 and the Emerging Role of Bacteria in Carcinogenesis. Oncoimmunology 2013, 2 (4), e23620,  DOI: 10.4161/onci.23620
  110. 110
    Yazar, V.; Kilic, G.; Bulut, O.; Canavar Yildirim, T.; Yagci, F. C; Aykut, G.; Klinman, D. M; Gursel, M.; Gursel, I. A Suppressive Oligodeoxynucleotide Expressing TTAGGG Motifs Modulates Cellular Energetics through the MTOR Signaling Pathway. Int. Immunol. 2020, 32 (1), 3948,  DOI: 10.1093/intimm/dxz059
  111. 111
    Relitti, N.; Saraswati, A. P.; Federico, S.; Khan, T.; Brindisi, M.; Zisterer, D.; Brogi, S.; Gemma, S.; Butini, S.; Campiani, G. Telomerase-Based Cancer Therapeutics: A Review on Their Clinical Trials. Curr. Top. Med. Chem. 2020, 20 (6), 433457,  DOI: 10.2174/1568026620666200102104930
  112. 112
    Saraswati, A. P.; Relitti, N.; Brindisi, M.; Gemma, S.; Zisterer, D.; Butini, S.; Campiani, G. Raising the Bar in Anticancer Therapy: Recent Advances in, and Perspectives on, Telomerase Inhibitors. Drug Discovery Today 2019, 24 (7), 13701388,  DOI: 10.1016/j.drudis.2019.05.015
  113. 113
    Golenkina, E. A.; Viryasova, G. M.; Dolinnaya, N. G.; Bannikova, V. A.; Gaponova, T. V.; Romanova, Y. M.; Sud'ina, G. F. The Potential of Telomeric G-Quadruplexes Containing Modified Oligoguanosine Overhangs in Activation of Bacterial Phagocytosis and Leukotriene Synthesis in Human Neutrophils. Biomolecules 2020, 10, 249,  DOI: 10.3390/biom10020249
  114. 114
    Yeh, D.-W.; Lai, C.-Y.; Liu, Y.-L.; Lu, C.-H.; Tseng, P.-H.; Yuh, C.-H.; Yu, G.-Y.; Liu, S.-J.; Leng, C.-H.; Chuang, T.-H. CpG-Oligodeoxynucleotides Developed for Grouper Toll-like Receptor (TLR) 21s Effectively Activate Mouse and Human TLR9s Mediated Immune Responses. Sci. Rep. 2017, 7, 17297,  DOI: 10.1038/s41598-017-17609-2
  115. 115
    Mohamed, W.; Domann, E.; Chakraborty, T.; Mannala, G.; Lips, K. S.; Heiss, C.; Schnettler, R.; Alt, V. TLR9Mediates S. Aureus Killing inside Osteoblasts via Induction of Oxidative Stress. BMC Microbiol. 2016, 16, 230,  DOI: 10.1186/s12866-016-0855-8
  116. 116
    Kim, T. H.; Kim, D.; Lee, H.; Kwak, M. H.; Park, S.; Lee, Y.; Kwon, H. J. CpG-DNA Induces Bacteria-Reactive IgM Enhancing Phagocytic Activity against Staphylococcus Aureus Infection. BMB Rep. 2019, 52 (11), 635640,  DOI: 10.5483/BMBRep.2019.52.11.018
  117. 117
    Duggan, J. M.; You, D.; Cleaver, J. O.; Larson, D. T.; Garza, R. J.; Guzmán Pruneda, F. A.; Tuvim, M. J.; Zhang, J.; Dickey, B. F.; Evans, S. E. Synergistic Interactions of TLR2/6 and TLR9 Induce a High Level of Resistance to Lung Infection in Mice. J. Immunol. 2011, 186 (10), 59165926,  DOI: 10.4049/jimmunol.1002122
  118. 118
    Savva, A.; Roger, T. TargetingToll-like Receptors : Promising Therapeutic Strategies for the Management of Sepsis-Associated Pathology and Infectious Diseases. Front. Immunol. 2013, 4, 387,  DOI: 10.3389/fimmu.2013.00387
  119. 119
    Kuzmich, N. N.; Sivak, K. V.; Chubarev, V. N.; Porozov, Y. B.; Savateeva-lyubimova, T. N.; Peri, F. TLR4 Signaling Pathway Modulators as Potential Therapeutics in Inflammation and Sepsis. Vaccines 2017, 5, 34,  DOI: 10.3390/vaccines5040034
  120. 120
    Steinhagen, F.; Schmidt, S. V.; Schewe, J.; Peukert, K.; Klinman, D. M.; Bode, C. Immunotherapy in Sepsis - Brake or Accelerate?. Pharmacol. Ther. 2020, 208, 107476,  DOI: 10.1016/j.pharmthera.2020.107476
  121. 121
    Chavez, S. A.; Martinko, A. J.; Lau, C.; Pham, M. N.; Cheng, K.; Bevan, D. E.; Mollnes, T. E.; Yin, H. Development of β -Amino Alcohol Derivatives That Inhibit Toll-like Receptor 4 Mediated Inflammatory Response as Potential Antiseptics. J. Med. Chem. 2011, 54, 46594669,  DOI: 10.1021/jm2003365
  122. 122
    Cighetti, R.; Ciaramelli, C.; Sestito, E.; Zanoni, I.; Kubik, Ł.; Arda-Freire, A.; Calabrese, V.; Granucci, F.; Jerala, R.; Martín-Santamaría, S.; Jimenez-Barbero, J.; Peri, F. Modulation of CD14 and TLR4 · MD-2 Activities by a Synthetic Lipid A Mimetic. ChemBioChem 2014, 15, 250258,  DOI: 10.1002/cbic.201300588
  123. 123
    Zaffaroni, L.; Peri, F. Recent Advances on Toll-like Receptor 4 Modulation: New Therapeutic Perspectives. Future Med. Chem. 2018, 10 (4), 461476,  DOI: 10.4155/fmc-2017-0172
  124. 124
    Liang, Q.; Wu, Q.; Jiang, J.; Duan, J.; Wang, C.; Smith, M. D.; Lu, H.; Wang, Q.; Nagarkatti, P.; Fan, D. Characterization of Sparstolonin B, a Chinese Herb-Derived Compound, as a Selective Toll-like Receptor Antagonist with Potent Anti-Inflammatory Properties. J. Biol. Chem. 2011, 286 (30), 2647026479,  DOI: 10.1074/jbc.M111.227934
  125. 125
    Pollock, J. A.; Sharma, N.; Ippagunta, S. K.; Redecke, V.; Häcker, H.; Katzenellenbogen, J. A. Triaryl Pyrazole Toll-Like Receptor Signaling Inhibitors: Structure–Activity Relationships Governing Pan- and Selective Signaling Inhibitors. ChemMedChem 2018, 13 (20), 22082216,  DOI: 10.1002/cmdc.201800417
  126. 126
    Paul, B.; Rahaman, O.; Roy, S.; Pal, S.; Satish, S.; Mukherjee, A.; Ghosh, A. R.; Raychaudhuri, D.; Bhattacharya, R.; Goon, S.; Ganguly, D.; Talukdar, A. Activity-Guided Development of Potent and Selective Toll-like Receptor 9 Antagonists. Eur. J. Med. Chem. 2018, 159, 187205,  DOI: 10.1016/j.ejmech.2018.09.058
  127. 127
    D’Alessandro, S.; Alfano, G.; Di Cerbo, L.; Brogi, S.; Chemi, G.; Relitti, N.; Brindisi, M.; Lamponi, S.; Novellino, E.; Campiani, G.; Gemma, S.; Basilico, N.; Taramelli, D.; Baratto, M. C.; Pogni, R.; Butini, S. Bridged Bicyclic 2,3-Dioxabicyclo[3.3.1]Nonanes as Antiplasmodial Agents: Synthesis, Structure-Activity Relationships and Studies on Their Biomimetic Reaction with Fe(II). Bioorg. Chem. 2019, 89, 103020,  DOI: 10.1016/j.bioorg.2019.103020
  128. 128
    Kalantari, P. The Emerging Role of Pattern Recognition Receptors in the Pathogenesis of Malaria. Vaccines 2018, 6, 13,  DOI: 10.3390/vaccines6010013
  129. 129
    Eriksson, E. M.; Sampaio, N. G.; Schofield, L. Toll-Like Receptors and Malaria – Sensing and Susceptibility. J. Trop. Dis. 2014, 2 (1), 17,  DOI: 10.4172/2329-891X.1000126
  130. 130
    Ernest, M.; Hunja, C.; Arakura, Y.; Haraga, Y.; Abkallo, H. M.; Zeng, W.; Jackson, D. C.; Chua, B.; Culleton, R. The Toll-Like Receptor 2 Agonist PEG-Pam2Cys as an Immunochemoprophylactic and Immunochemotherapeutic against the Liver and Transmission Stages of Malaria Parasites. Int. J. Parasitol.: Drugs Drug Resist. 2018, 8 (3), 451458,  DOI: 10.1016/j.ijpddr.2018.10.006
  131. 131
    Kaur, A.; Kannan, D.; Mehta, S. K.; Singh, S.; Salunke, D. B. Synthetic Toll-like Receptor Agonists for the Development of Powerful Malaria Vaccines: A Patent Review. Expert Opin. Ther. Pat. 2018, 28 (11), 837847,  DOI: 10.1080/13543776.2018.1530217
  132. 132
    Coban, C.; Horii, T.; Akira, S.; Ishii, K. J. TLR9 and Endogenous Adjuvants of the Whole Blood-Stage Malaria Vaccine. Expert Rev. Vaccines 2010, 9 (7), 775784,  DOI: 10.1586/erv.10.60
  133. 133
    Battista, T.; Colotti, G.; Ilari, A.; Fiorillo, A. Targeting Trypanothione Reductase, a Key Enzyme in the Redox Trypanosomatid Metabolism, to Develop New Drugs against Leishmaniasis and Trypanosomiases. Molecules 2020, 25 (8), 1924,  DOI: 10.3390/molecules25081924
  134. 134
    Gemma, S.; Federico, S.; Brogi, S.; Brindisi, M.; Butini, S.; Campiani, G. Dealing with Schistosomiasis: Current Drug Discovery Strategies. Annu. Rep. Med. Chem. 2019, 53, 107138,  DOI: 10.1016/bs.armc.2019.06.002
  135. 135
    Fouzder, C.; Mukhuty, A.; Das, S.; Chattopadhyay, D. TLR Signaling on Protozoan and Helminthic Parasite Infection. IntechOpen 2020, 120,  DOI: 10.5772/intechopen.84711
  136. 136
    Mukherjee, S.; Karmakar, S.; Babu, S. P. S. TLR2 and TLR4Mediated Host Immune Responses in Major Infectious Diseases: A Review. Braz. J. Infect. Dis. 2016, 20 (2), 193204,  DOI: 10.1016/j.bjid.2015.10.011
  137. 137
    Wang, X.; Dong, L.; Ni, H.; Zhou, S.; Xu, Z.; Hoellwarth, J. S.; Chen, X.; Zhang, R.; Chen, Q.; Liu, F.; Wang, J.; Su, C. Combined TLR7/8 and TLR9 Ligands Potentiate the Activity of a Schistosoma Japonicum DNA Vaccine. PLoS Neglected Trop. Dis. 2013, 7 (4), e2164,  DOI: 10.1371/journal.pntd.0002164
  138. 138
    Bourgeois, C.; Kuchler, K. Fungal Pathogens-a Sweet and Sour Treat for Toll-like Receptors. Front. Cell. Infect. Microbiol. 2012, 2, 142,  DOI: 10.3389/fcimb.2012.00142
  139. 139
    Patin, E. C.; Thompson, A.; Orr, S. J. Pattern Recognition Receptors in Fungal Immunity. Semin. Cell Dev. Biol. 2019, 89, 2433,  DOI: 10.1016/j.semcdb.2018.03.003
  140. 140
    Martínez, A.; Bono, C.; Megías, J.; Yáñez, A.; Gozalbo, D.; Gil, M. L. Systemic Candidiasis and TLR2 Agonist Exposure Impact the Antifungal Response of Hematopoietic Stem and Progenitor Cells. Front. Cell. Infect. Microbiol. 2018, 8, 309,  DOI: 10.3389/fcimb.2018.00309
  141. 141
    Redlich, S.; Ribes, S.; Schütze, S.; Eiffert, H.; Nau, R. Toll-like Receptor Stimulation Increases Phagocytosis of Cryptococcus Neoformans by Microglial Cells. J. Neuroinflammation 2013, 10, 841,  DOI: 10.1186/1742-2094-10-71
  142. 142
    Oh, H. M.; Lee, S. W.; Park, M. H.; Kim, M. H.; Ryu, Y. B.; Kim, M. S.; Kim, H. H.; Park, K. H.; Lee, W. S.; Park, S. J.; Rho, M. C. Norkurarinol Inhibits Toll-Like Receptor 3 (TLR3)-Mediated pro-Inflammatory Signaling Pathway and Rotavirus Replication. J. Pharmacol. Sci. 2012, 118 (2), 161170,  DOI: 10.1254/jphs.11077FP
  143. 143
    Engelmann, C.; Sheikh, M.; Sharma, S.; Kondo, T.; Loeffler-Wirth, H.; Zheng, Y. B.; Novelli, S.; Hall, A.; Kerbert, A. J. C.; Macnaughtan, J.; Mookerjee, R.; Habtesion, A.; Davies, N.; Ali, T.; Gupta, S.; Andreola, F.; Jalan, R. Toll-like Receptor 4 Is a Therapeutic Target for Prevention and Treatment of Liver Failure. J. Hepatol. 2020, 73 (1), 102112,  DOI: 10.1016/j.jhep.2020.01.011
  144. 144
    Papaioannou, A. I.; Spathis, A.; Kostikas, K.; Karakitsos, P.; Papiris, S.; Rossios, C. The Role of Endosomal Toll-like Receptors in Asthma. Eur. J. Pharmacol. 2017, 808 (September), 1420,  DOI: 10.1016/j.ejphar.2016.09.033
  145. 145
    Kim, J.; Durai, P.; Jeon, D.; Jung, I. D.; Lee, S. J.; Park, Y. M.; Kim, Y. Phloretin as a Potent Natural TLR2/1 Inhibitor Suppresses TLR2-Induced Inflammation. Nutrients 2018, 10 (7), 868,  DOI: 10.3390/nu10070868
  146. 146
    Fußbroich, D.; Schubert, R.; Schneider, P.; Zielen, S.; Beermann, C. Impact of Soyasaponin I on TLR2 and TLR4 Induced Inflammation in the MUTZ-3-Cell Model. Food Funct. 2015, 6 (3), 10011010,  DOI: 10.1039/C4FO01065E
  147. 147
    Lim, H. J.; Jang, H.-J.; Kim, M. H.; Lee, S.; Lee, S. W.; Lee, S.-J.; Rho, M.-C. Oleanolic Acid Acetate Exerts Anti-Inflammatory Activity via IKKα/β Suppression in TLR3-Mediated NF-KB Activation. Molecules 2019, 24 (21), 4002,  DOI: 10.3390/molecules24214002
  148. 148
    Okada, T.; Kawakita, F.; Nishikawa, H.; Nakano, F.; Liu, L.; Suzuki, H. Selective Toll-Like Receptor 4 Antagonists Prevent Acute Blood-Brain Barrier Disruption After Subarachnoid Hemorrhage in Mice. Mol. Neurobiol. 2019, 56 (2), 976985,  DOI: 10.1007/s12035-018-1145-2
  149. 149
    Plunk, M. A.; Alaniz, A.; Olademehin, O. P.; Ellington, T. L.; Shuford, K. L.; Kane, R. R. Design and Catalyzed Activation of Tak-242 Prodrugs for Localized Inhibition of TLR4-Induced Inflammation. ACS Med. Chem. Lett. 2020, 11 (2), 141146,  DOI: 10.1021/acsmedchemlett.9b00518
  150. 150
    Facchini, F. A.; Zaffaroni, L.; Minotti, A.; Rapisarda, S.; Calabrese, V.; Forcella, M.; Fusi, P.; Airoldi, C.; Ciaramelli, C.; Billod, J. M.; Schromm, A. B.; Braun, H.; Palmer, C.; Beyaert, R.; Lapenta, F.; Jerala, R.; Pirianov, G.; Martin-Santamaria, S.; Peri, F. Structure-Activity Relationship in Monosaccharide-Based Toll-like Receptor 4 (TLR4) Antagonists. J. Med. Chem. 2018, 61 (7), 28952909,  DOI: 10.1021/acs.jmedchem.7b01803
  151. 151
    Fernández, G.; Moraga, A.; Cuartero, M. I.; García-Culebras, A.; Peña-Martínez, C.; Pradillo, J. M.; Hernández-Jiménez, M.; Sacristán, S.; Ayuso, M. I.; Gonzalo-Gobernado, R.; Fernández-López, D.; Martín, M. E.; Moro, M. A.; González, V. M.; Lizasoain, I. TLR4-Binding DNA Aptamers Show a Protective Effect against Acute Stroke in Animal Models. Mol. Ther. 2018, 26 (8), 20472059,  DOI: 10.1016/j.ymthe.2018.05.019
  152. 152
    Flacher, V.; Neuberg, P.; Point, F.; Daubeuf, F.; Muller, Q.; Sigwalt, D.; Fauny, J. D.; Remy, J. S.; Frossard, N.; Wagner, A.; Mueller, C. G.; Schaeffer, E. Mannoside Glycolipid Conjugates Display Anti-Inflammatory Activity by Inhibition of Toll-like Receptor-4 Mediated Cell Activation. ACS Chem. Biol. 2015, 10 (12), 26972705,  DOI: 10.1021/acschembio.5b00552
  153. 153
    Lu, M. Y.; Chen, C. C.; Lee, L. Y.; Lin, T. W.; Kuo, C. F. N6-(2-Hydroxyethyl)Adenosine in the Medicinal Mushroom Cordyceps Cicadae Attenuates Lipopolysaccharide-Stimulated Pro-Inflammatory Responses by Suppressing TLR4-Mediated NF-KB Signaling Pathways. J. Nat. Prod. 2015, 78 (10), 24522460,  DOI: 10.1021/acs.jnatprod.5b00573
  154. 154
    Li, S.; Gao, X.; Wu, X.; Wu, Z.; Cheng, L.; Zhu, L.; Shen, D.; Tong, X. Parthenolide Inhibits LPS-Induced Inflammatory Cytokines through the Toll-like Receptor 4 Signal Pathway in THP-1 Cells. Acta Biochim. Biophys. Sin. 2015, 47 (5), 368375,  DOI: 10.1093/abbs/gmv019
  155. 155
    Ye, S.; Zheng, Q.; Zhou, Y.; Bai, B.; Yang, D.; Zhao, Z. Chlojaponilactone B Attenuates Lipopolysaccharide-Induced Inflammatory Responses by Suppressing TLR4-Mediated ROS Generation and NF-KB Signaling Pathway. Molecules 2019, 24 (20), 3731,  DOI: 10.3390/molecules24203731
  156. 156
    He, J.; Han, S.; Li, X. X.; Wang, Q. Q.; Cui, Y.; Chen, Y.; Gao, H.; Huang, L.; Yang, S. Diethyl Blechnic Exhibits Anti-Inflammatory and Antioxidative Activity via the TLR4/MyD88 Signaling Pathway in LPS-Stimulated RAW264.7 Cells. Molecules 2019, 24 (24), 4502,  DOI: 10.3390/molecules24244502
  157. 157
    Thakur, V. R.; Beladiya, J. V.; Chaudagar, K. K.; Mehta, A. A. An Anti-Asthmatic Activity of Natural Toll-like Receptor-4 Antagonist in OVA-LPS-Induced Asthmatic Rats. Clin. Exp. Pharmacol. Physiol. 2018, 45 (11), 11871197,  DOI: 10.1111/1440-1681.13002
  158. 158
    Sun, H.; Zhu, X.; Cai, W.; Qiu, L. Hypaphorine Attenuates Lipopolysaccharide-Induced Endothelial Inflammation via Regulation of TLR4 and PPAR-γ Dependent on PI3K/Akt/MTOR Signal Pathway. Int. J. Mol. Sci. 2017, 18 (4), 844,  DOI: 10.3390/ijms18040844
  159. 159
    Malgorzata-Miller, G.; Heinbockel, L.; Brandenburg, K.; Van Der Meer, J. W. M.; Netea, M. G.; Joosten, L. A. B. Bartonella Quintana Lipopolysaccharide (LPS): Structure and Characteristics of a Potent TLR4 Antagonist for in-Vitro and in-Vivo Applications. Sci. Rep. 2016, 6, 34221,  DOI: 10.1038/srep34221
  160. 160
    Shih, T. L.; Liu, M. H.; Li, C. W.; Kuo, C. F. Halo-Substituted Chalcones and Azachalcones-Inhibited, Lipopolysaccharited-Stimulated, pro-Inflammatory Responses through the TLR4-Mediated Pathway. Molecules 2018, 23 (3), 597,  DOI: 10.3390/molecules23030597
  161. 161
    Guo, X. Y.; Cao, Q. Y.; Tang, Y. M.; Liang, Q. L. Simple Synthesis and Anti-Inflammatory Activities of Spanrstolonin B Derivatives. Phytochem. Lett. 2018, 24, 158162,  DOI: 10.1016/j.phytol.2018.02.011
  162. 162
    Arora, S.; Ahmad, S.; Irshad, R.; Goyal, Y.; Rafat, S.; Siddiqui, N.; Dev, K.; Husain, M.; Ali, S.; Mohan, A.; Syed, M. A. TLRs in Pulmonary Diseases. Life Sci. 2019, 233, 116671,  DOI: 10.1016/j.lfs.2019.116671
  163. 163
    Biggadike, K.; Ahmed, M.; Ball, D. I.; Coe, D. M.; Dalmas Wilk, D. A.; Edwards, C. D.; Gibbon, B. H.; Hardy, C. J.; Hermitage, S. A.; Hessey, J. O.; Hillegas, A. E.; Hughes, S. C.; Lazarides, L.; Lewell, X. Q.; Lucas, A.; Mallett, D. N.; Price, M. A.; Priest, F. M.; Quint, D. J.; Shah, P.; Sitaram, A.; Smith, S. A.; Stocker, R.; Trivedi, N. A.; Tsitoura, D. C.; Weller, V. Discovery of 6-Amino-2-{[(1S)-1-Methylbutyl]Oxy}-9-[5-(1-Piperidinyl)Pentyl]-7,9-Dihydro-8H-Purin-8-One (GSK2245035), a Highly Potent and Selective Intranasal Toll-Like Receptor 7 Agonist for the Treatment of Asthma. J. Med. Chem. 2016, 59 (5), 17111726,  DOI: 10.1021/acs.jmedchem.5b01647
  164. 164
    Yoo, E.; Crall, B. M.; Balakrishna, R.; Malladi, S. S.; Fox, L. M.; Hermanson, A. R.; David, S. A. Structure-Activity Relationships in Toll-like Receptor 7 Agonistic 1H-Imidazo[4,5-c]Pyridines. Org. Biomol. Chem. 2013, 11 (38), 65266545,  DOI: 10.1039/c3ob40816g
  165. 165
    Beesu, M.; Caruso, G.; Salyer, A. C. D.; Shukla, N. M.; Khetani, K. K.; Smith, L. J.; Fox, L. M.; Tanji, H.; Ohto, U.; Shimizu, T.; David, S. A. Identification of a Human Toll-Like Receptor (TLR) 8-Specific Agonist and a Functional Pan-TLR Inhibitor in 2-Aminoimidazoles. J. Med. Chem. 2016, 59 (7), 33113330,  DOI: 10.1021/acs.jmedchem.6b00023
  166. 166
    Beesu, M.; Salyer, A. C. D.; Trautman, K. L.; Hill, J. K.; David, S. A. Human Toll-like Receptor (TLR) 8-Specific Agonistic Activity in Substituted Pyrimidine-2,4-Diamines. J. Med. Chem. 2016, 59 (17), 80828093,  DOI: 10.1021/acs.jmedchem.6b00872
  167. 167
    Jiang, S.; Tanji, H.; Yin, K.; Zhang, S.; Sakaniwa, K.; Huang, J.; Yang, Y.; Li, J.; Ohto, U.; Shimizu, T.; Yin, H. Rationally Designed Small-Molecule Inhibitors Targeting an Unconventional Pocket on the TLR8 Protein–Protein Interface. J. Med. Chem. 2020, 63 (8), 41174132,  DOI: 10.1021/acs.jmedchem.9b02128
  168. 168
    Cheng, B.; Yuan, W. E.; Su, J.; Liu, Y.; Chen, J. Recent Advances in Small Molecule Based Cancer Immunotherapy. Eur. J. Med. Chem. 2018, 157, 582598,  DOI: 10.1016/j.ejmech.2018.08.028
  169. 169
    Basith, S.; Manavalan, B.; Yoo, T. H.; Kim, S. G.; Choi, S. Roles of Toll-like Receptors in Cancer: A Double-Edged Sword for Defense and Offense. Arch. Pharmacal Res. 2012, 35 (8), 12971316,  DOI: 10.1007/s12272-012-0802-7
  170. 170
    Hennessy, E. J.; Parker, A. E.; O’Neill, L. A. J. Targeting Toll-like Receptors: Emerging Therapeutics?. Nat. Rev. Drug Discovery 2010, 9 (4), 293307,  DOI: 10.1038/nrd3203
  171. 171
    Pradere, J. P.; Dapito, D. H.; Schwabe, R. F. The Yin and Yang of Toll-like Receptors in Cancer. Oncogene 2014, 33 (27), 34853495,  DOI: 10.1038/onc.2013.302
  172. 172
    Schmidt, J.; Welsch, T.; Jäger, D.; Mühlradt, P. F.; Büchler, M. W.; Märten, A. Intratumoural Injection of the Toll-like Receptor-2/6 Agonist ‘Macrophage-Activating Lipopeptide-2′ in Patients with Pancreatic Carcinoma: A Phase I/II Trial. Br. J. Cancer 2007, 97 (5), 598604,  DOI: 10.1038/sj.bjc.6603903
  173. 173
    Ingale, S.; Wolfert, M. A.; Buskas, T.; Boons, G. J. Increasing the Antigenicity of Synthetic Tumor-Associated Carbohydrate Antigens by Targeting Toll-like Receptors. ChemBioChem 2009, 10 (3), 455463,  DOI: 10.1002/cbic.200800596
  174. 174
    Abdel-Aal, A. B. M.; Lakshminarayanan, V.; Thompson, P.; Supekar, N.; Bradley, J. M.; Wolfert, M. A.; Cohen, P. A.; Gendler, S. J.; Boons, G. J. Immune and Anticancer Responses Elicited by Fully Synthetic Aberrantly Glycosylated MUC1 Tripartite Vaccines Modified by a TLR2 or TLR9 Agonist. ChemBioChem 2014, 15 (10), 15081513,  DOI: 10.1002/cbic.201402077
  175. 175
    Shi, L.; Cai, H.; Huang, Z. H.; Sun, Z. Y.; Chen, Y. X.; Zhao, Y. F.; Kunz, H.; Li, Y. M. Synthetic MUC1 Antitumor Vaccine Candidates with Varied Glycosylation Pattern Bearing R/S-Configured Pam3CysSerLys4. ChemBioChem 2016, 17, 14121415,  DOI: 10.1002/cbic.201600206
  176. 176
    Willems, M. M. J. H. P.; Zom, G. G.; Khan, S.; Meeuwenoord, N.; Melief, C. J. M.; Van Der Stelt, M.; Overkleeft, H. S.; Codée, J. D. C.; Van Der Marel, G. A.; Ossendorp, F.; Filippov, D. V. N-Tetradecylcarbamyl Lipopeptides as Novel Agonists for Toll-like Receptor 2. J. Med. Chem. 2014, 57 (15), 68736878,  DOI: 10.1021/jm500722p
  177. 177
    Zom, G. G.; Willems, M. M. J. H. P.; Khan, S.; Van Der Sluis, T. C.; Kleinovink, J. W.; Camps, M. G. M.; Van Der Marel, G. A.; Filippov, D. V.; Melief, C. J. M.; Ossendorp, F. Novel TLR2-Binding Adjuvant Induces Enhanced T Cell Responses and Tumor Eradication. J. Immunother. Cancer 2018, 6, 146,  DOI: 10.1186/s40425-018-0455-2
  178. 178
    Huynh, A. S.; Chung, W. J.; Cho, H. Il; Moberg, V. E.; Celis, E.; Morse, D. L.; Vagner, J. Novel Toll-like Receptor 2 Ligands for Targeted Pancreatic Cancer Imaging and Immunotherapy. J. Med. Chem. 2012, 55 (22), 97519762,  DOI: 10.1021/jm301002f
  179. 179
    Bowdish, D. M. E.; Sakamoto, K.; Kim, M.-J.; Kroos, M.; Mukhopadhyay, S.; Leifer, C. A.; Tryggvason, K.; Gordon, S.; Russell, D. G. MARCO, TLR2, and CD14 Are Required for Macrophage Cytokine Responses to Mycobacterial Trehalose Dimycolate and Mycobacterium Tuberculosis. PLoS Pathog. 2009, 5 (6), e1000474,  DOI: 10.1371/journal.ppat.1000474
  180. 180
    Yamamoto, H.; Oda, M.; Nakano, M.; Watanabe, N.; Yabiku, K.; Shibutani, M.; Inoue, M.; Imagawa, H.; Nagahama, M.; Himeno, S.; Setsu, K.; Sakurai, J.; Nishizawa, M. Development of Vizantin, a Safe Immunostimulant, Based on the Structure-Activity Relationship of Trehalose-6,6′-Dicorynomycolate. J. Med. Chem. 2013, 56 (1), 381385,  DOI: 10.1021/jm3016443
  181. 181
    Morin, M. D.; Wang, Y.; Jones, B. T.; Mifune, Y.; Su, L.; Shi, H.; Moresco, E. M. Y.; Zhang, H.; Beutler, B.; Boger, D. L. Diprovocims: A New and Exceptionally Potent Class of Toll-like Receptor Agonists. J. Am. Chem. Soc. 2018, 140 (43), 1444014454,  DOI: 10.1021/jacs.8b09223
  182. 182
    Wang, Y.; Su, L.; Morin, M. D.; Jones, B. T.; Mifune, Y.; Shi, H.; Wang, K.-w.; Zhan, X.; Liu, A.; Wang, J.; Li, X.; Tang, M.; Ludwig, S.; Hildebrand, S.; Zhou, K.; Siegwart, D. J.; Moresco, E. M. Y.; Zhang, H.; Boger, D. L.; Beutler, B. Adjuvant Effect of the Novel TLR1/TLR2 Agonist Diprovocim Synergizes with Anti–PD-L1 to Eliminate Melanoma in Mice. Proc. Natl. Acad. Sci. U. S. A. 2018, 115 (37), E8698E8706,  DOI: 10.1073/pnas.1809232115
  183. 183
    Su, L.; Wang, Y.; Wang, J.; Mifune, Y.; Morin, M. D.; Jones, B. T.; Moresco, E. M. Y.; Boger, D. L.; Beutler, B.; Zhang, H. Structural Basis of TLR2/TLR1 Activation by the Synthetic Agonist Diprovocim. J. Med. Chem. 2019, 62 (6), 29382949,  DOI: 10.1021/acs.jmedchem.8b01583
  184. 184
    Cen, X.; Zhu, G.; Yang, J.; Yang, J.; Guo, J.; Jin, J.; Nandakumar, K. S.; Yang, W.; Yin, H.; Liu, S.; Cheng, K. TLR1/2 Specific Small-Molecule Agonist Suppresses Leukemia Cancer Cell Growth by Stimulating Cytotoxic T Lymphocytes. Adv. Sci. 2019, 6 (10), 1802042,  DOI: 10.1002/advs.201802042
  185. 185
    Chen, Z.; Cen, X.; Yang, J.; Tang, X.; Cui, K.; Cheng, K. Structure-Based Discovery of a Specific TLR1-TLR2 Small Molecule Agonist from the ZINC Drug Library Database. Chem. Commun. 2018, 54 (81), 1141111414,  DOI: 10.1039/C8CC06618C
  186. 186
    Kitada, S.; Leone, M.; Sareth, S.; Zhai, D.; Reed, J. C.; Pellecchia, M. Discovery, Characterization, and Structure - Activity Relationships Studies of Proapoptotic Polyphenols Targeting B-Cell Lymphocyte/Leukemia-2 Proteins. J. Med. Chem. 2003, 46 (20), 42594264,  DOI: 10.1021/jm030190z
  187. 187
    Cheng, K.; Wang, X.; Zhang, S.; Yin, H. Discovery of Small-Molecule Inhibitors of the TLR1/TLR2 Complex. Angew. Chem., Int. Ed. 2012, 51 (49), 1224612249,  DOI: 10.1002/anie.201204910
  188. 188
    Xu, Y. Y.; Chen, L.; Zhou, I. M.; Wu, Y. Y.; Zhu, Y. Y. Inhibitory Effect of DsRNA TLR3 Agonist in a Rat Hepatocellular Carcinoma Model. Mol. Med. Rep. 2013, 8 (4), 10371042,  DOI: 10.3892/mmr.2013.1646
  189. 189
    Basith, S.; Manavalan, B.; Lee, G.; Kim, S. G.; Choi, S. Toll-like Receptor Modulators: A Patent Review (2006 - 2010). Expert Opin. Ther. Pat. 2011, 21 (6), 927944,  DOI: 10.1517/13543776.2011.569494
  190. 190
    Matsumoto, M.; Takeda, Y.; Seya, T. Targeting Toll-like Receptor 3 in Dendritic Cells for Cancer Immunotherapy. Expert Opin. Biol. Ther. 2020, 20 (8), 937946,  DOI: 10.1080/14712598.2020.1749260
  191. 191
    Seya, T.; Takeda, Y.; Matsumoto, M. A Toll-like Receptor 3 (TLR3) Agonist ARNAX for Therapeutic Immunotherapy. Adv. Drug Delivery Rev. 2019, 147, 3743,  DOI: 10.1016/j.addr.2019.07.008
  192. 192
    Wang, Y.; Tu, Q.; Yan, W.; Xiao, D.; Zeng, Z.; Ouyang, Y.; Huang, L.; Cai, J.; Zeng, X.; Chen, Y. J.; Liu, A. CXC195 Suppresses Proliferation and Inflammatory Response in LPS-Induced Human Hepatocellular Carcinoma Cells via Regulating TLR4-MyD88-TAK1-Mediated NF-KB and MAPK Pathway. Biochem. Biophys. Res. Commun. 2015, 456 (1), 373379,  DOI: 10.1016/j.bbrc.2014.11.090
  193. 193
    Liu, H.; Zhang, G.; Huang, J.; Ma, S.; Mi, K.; Cheng, J.; Zhu, Y.; Zha, X.; Huang, W. Atractylenolide I Modulates Ovarian Cancer Cell-Mediated Immunosuppression by Blocking MD-2/TLR4 Complex-Mediated MyD88/NF-KB Signaling in Vitro. J. Transl. Med. 2016, 14 (1), 415,  DOI: 10.1186/s12967-016-0845-5
  194. 194
    Zandi, Z.; Kashani, B.; Poursani, E. M.; Bashash, D.; Kabuli, M.; Momeny, M.; Mousavi-pak, S. H.; Sheikhsaran, F.; Alimoghaddam, K.; Mousavi, S. A.; Ghaffari, S. H. TLR4 Blockade Using TAK-242 Suppresses Ovarian and Breast Cancer Cells Invasion through the Inhibition of Extracellular Matrix Degradation and Epithelial-Mesenchymal Transition. Eur. J. Pharmacol. 2019, 853, 256263,  DOI: 10.1016/j.ejphar.2019.03.046
  195. 195
    Kashani, B.; Zandi, Z.; Karimzadeh, M. R.; Bashash, D.; Nasrollahzadeh, A.; Ghaffari, S. H. Blockade of TLR4 Using TAK-242 (Resatorvid) Enhances Anti-Cancer Effects of Chemotherapeutic Agents: A Novel Synergistic Approach for Breast and Ovarian Cancers. Immunol. Res. 2019, 67 (6), 505516,  DOI: 10.1007/s12026-019-09113-8
  196. 196
    Kashani, B.; Zandi, Z.; Bashash, D.; Zaghal, A.; Momeny, M.; Poursani, E. M.; Pourbagheri-Sigaroodi, A.; Mousavi, S. A.; Ghaffari, S. H. Small Molecule Inhibitor of TLR4 Inhibits Ovarian Cancer Cell Proliferation: New Insight into the Anticancer Effect of TAK-242 (Resatorvid). Cancer Chemother. Pharmacol. 2020, 85 (1), 4759,  DOI: 10.1007/s00280-019-03988-y
  197. 197
    Premkumar, V.; Dey, M.; Dorn, R.; Raskin, I. MyD88-Dependent and Independent Pathways of Toll-Like Receptors Are Engaged in Biological Activity of Triptolide in Ligand-Stimulated Macrophages. BMC Chem. Biol. 2010, 10, 3,  DOI: 10.1186/1472-6769-10-3
  198. 198
    Ma, J. X.; Sun, Y. L.; Yu, Y.; Zhang, J.; Wu, H. Y.; Yu, X. F. Triptolide Enhances the Sensitivity of Pancreatic Cancer PANC-1 Cells to Gemcitabine by Inhibiting TLR4/NF-KB Signaling. Am. J. Transl. Res. 2019, 11 (6), 37503760
  199. 199
    Zhou, J.; Liu, Q.; Qian, R.; Liu, S.; Hu, W.; Liu, Z. Paeonol Antagonizes Oncogenesis of Osteosarcoma by Inhibiting the Function of TLR4/MAPK/NF-KB Pathway. Acta Histochem. 2020, 122 (1), 151455,  DOI: 10.1016/j.acthis.2019.151455
  200. 200
    Wu, H. C.; Ge, H. M.; Zang, L. Y.; Bei, Y. C.; Niu, Z. Y.; Wei, W.; Feng, X. J.; Ding, S.; Ng, S. W.; Shen, P. P.; Tan, R. X. Diaporine, a Novel Endophyte-Derived Regulator of Macrophage Differentiation. Org. Biomol. Chem. 2014, 12 (34), 65456548,  DOI: 10.1039/C4OB01123F
  201. 201
    Zhuang, H.; Dai, X.; Zhang, X.; Mao, Z.; Huang, H. Sophoridine Suppresses Macrophage-Mediated Immunosuppression through TLR4/IRF3 Pathway and Subsequently Upregulates CD8+ T Cytotoxic Function against Gastric Cancer. Biomed. Pharmacother. 2020, 121, 109636,  DOI: 10.1016/j.biopha.2019.109636
  202. 202
    Xie, X.; Ma, L.; Zhou, Y.; Shen, W.; Xu, D.; Dou, J.; Shen, B.; Zhou, C. Polysaccharide Enhanced NK Cell Cytotoxicity against Pancreatic Cancer via TLR4/MAPKs/NF-KB Pathway in Vitro/Vivo. Carbohydr. Polym. 2019, 225, 115223,  DOI: 10.1016/j.carbpol.2019.115223
  203. 203
    Xia, Y.; Wang, M.; Demaria, O.; Tang, J.; Rocchi, P.; Qu, F.; Iovanna, J. L.; Alexopoulou, L.; Peng, L. A Novel Bitriazolyl Acyclonucleoside Endowed with Dual Antiproliferative and Immunomodulatory Activity. J. Med. Chem. 2012, 55 (11), 56425646,  DOI: 10.1021/jm300534u
  204. 204
    Zhang, L.; Shi, L.; Soars, S. M.; Kamps, J.; Yin, H. Discovery of Novel Small-Molecule Inhibitors of NF-KB Signaling with Antiinflammatory and Anticancer Properties. J. Med. Chem. 2018, 61 (14), 58815899,  DOI: 10.1021/acs.jmedchem.7b01557
  205. 205
    Krieg, A. M. Toll-like Receptor 9 (TLR9) Agonists in the Treatment of Cancer. Oncogene 2008, 27 (2), 161167,  DOI: 10.1038/sj.onc.1210911
  206. 206
    Lim, K.-H. TLR9. Cancer Ther. Targets 2017, 1–2, 495502,  DOI: 10.1007/978-1-4419-0717-2_70
  207. 207
    Cho, H. C.; Kim, B. H.; Kim, K.; Park, J. Y.; Chang, J. H.; Kim, S. K. Cancer Immunotherapeutic Effects of Novel CpG ODN in Murine Tumor Model. Int. Immunopharmacol. 2008, 8 (10), 14011407,  DOI: 10.1016/j.intimp.2008.05.010
  208. 208
    Qi, X. F.; Zheng, L.; Kim, C. S.; Lee, K. J.; Kim, D. H.; Cai, D. Q.; Qin, J. W.; Yu, Y. H.; Wu, Z.; Kim, S. K. CpG Oligodeoxynucleotide Induces Apoptosis and Cell Cycle Arrest in A20 Lymphoma Cells via TLR9-Mediated Pathways. Mol. Immunol. 2013, 54 (3–4), 327337,  DOI: 10.1016/j.molimm.2013.01.001
  209. 209
    Zhang, Y.; Lin, A.; Zhang, C.; Tian, Z.; Zhang, J. Phosphorothioate-Modified CpG Oligodeoxynucleotide (CpG ODN) Induces Apoptosis of Human Hepatocellular Carcinoma Cells Independent of TLR9. Cancer Immunol. Immunother. 2014, 63 (4), 357367,  DOI: 10.1007/s00262-014-1518-y
  210. 210
    Yang, L.; Sun, L.; Wu, X.; Wang, L.; Wei, H.; Wan, M.; Zhang, P.; Yu, Y.; Wang, L. Therapeutic Injection of C-Class CpG ODN in Draining Lymph Node Area Induces Potent Activation of Immune Cells and Rejection of Established Breast Cancer in Mice. Clin. Immunol. 2009, 131 (3), 426437,  DOI: 10.1016/j.clim.2009.01.011
  211. 211
    Yang, M.; Yan, Y.; Fang, M.; Wan, M.; Wu, X.; Zhang, X.; Zhao, T.; Wei, H.; Song, D.; Wang, L.; Yu, Y. MF59 Formulated with CpG ODN as a Potent Adjuvant of Recombinant HSP65-MUC1 for Inducing Anti-MUC1 + Tumor Immunity in Mice. Int. Immunopharmacol. 2012, 13 (4), 408416,  DOI: 10.1016/j.intimp.2012.05.003
  212. 212
    Jordan, M.; Waxman, D. J. CpG-1826 Immunotherapy Potentiates Chemotherapeutic and Anti-Tumor Immune Responses to Metronomic Cyclophosphamide in a Preclinical Glioma Model. Cancer Lett. 2016, 373 (1), 8896,  DOI: 10.1016/j.canlet.2015.11.029
  213. 213
    Xu, A.; Zhang, L.; Yuan, J.; Babikr, F.; Freywald, A.; Chibbar, R.; Moser, M.; Zhang, W.; Zhang, B.; Fu, Z.; Xiang, J. TLR9 Agonist Enhances Radiofrequency Ablation-Induced CTL Responses, Leading to the Potent Inhibition of Primary Tumor Growth and Lung Metastasis. Cell. Mol. Immunol. 2019, 16 (10), 820832,  DOI: 10.1038/s41423-018-0184-y
  214. 214
    Babaer, D.; Amara, S.; McAdory, B. S.; Johnson, O.; Myles, E. L.; Zent, R.; Rathmell, J. C.; Tiriveedhi, V. Oligodeoxynucleotides ODN 2006 and M362 Exert Potent Adjuvant Effect through TLR-9/-6 Synergy to Exaggerate Mammaglobin-a Peptide Specific Cytotoxic CD8+T Lymphocyte Responses against Breast Cancer Cells. Cancers 2019, 11 (5), 672,  DOI: 10.3390/cancers11050672
  215. 215
    Kapp, K.; Volz, B.; Curran, M. A.; Oswald, D.; Wittig, B.; Schmidt, M. EnanDIM - a Novel Family of L-Nucleotide-Protected TLR9 Agonists for Cancer Immunotherapy. J. Immunother. Cancer 2019, 7, 5,  DOI: 10.1186/s40425-018-0470-3
  216. 216
    Jia, H.; Guo, J.; Wang, P.; Sun, K.; Chen, J.; Ren, W.; Wei, T.; Yang, Y.; Li, J.; Liu, X.; Li, R.; Zhong, J.; Wang, M.; Tian, Z.; Feng, Z.; Zhao, T. A Self-Designed CpG ODN Enhanced the Anti-Melanoma Effect of Pimozide. Int. Immunopharmacol. 2020, 83, 106397,  DOI: 10.1016/j.intimp.2020.106397
  217. 217
    Zhang, L.; Dewan, V.; Yin, H. Discovery of Small Molecules as Multi-Toll-like Receptor Agonists with Proinflammatory and Anticancer Activities. J. Med. Chem. 2017, 60 (12), 50295044,  DOI: 10.1021/acs.jmedchem.7b00419
  218. 218
    Davidson, A.; Diamond, B. Autoimmune Diseases. N. Engl. J. Med. 2001, 345 (5), 340350,  DOI: 10.1056/NEJM200108023450506
  219. 219
    Liu, Y.; Yin, H.; Zhao, M.; Lu, Q. TLR2 and TLR4 in Autoimmune Diseases: A Comprehensive Review. Clin. Rev. Allergy Immunol. 2014, 47 (2), 136147,  DOI: 10.1007/s12016-013-8402-y
  220. 220
    Joosten, L. A. B.; Abdollahi-Roodsaz, S.; Dinarello, C. A.; O’Neill, L.; Netea, M. G. Toll-like Receptors and Chronic Inflammation in Rheumatic Diseases: New Developments. Nat. Rev. Rheumatol. 2016, 12 (6), 344357,  DOI: 10.1038/nrrheum.2016.61
  221. 221
    Minagar, A. Multiple Sclerosis: An Overview of Clinical Features, Pathophysiology, Neuroimaging, and Treatment Options. Colloq. Ser. Integr. Syst. Physiol. From Mol. to Funct. 2014, 6, 1117,  DOI: 10.4199/C00116ED1V01Y201408ISP055
  222. 222
    Kumar, V. Toll-like Receptors in the Pathogenesis of Neuroinflammation. J. Neuroimmunol. 2019, 332, 1630,  DOI: 10.1016/j.jneuroim.2019.03.012
  223. 223
    Hansen, B. S.; Hussain, R. Z.; Lovett-Racke, A. E.; Thomas, J. A.; Racke, M. K. Multiple Toll-like Receptor Agonists Act as Potent Adjuvants in the Induction of Autoimmunity. J. Neuroimmunol. 2006, 172 (1–2), 94103,  DOI: 10.1016/j.jneuroim.2005.11.006
  224. 224
    Clements, M. TLR2 and TLR4 Cascade Involved in the Multifaceted Symptoms of Experimental Autoimmune Encephalomyelitis (EAE), a Model of Multiple Sclerosis, Thesis, University of Colorado at Boulder, Boulder, CO, 2019.
  225. 225
    Touil, T.; Fitzgerald, D.; Zhang, G.-X.; Rostami, A.; Gran, B. Cutting Edge: TLR3 Stimulation Suppresses Experimental Autoimmune Encephalomyelitis by Inducing Endogenous IFN-β. J. Immunol. 2006, 177 (11), 75057509,  DOI: 10.4049/jimmunol.177.11.7505
  226. 226
    Hirotani, M.; Niino, M.; Fukazawa, T.; Kikuchi, S.; Yabe, I.; Hamada, S.; Tajima, Y.; Sasaki, H. Decreased IL-10 Production Mediated by Toll-like Receptor 9 in B Cells in Multiple Sclerosis. J. Neuroimmunol. 2010, 221 (1–2), 95100,  DOI: 10.1016/j.jneuroim.2010.02.012
  227. 227
    Dishon, S.; Schumacher, A.; Fanous, J.; Talhami, A.; Kassis, I.; Karussis, D.; Gilon, C.; Hoffman, A.; Nussbaum, G. Development of a Novel Backbone Cyclic Peptide Inhibitor of the Innate Immune TLR/IL1R Signaling Protein MyD88. Sci. Rep. 2018, 8, 9476,  DOI: 10.1038/s41598-018-27773-8
  228. 228
    Hultqvist, M.; Nandakumar, K. S.; Björklund, U.; Holmdahl, R. The Novel Small Molecule Drug Rabeximod Is Effective in Reducing Disease Severity of Mouse Models of Autoimmune Disorders. Ann. Rheum. Dis. 2009, 68 (1), 130135,  DOI: 10.1136/ard.2007.085241
  229. 229
    Crowley, T.; Fitzpatrick, J. M.; Kuijper, T.; Cryan, J. F.; O’Toole, O.; O’Leary, O. F.; Downer, E. J. Modulation of TLR3/TLR4 Inflammatory Signaling by the GABAB Receptor Agonist Baclofen in Glia and Immune Cells: Relevance to Therapeutic Effects in Multiple Sclerosis. Front. Cell. Neurosci. 2015, 9, 284,  DOI: 10.3389/fncel.2015.00284
  230. 230
    Li, X.; Li, T. T.; Zhang, X. H.; Hou, L. F.; Yang, X. Q.; Zhu, F. H.; Tang, W.; Zuo, J. P. Artemisinin Analogue SM934 Ameliorates Murine Experimental Autoimmune Encephalomyelitis through Enhancing the Expansion and Functions of Regulatory T Cell. PLoS One 2013, 8 (8), e74108,  DOI: 10.1371/journal.pone.0074108
  231. 231
    Angelotti, F.; Parma, A.; Cafaro, G.; Capecchi, R.; Alunno, A.; Puxeddu, I. One Year in Review 2017: Pathogenesis of Rheumatoid Arthritis. Clin. Exp. Rheumatol. 2017, 35 (3), 368378
  232. 232
    McInnes, I. B.; Schett, G. The Pathogenesis of Rheumatoid Arthritis. N. Engl. J. Med. 2011, 365 (23), 22052219,  DOI: 10.1056/NEJMra1004965
  233. 233
    Seibl, R.; Birchler, T.; Loeliger, S.; Hossle, J. P.; Gay, R. E.; Saurenmann, T.; Michel, B. A.; Seger, R. A.; Gay, S.; Lauener, R. P. Expression and Regulation of Toll-like Receptor 2 in Rheumatoid Arthritis Synovium. Am. J. Pathol. 2003, 162 (4), 12211227,  DOI: 10.1016/S0002-9440(10)63918-1
  234. 234
    Huang, Q. Q.; Ma, Y.; Adebayo, A.; Pope, R. M. Increased Macrophage Activation Mediated through Toll-like Receptors in Rheumatoid Arthritis. Arthritis Rheum. 2007, 56 (7), 21922201,  DOI: 10.1002/art.22707
  235. 235
    Ospelt, C.; Brentano, F.; Rengel, Y.; Stanczyk, J.; Kolling, C.; Tak, P. P.; Gay, R. E.; Gay, S.; Kyburz, D. Overexpression of Toll-like Receptors 3 and 4 in Synovial Tissue from Patients with Early Rheumatoid Arthritis: Toll-like Receptor Expression in Early and Longstanding Arthritis. Arthritis Rheum. 2008, 58 (12), 36843692,  DOI: 10.1002/art.24140
  236. 236
    Roelofs, M. F.; Joosten, L. A. B.; Abdollahi-Roodsaz, S.; Van Lieshout, A. W. T.; Sprong, T.; Van Den Hoogen, F. H.; Van Den Berg, W. B.; Radstake, T. R. D. J. The Expression of Toll-like Receptors 3 and 7 in Rheumatoid Arthritis Synovium Is Increased and Costimulation of Toll-like Receptors 3, 4, and 7/8 Results in Synergistic Cytokine Production by Dendritic Cells. Arthritis Rheum. 2005, 52 (8), 23132322,  DOI: 10.1002/art.21278
  237. 237
    Hayashi, T.; Gray, C. S.; Chan, M.; Tawatao, R. I.; Ronacher, L.; McGargill, M. A.; Datta, S. K.; Carson, D. A.; Corr, M. Prevention of Autoimmune Disease by Induction of Tolerance to Toll-like Receptor 7. Proc. Natl. Acad. Sci. U. S. A. 2009, 106 (8), 27642769,  DOI: 10.1073/pnas.0813037106
  238. 238
    Sacre, S. M.; Lo, A.; Gregory, B.; Simmonds, R. E.; Williams, L.; Feldmann, M.; Brennan, F. M.; Foxwell, B. M. Inhibitors of TLR8 Reduce TNF Production from Human Rheumatoid Synovial Membrane Cultures. J. Immunol. 2008, 181 (11), 80028009,  DOI: 10.4049/jimmunol.181.11.8002
  239. 239
    Lacerte, P.; Brunet, A.; Egarnes, B.; Duchêne, B.; Brown, J. P.; Gosselin, J. Overexpression of TLR2 and TLR9 on Monocyte Subsets of Active Rheumatoid Arthritis Patients Contributes to Enhance Responsiveness to TLR Agonists. Arthritis Res. Ther. 2016, 18, 10,  DOI: 10.1186/s13075-015-0901-1
  240. 240
    Nic An Ultaigh, S.; Saber, T. P.; McCormick, J.; Connolly, M.; Dellacasagrande, J.; Keogh, B.; McCormack, W.; Reilly, M.; O’Neill, L. A.; McGuirk, P.; Fearon, U.; Veale, D. J. Blockade of Toll-like Receptor 2 Prevents Spontaneous Cytokine Release from Rheumatoid Arthritis Ex Vivo Synovial Explant Cultures. Arthritis Res. Ther. 2011, 13, R33,  DOI: 10.1186/ar3261
  241. 241
    Monnet, E.; Choy, E. H.; McInnes, I.; Kobakhidze, T.; De Graaf, K.; Jacqmin, P.; Lapeyre, G.; De Min, C. Efficacy and Safety of NI-0101, an Anti-Toll-like Receptor 4 Monoclonal Antibody, in Patients with Rheumatoid Arthritis after Inadequate Response to Methotrexate: A Phase II Study. Ann. Rheum. Dis. 2020, 79, 316323,  DOI: 10.1136/annrheumdis-2019-216487
  242. 242
    Monnet, E.; Shang, L.; Lapeyre, G.; DeGraaf, K.; Hatterer, E.; Buatois, V.; Elson, G.; Ferlin, W.; Gabay, C.; Sokolove, J.; Jones, S. A.; Choy, E. H.; McInnes, I. B.; Kosco-Vilbois, M.; de Min, C. AB0451 NI-0101, a Monoclonal Antibody Targeting Toll Like Receptor 4 (TLR4) Being Developed for Rheumatoid Arthritis (RA) Treatment with a Potential for Personalized Medicine. Ann. Rheum. Dis. 2015, 74, 1046,  DOI: 10.1136/annrheumdis-2015-eular.3801
  243. 243
    Park, S. J.; Lee, A. N.; Youn, H. S. TBK1-Targeted Suppression of TRIF-Dependent Signaling Pathway of Toll-like Receptor 3 by Auranofin. Arch. Pharmacal Res. 2010, 33 (6), 939945,  DOI: 10.1007/s12272-010-0618-2
  244. 244
    Hultqvist, M.; Nandakumar, K. S.; Björklund, U.; Holmdahl, R. Rabeximod Reduces Arthritis Severity in Mice by Decreasing Activation of Inflammatory Cells. Ann. Rheum. Dis. 2010, 69 (8), 15271532,  DOI: 10.1136/ard.2009.121178
  245. 245
    Samarpita, S.; Kim, J. Y.; Rasool, M. K.; Kim, K. S. Investigation of Toll-like Receptor (TLR) 4 Inhibitor TAK-242 as a New Potential Anti-Rheumatoid Arthritis Drug. Arthritis Res. Ther. 2020, 22, 16,  DOI: 10.1186/s13075-020-2097-2
  246. 246
    Danto, S. I.; Shojaee, N.; Singh, R. S. P.; Li, C.; Gilbert, S. A.; Manukyan, Z.; Kilty, I. Safety, Tolerability, Pharmacokinetics, and Pharmacodynamics of PF-06650833, a Selective Interleukin-1 Receptor-Associated Kinase 4 (IRAK4) Inhibitor, in Single and Multiple Ascending Dose Randomized Phase 1 Studies in Healthy Subjects. Arthritis Res. Ther. 2019, 21, 269,  DOI: 10.1186/s13075-019-2008-6
  247. 247
    Zhang, S.; Hu, Z.; Tanji, H.; Jiang, S.; Das, N.; Li, J.; Sakaniwa, K.; Jin, J.; Bian, Y.; Ohto, U.; Shimizu, T.; Yin, H. Small-Molecule Inhibition of TLR8 through Stabilization of Its Resting State. Nat. Chem. Biol. 2018, 14 (1), 5864,  DOI: 10.1038/nchembio.2518
  248. 248
    Schrezenmeier, E.; Dörner, T. Mechanisms of Action of Hydroxychloroquine and Chloroquine: Implications for Rheumatology. Nat. Rev. Rheumatol. 2020, 16 (3), 155166,  DOI: 10.1038/s41584-020-0372-x
  249. 249
    Crispín, J. C.; Liossis, S. N. C.; Kis-Toth, K.; Lieberman, L. A.; Kyttaris, V. C.; Juang, Y. T.; Tsokos, G. C. Pathogenesis of Human Systemic Lupus Erythematosus: Recent Advances. Trends Mol. Med. 2010, 16 (2), 4757,  DOI: 10.1016/j.molmed.2009.12.005
  250. 250
    Berden, J. H. M. Lupus Nephritis. Kidney Int. 1997, 52 (2), 538558,  DOI: 10.1038/ki.1997.365
  251. 251
    Kruse, K.; Janko, C.; Urbonaviciute, V.; Mierke, C. T.; Winkler, T. H.; Voll, R. E.; Schett, G.; Muñoz, L. E.; Herrmann, M. Inefficient Clearance of Dying Cells in Patients with SLE: Anti-DsDNA Autoantibodies, MFG-E8, HMGB-1 and Other Players. Apoptosis 2010, 15 (9), 10981113,  DOI: 10.1007/s10495-010-0478-8
  252. 252
    Lartigue, A.; Colliou, N.; Calbo, S.; François, A.; Jacquot, S.; Arnoult, C.; Tron, F.; Gilbert, D.; Musette, P. Critical Role of TLR2 and TLR4 in Autoantibody Production and Glomerulonephritis in Lpr Mutation-Induced Mouse Lupus. J. Immunol. 2009, 183 (10), 62076216,  DOI: 10.4049/jimmunol.0803219
  253. 253
    Liu, B.; Yang, Y.; Dai, J.; Medzhitov, R.; Freudenberg, M. A.; Zhang, P. L.; Li, Z. TLR4 Up-Regulation at Protein or Gene Level Is Pathogenic for Lupus-Like Autoimmune Disease. J. Immunol. 2006, 177 (10), 68806888,  DOI: 10.4049/jimmunol.177.10.6880
  254. 254
    Patole, P. S.; Gröne, H. J.; Segerer, S.; Ciubar, R.; Belemezova, E.; Henger, A.; Kretzler, M.; Schlöndorff, D.; Anders, H. J. Viral Double-Stranded RNA Aggravates Lupus Nephritis through Toll-like Receptor 3 on Glomerular Mesangial Cells and Antigen-Presenting Cells. J. Am. Soc. Nephrol. 2005, 16 (5), 13261338,  DOI: 10.1681/ASN.2004100820
  255. 255
    Kono, D. H.; Haraldsson, M. K.; Lawson, B. R.; Pollard, K. M.; Koh, Y. T.; Du, X.; Arnold, C. N.; Baccala, R.; Silverman, G. J.; Beutler, B. A.; Theofilopoulos, A. N. Endosomal TLR Signaling Is Required for Anti-Nucleic Acid and Rheumatoid Factor Autoantibodies in Lupus. Proc. Natl. Acad. Sci. U. S. A. 2009, 106 (29), 1206112066,  DOI: 10.1073/pnas.0905441106
  256. 256
    Lyn-Cook, B. D.; Xie, C.; Oates, J.; Treadwell, E.; Word, B.; Hammons, G.; Wiley, K. Increased Expression of Toll-like Receptors (TLRs) 7 and 9 and Other Cytokines in Systemic Lupus Erythematosus (SLE) Patients: Ethnic Differences and Potential New Targets for Therapeutic Drugs. Mol. Immunol. 2014, 61 (1), 3843,  DOI: 10.1016/j.molimm.2014.05.001
  257. 257
    Tran, N. L.; Manzin-Lorenzi, C.; Santiago-Raber, M. L. Toll-like Receptor 8 Deletion Accelerates Autoimmunity in a Mouse Model of Lupus through a Toll-like Receptor 7-Dependent Mechanism. Immunology 2015, 145 (1), 6070,  DOI: 10.1111/imm.12426
  258. 258
    Capolunghi, F.; Rosado, M. M.; Cascioli, S.; Girolami, E.; Bordasco, S.; Vivarelli, M.; Ruggiero, B.; Cortis, E.; Insalaco, A.; Fantò, N.; Gallo, G.; Nucera, E.; Loiarro, M.; Sette, C.; De santis, R.; Carsetti, R.; Ruggiero, V. Pharmacological Inhibition of TLR9 Activation Blocks Autoantibody Production in Human B Cells from SLE Patients. Rheumatology 2010, 49 (12), 22812289,  DOI: 10.1093/rheumatology/keq226
  259. 259
    Li, B.; Xia, Y.; Hu, B. Infection and Atherosclerosis: TLR-Dependent Pathways. Cell. Mol. Life Sci. 2020, 77, 27512769,  DOI: 10.1007/s00018-020-03453-7
  260. 260
    Zhou, Y.; Little, P. J.; Downey, L.; Afroz, R.; Wu, Y.; Ta, H. T.; Xu, S.; Kamato, D. The Role of Toll-like Receptors in Atherothrombotic Cardiovascular Disease. ACS Pharmacol. Transl. Sci. 2020, 3 (3), 457471,  DOI: 10.1021/acsptsci.9b00100
  261. 261
    Adamczak, D. M. The Role of Toll-like Receptors and Vitamin D in Cardiovascular Diseases—a Review. Int. J. Mol. Sci. 2017, 18 (11), 2252,  DOI: 10.3390/ijms18112252
  262. 262
    Balistreri, C. R.; Ruvolo, G.; Lio, D.; Madonna, R. Toll-like Receptor-4 Signaling Pathway in Aorta Aging and Diseases: “Its Double Nature.. J. Mol. Cell. Cardiol. 2017, 110, 3853,  DOI: 10.1016/j.yjmcc.2017.06.011
  263. 263
    Bomfim, G. F.; Echem, C.; Martins, C. B.; Costa, T. J.; Sartoretto, S. M.; Dos Santos, R. A.; Oliveira, M. A.; Akamine, E. H.; Fortes, Z. B.; Tostes, R. C.; Webb, R. C.; Carvalho, M. H. C. Toll-like Receptor 4 Inhibition Reduces Vascular Inflammation in Spontaneously Hypertensive Rats. Life Sci. 2015, 122, 17,  DOI: 10.1016/j.lfs.2014.12.001
  264. 264
    Kim, J.; Yoo, J. Y.; Suh, J. M.; Park, S.; Kang, D.; Jo, H.; Bae, Y. S. The Flagellin-TLR5-Nox4 Axis Promotes the Migration of Smooth Muscle Cells in Atherosclerosis. Exp. Mol. Med. 2019, 51, 78,  DOI: 10.1038/s12276-019-0275-6
  265. 265
    Fukuda, D.; Nishimoto, S.; Aini, K.; Tanaka, A.; Nishiguchi, T.; Kim-Kaneyama, J. R.; Lei, X. F.; Masuda, K.; Naruto, T.; Tanaka, K.; Higashikuni, Y.; Hirata, Y.; Yagi, S.; Kusunose, K.; Yamada, H.; Soeki, T.; Imoto, I.; Akasaka, T.; Shimabukuro, M.; Sata, M. Toll-like Receptor 9 Plays a Pivotal Role in Angiotensin II-Induced Atherosclerosis. J. Am. Heart Assoc. 2019, 8 (7), e010860,  DOI: 10.1161/JAHA.118.010860
  266. 266
    Navi, A.; Patel, H.; Shaw, S.; Baker, D.; Tsui, J. Therapeutic Role of Toll-like Receptor Modification in Cardiovascular Dysfunction. Vasc. Pharmacol. 2013, 58 (3), 231239,  DOI: 10.1016/j.vph.2012.10.001
  267. 267
    Wang, Z.; Wang, Z.; Zhu, J.; Long, X.; Yan, J. Vitamin K2 Can Suppress the Expression of Toll-like Receptor 2 (TLR2) and TLR4, and Inhibit Calcification of Aortic Intima in ApoE–/– Mice as Well as Smooth Muscle Cells. Vascular 2018, 26 (1), 1826,  DOI: 10.1177/1708538117713395
  268. 268
    Owens, A. P.; Passam, F. H.; Antoniak, S.; Marshall, S. M.; McDaniel, A. L.; Rudel, L.; Williams, J. C.; Hubbard, B. K.; Dutton, J. A.; Wang, J.; Tobias, P. S.; Curtiss, L. K.; Daugherty, A.; Kirchhofer, D.; Luyendyk, J. P.; Moriarty, P. M.; Nagarajan, S.; Furie, B. C.; Furie, B.; Johns, D. G.; Temel, R. E.; Mackman, N. Monocyte Tissue Factor - Dependent Activation of Coagulation in Hypercholesterolemic Mice and Monkeys Is Inhibited by Simvastatin. J. Clin. Invest. 2012, 122 (2), 558568,  DOI: 10.1172/JCI58969
  269. 269
    Farkas, D.; Thompson, A. A. R.; Bhagwani, A. R.; Hultman, S.; Ji, H.; Kotha, N.; Farr, G.; Arnold, N. D.; Braithwaite, A.; Casbolt, H.; Cole, J. E.; Sabroe, I.; Monaco, C.; Cool, C. D.; Goncharova, E. A.; Lawrie, A.; Farkas, L. Toll-like Receptor 3 Is a Therapeutic Target for Pulmonary Hypertension. Am. J. Respir. Crit. Care Med. 2019, 199 (2), 199210,  DOI: 10.1164/rccm.201707-1370OC
  270. 270
    Wang, P.-F.; Fang, H.; Chen, J.; Lin, S.; Liu, Y.; Xiong, X.-Y.; Wang, Y.-C.; Xiong, R.-P.; lv, F.-L.; Wang, J.; Yang, Q.-W. Polyinosinic-Polycytidylic Acid Has Therapeutic Effects against Cerebral Ischemia/Reperfusion Injury through the Downregulation of TLR4 Signaling via TLR3. J. Immunol. 2014, 192 (10), 47834794,  DOI: 10.4049/jimmunol.1303108
  271. 271
    Chen, G.; Chen, X. L.; Xu, C. B.; Lin, J.; Luo, H. L.; Xie, X.; Li, J. Toll-like Receptor Protein 4 Monoclonal Antibody Inhibits MmLDL-Induced Endothelium-Dependent Vasodilation Dysfunction of Mouse Mesenteric Arteries. Microvasc. Res. 2020, 127, 103923,  DOI: 10.1016/j.mvr.2019.103923
  272. 272
    Huggins, C.; Pearce, S.; Peri, F.; Neumann, F.; Cockerill, G.; Pirianov, G. A Novel Small Molecule TLR4 Antagonist (IAXO-102) Negatively Regulates Non-Hematopoietic Toll like Receptor 4 Signalling and Inhibits Aortic Aneurysms Development. Atherosclerosis 2015, 242 (2), 563570,  DOI: 10.1016/j.atherosclerosis.2015.08.010
  273. 273
    Sun, M.; Deng, B.; Zhao, X.; Gao, C.; Yang, L.; Zhao, H.; Yu, D.; Zhang, F.; Xu, L.; Chen, L.; Sun, X. Isoflurane Preconditioning Provides Neuroprotection against Stroke by Regulating the Expression of the TLR4 Signalling Pathway to Alleviate Microglial Activation. Sci. Rep. 2015, 5, 11445,  DOI: 10.1038/srep11445
  274. 274
    Kapelouzou, A.; Giaglis, S.; Peroulis, M.; Katsimpoulas, M.; Moustardas, P.; Aravanis, C. V.; Kostakis, A.; Karayannakos, P. E.; Cokkinos, D. V. Overexpression of Toll-Like Receptors 2, 3, 4, and 8 Is Correlated to the Vascular Atherosclerotic Process in the Hyperlipidemic Rabbit Model: The Effect of Statin Treatment. J. Vasc. Res. 2017, 54 (3), 156169,  DOI: 10.1159/000457797
  275. 275
    Koulis, C.; Chen, Y. C.; Hausding, C.; Ahrens, I.; Kyaw, T. S.; Tay, C.; Allen, T.; Jandeleit-Dahm, K.; Sweet, M. J.; Akira, S.; Bobik, A.; Peter, K.; Agrotis, A. Protective Role for Toll-like Receptor-9 in the Development of Atherosclerosis in Apolipoprotein e-Deficient Mice. Arterioscler., Thromb., Vasc. Biol. 2014, 34 (3), 516525,  DOI: 10.1161/ATVBAHA.113.302407
  276. 276
    McCarthy, C. G.; Wenceslau, C. F.; Goulopoulou, S.; Baban, B.; Matsumoto, T.; Webb, R. C. Chloroquine Suppresses the Development of Hypertension in Spontaneously Hypertensive Rats. Am. J. Hypertens. 2017, 30 (2), 173181,  DOI: 10.1093/ajh/hpw113
  277. 277
    Carullo, G.; Governa, P.; Leo, A.; Gallelli, L.; Citraro, R.; Cione, E.; Caroleo, M. C.; Biagi, M.; Aiello, F.; Manetti, F. Quercetin-3-Oleate Contributes to Skin Wound Healing Targeting FFA1/GPR40. ChemistrySelect 2019, 4 (29), 84298433,  DOI: 10.1002/slct.201902572
  278. 278
    Carullo, G.; Perri, M.; Manetti, F.; Aiello, F.; Caroleo, M. C.; Cione, E. Quercetin-3-Oleoyl Derivatives as New GPR40 Agonists: Molecular Docking Studies and Functional Evaluation. Bioorg. Med. Chem. Lett. 2019, 29 (14), 17611764,  DOI: 10.1016/j.bmcl.2019.05.018
  279. 279
    Westwell-Roper, C.; Nackiewicz, D.; Dan, M.; Ehses, J. A. Toll-like Receptors and NLRP3 as Central Regulators of Pancreatic Islet Inflammation in Type 2 Diabetes. Immunol. Cell Biol. 2014, 92 (4), 314323,  DOI: 10.1038/icb.2014.4
  280. 280
    Rada, I.; Deldicque, L.; Francaux, M.; Zbinden-Foncea, H. Toll like Receptor Expression Induced by Exercise in Obesity and Metabolic Syndrome: A Systematic Review. Exerc. Immunol. Rev. 2018, 24 (14), 6071
  281. 281
    Singh, K.; Singh, K.; Agrawal, N. K.; Gupta, S. K.; Mohan, G.; Chaturvedi, S. Genetic and Epigenetic Alterations in Toll like Receptor 2 and Wound Healing Impairment in Type 2 Diabetes Patients. J. Diabetes Complications 2015, 29 (2), 222229,  DOI: 10.1016/j.jdiacomp.2014.11.015
  282. 282
    Zaharieva, E.; Velikova, T.; Tsakova, A.; Kamenov, Z. Reduced Soluble Toll-like Receptors 2 in Type 2 Diabetes. Arch. Physiol. Biochem. 2018, 124 (4), 326329,  DOI: 10.1080/13813455.2017.1401642
  283. 283
    Pahwa, R.; Jialal, I. Hyperglycemia Induces Toll-Like Receptor Activity Through Increased Oxidative Stress. Metab. Syndr. Relat. Disord. 2016, 14 (5), 239241,  DOI: 10.1089/met.2016.29006.pah
  284. 284
    Sepehri, Z.; Kiani, Z.; Nasiri, A. A.; Kohan, F. Toll-like Receptor 2 and Type 2 Diabetes. Cell. Mol. Biol. Lett. 2016, 21, 2,  DOI: 10.1186/s11658-016-0002-4
  285. 285
    Sepehri, Z.; Kiani, Z.; Javadian, F.; Akbar Nasiri, A.; Kohan, F.; Sepehrikia, S.; Javan Siamardi, S.; Aali, H.; Daneshvar, H.; Kennedy, D. TLR3 and Its Roles in the Pathogenesis of Type 2 Diabetes. Cell. Mol. Biol. 2015, 61 (3), 4650,  DOI: 10.14715/cmb/2015.61.3.10
  286. 286
    Rogero, M. M.; Calder, P. C. Obesity, Inflammation, Toll-like Receptor 4 and Fatty Acids. Nutrients 2018, 10 (4), 432,  DOI: 10.3390/nu10040432
  287. 287
    Portou, M. J.; Yu, R.; Baker, D.; Xu, S.; Abraham, D.; Tsui, J. Hyperglycaemia and Ischaemia Impair Wound Healing via Toll-like Receptor 4 Pathway Activation in Vitro and in an Experimental Murine Model. Eur. J. Vasc. Endovasc. Surg. 2020, 59 (1), 117127,  DOI: 10.1016/j.ejvs.2019.06.018
  288. 288
    Karpova, T.; de Oliveira, A. A.; Naas, H.; Priviero, F.; Nunes, K. P. Blockade of Toll-like Receptor 4 (TLR4) Reduces Oxidative Stress and Restores Phospho-ERK1/2 Levels in Leydig Cells Exposed to High Glucose. Life Sci. 2020, 245, 117365,  DOI: 10.1016/j.lfs.2020.117365
  289. 289
    Wang, H.; Zhang, Q.; Chai, Y.; Liu, Y.; Li, F.; Wang, B.; Zhu, C.; Cui, J.; Qu, H.; Zhu, M. 1,25(OH)2D3 Downregulates the Toll-like Receptor 4-Mediated Inflammatory Pathway and Ameliorates Liver Injury in Diabetic Rats. J. Endocrinol. Invest. 2015, 38 (10), 10831091,  DOI: 10.1007/s40618-015-0287-6
  290. 290
    Yu, R.; Bo, H.; Villani, V.; Spencer, P. J.; Fu, P. The Inhibitory Effect of Rapamycin on Toll Like Receptor 4 and Interleukin 17 in the Early Stage of Rat Diabetic Nephropathy. Kidney Blood Pressure Res. 2016, 41 (1), 5569,  DOI: 10.1159/000368547
  291. 291
    Lin, M.; Yiu, W. H.; Li, R. X.; Wu, H. J.; Wong, D. W. L.; Chan, L. Y. Y.; Leung, J. C. K.; Lai, K. N.; Tang, S. C. W. The TLR4 Antagonist CRX-526 Protects against Advanced Diabetic Nephropathy. Kidney Int. 2013, 83 (5), 887900,  DOI: 10.1038/ki.2013.11
  292. 292
    Dasu, M. R.; Ramirez, S.; Isseroff, R. R. Toll-like Receptors and Diabetes: A Therapeutic Perspective. Clin. Sci. 2012, 122 (5), 203214,  DOI: 10.1042/CS20110357
  293. 293
    Hayward, J. H.; Lee, S. J. A Decade of Research on TLR2 Discovering Its Pivotal Role in Glial Activation and Neuroinflammation in Neurodegenerative Diseases. Exp. Neurobiol. 2014, 23 (2), 138147,  DOI: 10.5607/en.2014.23.2.138
  294. 294
    Rangasamy, S. B.; Jana, M.; Roy, A.; Corbett, G. T.; Kundu, M.; Chandra, S.; Mondal, S.; Dasarathi, S.; Mufson, E. J.; Mishra, R. K.; Luan, C. H.; Bennett, D. A.; Pahan, K. Selective Disruption of TLR2-MyD88 Interaction Inhibits Inflammation and Attenuates Alzheimer’s Pathology. J. Clin. Invest. 2018, 128 (10), 42974312,  DOI: 10.1172/JCI96209
  295. 295
    Kwon, S.; Iba, M.; Masliah, E.; Kim, C. Targeting Microglial and Neuronal Toll-like Receptor 2 in Synucleinopathies. Exp. Neurobiol. 2019, 28 (5), 547553,  DOI: 10.5607/en.2019.28.5.547
  296. 296
    Fiebich, B. L.; Batista, C. R. A.; Saliba, S. W.; Yousif, N. M.; de Oliveira, A. C. P. Role of Microglia TLRs in Neurodegeneration. Front. Cell. Neurosci. 2018, 12, 329,  DOI: 10.3389/fncel.2018.00329
  297. 297
    Mulfaul, K.; Ozaki, E.; Fernando, N.; Brennan, K.; Chirco, K. R.; Connolly, E.; Greene, C.; Maminishkis, A.; Salomon, R. G.; Linetsky, M.; Natoli, R.; Mullins, R. F.; Campbell, M.; Doyle, S. L. Toll-like Receptor 2 Facilitates Oxidative Damage-Induced Retinal Degeneration. Cell Rep. 2020, 30 (7), 22092224.e5,  DOI: 10.1016/j.celrep.2020.01.064
  298. 298
    Kohno, H.; Chen, Y.; Kevany, B. M.; Pearlman, E.; Miyagi, M.; Maeda, T.; Palczewski, K.; Maeda, A. Photoreceptor Proteins Initiate Microglial Activation via Toll-like Receptor 4 in Retinal Degeneration Mediated by All-Trans-Retinal. J. Biol. Chem. 2013, 288 (21), 1532615341,  DOI: 10.1074/jbc.M112.448712
  299. 299
    Huang, Z.; Zhou, T.; Sun, X.; Zheng, Y.; Cheng, B.; Li, M.; Liu, X.; He, C. Necroptosis in Microglia Contributes to Neuroinflammation and Retinal Degeneration through TLR4 Activation. Cell Death Differ. 2018, 25 (1), 180189,  DOI: 10.1038/cdd.2017.141
  300. 300
    Liao, W. Y.; Tsai, T. H.; Ho, T. Y.; Lin, Y. W.; Cheng, C. Y.; Hsieh, C. L. Neuroprotective Effect of Paeonol Mediates Anti-Inflammation via Suppressing Toll-like Receptor 2 and Toll-like Receptor 4 Signaling Pathways in Cerebral Ischemia-Reperfusion Injured Rats. Evidence-based Complement. Altern. Med. 2016, 2016, 3704647,  DOI: 10.1155/2016/3704647
  301. 301
    Zhao, R.; Zhang, J.; Wang, Y.; Jin, J.; Zhou, H.; Chen, J.; Su, S. B. Activation of Toll-like Receptor 3 Promotes Pathological Corneal Neovascularization by Enhancement of SDF-1-Mediated Endothelial Progenitor Cell Recruitment. Exp. Eye Res. 2019, 178, 177185,  DOI: 10.1016/j.exer.2018.10.005
  302. 302
    Leitner, G. R.; Wenzel, T. J.; Marshall, N.; Gates, E. J.; Klegeris, A. Targeting Toll-like Receptor 4 to Modulate Neuroinflammation in Central Nervous System Disorders. Expert Opin. Ther. Targets 2019, 23 (10), 865882,  DOI: 10.1080/14728222.2019.1676416
  303. 303
    Chavali, V. D.; Agarwal, M.; Vyas, V. K.; Saxena, B. Neuroprotective Effects of Ethyl Pyruvate against Aluminum Chloride-Induced Alzheimer’s Disease in Rats via Inhibiting Toll-Like Receptor 4. J. Mol. Neurosci. 2020, 70, 836850,  DOI: 10.1007/s12031-020-01489-9
  304. 304
    Kamigaki, M.; Hide, I.; Yanase, Y.; Shiraki, H.; Harada, K.; Tanaka, Y.; Seki, T.; Shirafuji, T.; Tanaka, S.; Hide, M.; Sakai, N. The Toll-like Receptor 4-Activated Neuroprotective Microglia Subpopulation Survives via Granulocyte Macrophage Colony-Stimulating Factor and JAK2/STAT5 Signaling. Neurochem. Int. 2016, 93, 8294,  DOI: 10.1016/j.neuint.2016.01.003
  305. 305
    Feng, Y.; Gao, J.; Cui, Y.; Li, M.; Li, R.; Cui, C.; Cui, J. Neuroprotective Effects of Resatorvid Against Traumatic Brain Injury in Rat: Involvement of Neuronal Autophagy and TLR4 Signaling Pathway. Cell. Mol. Neurobiol. 2017, 37 (1), 155168,  DOI: 10.1007/s10571-016-0356-1
  306. 306
    Yang, L.; Zhou, R.; Tong, Y.; Chen, P.; Shen, Y.; Miao, S.; Liu, X. Neuroprotection by Dihydrotestosterone in LPS-Induced Neuroinflammation. Neurobiol. Dis. 2020, 140, 104814,  DOI: 10.1016/j.nbd.2020.104814
  307. 307
    De Paola, M.; Mariani, A.; Bigini, P.; Peviani, M.; Ferrara, G.; Molteni, M.; Gemma, S.; Veglianese, P.; Castellaneta, V.; Boldrin, V.; Rossetti, C.; Chiabrando, C.; Forloni, G.; Mennini, T.; Fanelli, R. Neuroprotective Effects of Toll-like Receptor 4 Antagonism in Spinal Cord Cultures and in a Mouse Model of Motor Neuron Degeneration. Mol. Med. 2012, 18 (6), 971981,  DOI: 10.2119/molmed.2012.00020
  308. 308
    Ikram, M.; Muhammad, T.; Rehman, S. U.; Khan, A.; Jo, M. G.; Ali, T.; Kim, M. O. Hesperetin Confers Neuroprotection by Regulating Nrf2/TLR4/NF-KB Signaling in an Aβ Mouse Model. Mol. Neurobiol. 2019, 56 (9), 62936309,  DOI: 10.1007/s12035-019-1512-7
  309. 309
    Jiwrajka, M.; Phillips, A.; Butler, M.; Rossi, M.; Pocock, J. M. The Plant-Derived Chalcone 2,2′,5′-Trihydroxychalcone Provides Neuroprotection against Toll-Like Receptor 4 Triggered Inflammation in Microglia. Oxid. Med. Cell. Longevity 2016, 2016, 6301712,  DOI: 10.1155/2016/6301712
  310. 310
    Zhu, X.; Liu, J.; Chen, O.; Xue, J.; Huang, S.; Zhu, W.; Wang, Y. Neuroprotective and Anti-Inflammatory Effects of Isoliquiritigenin in Kainic Acid-Induced Epileptic Rats via the TLR4/MYD88 Signaling Pathway. Inflammopharmacology 2019, 27 (6), 11431153,  DOI: 10.1007/s10787-019-00592-7
  311. 311
    Maatouk, L.; Compagnion, A. C.; Sauvage, M. A. C. De; Bemelmans, A. P.; Leclere-Turbant, S.; Cirotteau, V.; Tohme, M.; Beke, A.; Trichet, M.; Bazin, V.; Trawick, B. N.; Ransohoff, R. M.; Tronche, F.; Manoury, B.; Vyas, S. TLR9 Activation via Microglial Glucocorticoid Receptors Contributes to Degeneration of Midbrain Dopamine Neurons. Nat. Commun. 2018, 9, 2450,  DOI: 10.1038/s41467-018-04569-y
  312. 312
    Portou, M. J.; Baker, D.; Abraham, D.; Tsui, J. The Innate Immune System, Toll-like Receptors and Dermal Wound Healing: A Review. Vasc. Pharmacol. 2015, 71, 3136,  DOI: 10.1016/j.vph.2015.02.007
  313. 313
    Yang, H.; Brackett, C. M.; Morales-Tirado, V. M.; Li, Z.; Zhang, Q.; Wilson, M. W.; Benjamin, C.; Harris, W.; Waller, E. K.; Gudkov, A. V.; Burdelya, L. G.; Grossniklaus, H. E. The Toll-like Receptor 5 Agonist Entolimod Suppresses Hepatic Metastases in a Murine Model of Ocular Melanoma via an NK Cell-Dependent Mechanism. Oncotarget 2016, 7 (3), 29362950,  DOI: 10.18632/oncotarget.6500
  314. 314
    Bi, J.; Wang, W.; Du, J.; Chen, K.; Cheng, K. Structure-Activity Relationship Study and Biological Evaluation of SAC-Garlic Acid Conjugates as Novel Anti-Inflammatory Agents. Eur. J. Med. Chem. 2019, 179, 233245,  DOI: 10.1016/j.ejmech.2019.06.059
  315. 315
    Zhang, Y.; Zhang, Y. Pterostilbene, a Novel Natural Plant Conduct, Inhibits High Fat-Induced Atherosclerosis Inflammation via NF-KB Signaling Pathway in Toll-like Receptor 5 (TLR5) Deficient Mice. Biomed. Pharmacother. 2016, 81, 345355,  DOI: 10.1016/j.biopha.2016.04.031
  316. 316
    Anwar, M. A.; Shah, M.; Kim, J.; Choi, S. Recent Clinical Trends in Toll-like Receptor Targeting Therapeutics. Med. Res. Rev. 2019, 39 (3), 10531090,  DOI: 10.1002/med.21553
  317. 317
    Lima, C. X.; Souza, D. G.; Amaral, F. A.; Fagundes, C. T.; Rodrigues, I. P. S.; Alves-Filho, J. C.; Kosco-Vilbois, M.; Ferlin, W.; Shang, L.; Elson, G.; Teixeira, M. M. Therapeutic Effects of Treatment with Anti-TLR2 and Anti-TLR4Monoclonal Antibodies in Polymicrobial Sepsis. PLoS One 2015, 10 (7), e0132336,  DOI: 10.1371/journal.pone.0132336
  318. 318
    Toshchakov, V. Y.; Szmacinski, H.; Couture, L. A.; Lakowicz, J. R.; Vogel, S. N. Targeting TLR4 Signaling by TLR4 Toll/IL-1 Receptor Domain-Derived Decoy Peptides: Identification of the TLR4 Toll/IL-1 Receptor Domain Dimerization Interface. J. Immunol. 2011, 186 (8), 48194827,  DOI: 10.4049/jimmunol.1002424
  319. 319
    Sallenave, J.-M.; Guillot, L. Innate Immune Signaling and Proteolytic Pathways in the Resolution or Exacerbation of SARS-CoV-2 in Covid-19: Key Therapeutic Targets?. Front. Immunol. 2020, 11, 1229,  DOI: 10.3389/fimmu.2020.01229
  320. 320
    Chakraborty, C.; Sharma, A. R.; Bhattacharya, M.; Sharma, G.; Lee, S.-S.; Agoramoorthy, G. Consider TLR5 for New Therapeutic Development against COVID-19. J. Med. Virol. 2020,  DOI: 10.1002/jmv.25997
  321. 321
    Wali, S.; Flores, J. R.; Jaramillo, A. M.; Goldblatt, D. L.; Pantaleón García, J.; Tuvim, M. J.; Dickey, B. F.; Evans, S. E. Immune Modulation to Improve Survival of Respiratory Virus Infections in Mice. bioRxiv 2020, DOI: 10.1101/2020.04.16.045054 .
  322. 322
    Conti, P.; Ronconi, G.; Caraffa, A.; Gallenga, C.; Ross, R.; Frydas, I.; Kritas, S. Induction of Pro-Inflammatory Cytokines (IL-1 and IL-6) and Lung Inflammation by Coronavirus-19 (COVI-19 or SARS-CoV-2): Anti-Inflammatory Strategies. J. Biol. Regul. Homeost. Agents 2020, 34 (2), 1115,  DOI: 10.23812/conti-e

Cited By


This article is cited by 18 publications.

  1. Biswajit Kundu, Deblina Raychaudhuri, Ayan Mukherjee, Bishnu Prasad Sinha, Dipika Sarkar, Purbita Bandopadhyay, Sourav Pal, Nirmal Das, Debdeep Dey, Kantubhukta Ramarao, Kasireddy Nagireddy, Dipyaman Ganguly, Arindam Talukdar. Systematic Optimization of Potent and Orally Bioavailable Purine Scaffold as a Dual Inhibitor of Toll-Like Receptors 7 and 9. Journal of Medicinal Chemistry 2021, 64 (13) , 9279-9301. https://doi.org/10.1021/acs.jmedchem.1c00532OpenURL HONG KONG UNIV SCIENCE TECHLGY
  2. Arindam Talukdar, Dipyaman Ganguly, Swarnali Roy, Nirmal Das, Dipika Sarkar. Structural Evolution and Translational Potential for Agonists and Antagonists of Endosomal Toll-like Receptors. Journal of Medicinal Chemistry 2021, 64 (12) , 8010-8041. https://doi.org/10.1021/acs.jmedchem.1c00300OpenURL HONG KONG UNIV SCIENCE TECHLGY
  3. Arshpreet Kaur, Deepender Kaushik, Sakshi Piplani, Surinder K. Mehta, Nikolai Petrovsky, Deepak B. Salunke. TLR2 Agonistic Small Molecules: Detailed Structure–Activity Relationship, Applications, and Future Prospects. Journal of Medicinal Chemistry 2021, 64 (1) , 233-278. https://doi.org/10.1021/acs.jmedchem.0c01627OpenURL HONG KONG UNIV SCIENCE TECHLGY
  4. Junjie Yang, Fanjie Hu, Chengjun Guo, Yuqing Liang, Haiying Song, Kui Cheng. Discovery of isoliquiritigenin analogues that reverse acute hepatitis by inhibiting macrophage polarization. Bioorganic Chemistry 2021, 114 , 105043. https://doi.org/10.1016/j.bioorg.2021.105043OpenURL HONG KONG UNIV SCIENCE TECHLGY
  5. Deepender Kaushik, Arshpreet Kaur, Nikolai Petrovsky, Deepak B. Salunke. Structural evolution of toll-like receptor 7/8 agonists from imidazoquinolines to imidazoles. RSC Medicinal Chemistry 2021, 12 (7) , 1065-1120. https://doi.org/10.1039/D1MD00031DOpenURL HONG KONG UNIV SCIENCE TECHLGY
  6. Anindya Sarkar, Anushka C. Galasiti Kankanamalage, Qian Zhang, Heng Cheng, Prasanna Sivaprakasam, Joseph Naglich, Chunshan Xie, Sanjeev Gangwar, Dale L. Boger. Synthesis, structure-activity relationship studies and evaluation of a TLR 3/8/9 agonist and its analogues. Medicinal Chemistry Research 2021, 30 (7) , 1377-1385. https://doi.org/10.1007/s00044-021-02736-3OpenURL HONG KONG UNIV SCIENCE TECHLGY
  7. Xiaoqing Wang, Yafei Liu, Xingchun Han, Ge Zou, Wei Zhu, Hong Shen, Haixia Liu. Small molecule approaches to treat autoimmune and inflammatory diseases (Part II): Nucleic acid sensing antagonists and inhibitors. Bioorganic & Medicinal Chemistry Letters 2021, 44 , 128101. https://doi.org/10.1016/j.bmcl.2021.128101OpenURL HONG KONG UNIV SCIENCE TECHLGY
  8. Asmita Banstola, Kishwor Poudel, Jong Oh. Kim, Jee-Heon Jeong, Simmyung Yook. Recent progress in stimuli-responsive nanosystems for inducing immunogenic cell death. Journal of Controlled Release 2021, 19 https://doi.org/10.1016/j.jconrel.2021.07.038OpenURL HONG KONG UNIV SCIENCE TECHLGY
  9. Silke Miller, Maria-Jesus Blanco. Small molecule therapeutics for neuroinflammation-mediated neurodegenerative disorders. RSC Medicinal Chemistry 2021, 12 (6) , 871-886. https://doi.org/10.1039/D1MD00036EOpenURL HONG KONG UNIV SCIENCE TECHLGY
  10. Ali Namvar, Azam Bolhassani, Gholamreza Javadi, Zahra Noormohammadi. Combination of human papillomaviruses L1 and L2 multiepitope constructs protects mice against tumor cells. Fundamental & Clinical Pharmacology 2021, 8 https://doi.org/10.1111/fcp.12690OpenURL HONG KONG UNIV SCIENCE TECHLGY
  11. Bahareh Kashani, Zahra Zandi, Atieh Pourbagheri‐Sigaroodi, Davood Bashash, Seyed H. Ghaffari. The role of toll‐like receptor 4 (TLR4) in cancer progression: A possible therapeutic target?. Journal of Cellular Physiology 2021, 236 (6) , 4121-4137. https://doi.org/10.1002/jcp.30166OpenURL HONG KONG UNIV SCIENCE TECHLGY
  12. Huili Lyu, Cody M. Elkins, Jessica L. Pierce, C. Henrique Serezani, Daniel S. Perrien. MyD88 Is Not Required for Muscle Injury-Induced Endochondral Heterotopic Ossification in a Mouse Model of Fibrodysplasia Ossificans Progressiva. Biomedicines 2021, 9 (6) , 630. https://doi.org/10.3390/biomedicines9060630OpenURL HONG KONG UNIV SCIENCE TECHLGY
  13. Taiki Mori, Hideo Kataoka, Takeshi Into. Effect of Myd88 deficiency on gene expression profiling in salivary glands of female non-obese diabetic (NOD) mice. Journal of Oral Biosciences 2021, 63 (2) , 192-198. https://doi.org/10.1016/j.job.2021.04.003OpenURL HONG KONG UNIV SCIENCE TECHLGY
  14. Saghar Pahlavanneshan, Ali Sayadmanesh, Hamidreza Ebrahimiyan, Mohsen Basiri, . Toll-Like Receptor-Based Strategies for Cancer Immunotherapy. Journal of Immunology Research 2021, 2021 , 1-14. https://doi.org/10.1155/2021/9912188OpenURL HONG KONG UNIV SCIENCE TECHLGY
  15. Hassan A. Alhazmi, Asim Najmi, Sadique A. Javed, Shahnaz Sultana, Mohammed Al Bratty, Hafiz A. Makeen, Abdulkarim M. Meraya, Waquar Ahsan, Syam Mohan, Manal M. E. Taha, Asaad Khalid. Medicinal Plants and Isolated Molecules Demonstrating Immunomodulation Activity as Potential Alternative Therapies for Viral Diseases Including COVID-19. Frontiers in Immunology 2021, 12 https://doi.org/10.3389/fimmu.2021.637553OpenURL HONG KONG UNIV SCIENCE TECHLGY
  16. Deepender Kaushik, Juliana T Granato, Gilson C Macedo, Paula R B Dib, Sakshi Piplani, Johnson Fung, Adilson D da Silva, Elaine S Coimbra, Nikolai Petrovsky, Deepak B Salunke. Toll-like receptor-7/8 agonist kill Leishmania amazonensis by acting as pro-oxidant and pro-inflammatory agent. Journal of Pharmacy and Pharmacology 2021, 11 https://doi.org/10.1093/jpp/rgab063OpenURL HONG KONG UNIV SCIENCE TECHLGY
  17. Muhammad Waqqas Hasan, Muhammad Haseeb, Muhammad Ehsan, Javaid Ali Gadahi, Qiangqiang Wang, Muhammad Ali Memon, Muhammad Tahir Aleem, Shakeel Ahmed Lakho, Ruo Feng Yan, Li Xin Xu, Xiao Kai Song, Xiangrui Li. The immunogenic maturation of goat monocyte-derived dendritic cells and upregulation of toll-like receptors by five antigens of Haemonchus contortus in-vitro. Research in Veterinary Science 2021, 136 , 247-258. https://doi.org/10.1016/j.rvsc.2021.03.007OpenURL HONG KONG UNIV SCIENCE TECHLGY
  18. Hongyan Sui, Qian Chen, Tomozumi Imamichi. Cytoplasmic‐translocated Ku70 senses intracellular DNA and mediates interferon‐lambda1 induction. Immunology 2021, 27 https://doi.org/10.1111/imm.13318OpenURL HONG KONG UNIV SCIENCE TECHLGY
  • Abstract

    Figure 1

    Figure 1. General structure of a dimeric toll-like receptor (TLR).

    Figure 2

    Figure 2. Schematic representation of TLR signaling pathways.

    Figure 3

    Figure 3. Multiple members of TLR family are responsible for micro-organism and viral PAMPs recognition.

    Figure 4

    Figure 4. Chemical structures of the TLR2/1 and 2/6 modulators 16 for the treatment of viral infection.

    Figure 5

    Figure 5. Chemical structures of TLR3 and 4 modulators 714 for the treatment of viral infection.

    Figure 6

    Figure 6. Chemical structures of the TLR7, TLR8, and TLR9 modulators 1527 endowed with an antiviral activity.

    Figure 7

    Figure 7. Chemical structures of TLR2, TLR4, and TLR5 modulators 2833 discovered for the treatment of bacterial infections.

    Figure 8

    Figure 8. Chemical structures of the TLR modulators 3441 involved in sepsis and parasitic diseases.

    Figure 9

    Figure 9. Chemical structures of TLR2/1, TLR2/6 and TLR3 modulators 4246 involved in inflammatory diseases.

    Figure 10

    Figure 10. Chemical structures of TLR4 modulators 4759 studied against inflammation.

    Figure 11

    Figure 11. Chemical structures of TLR7 and TLR8 modulators 6064 studied against inflammation.

    Figure 12

    Figure 12. Chemical structures of some of the most-relevant TLR modulators 6568 investigated in clinical trials against cancer.

    Figure 13

    Figure 13. Chemical structures of Pam3CysSK4-MUC-1 conjugated 6971 and UPam derivatives 72a72e.

    Figure 14

    Figure 14. Chemical structures of the homologated Pam2CysSK4–NY-ESO-1 73a73d and of the Pam2Cys derivative 74a and 74b.

    Figure 15

    Figure 15. Chemical structures of TLR1/2 modulators 7579 as anticancer agents.

    Figure 16

    Figure 16. Chemical structures of TLR4 modulators 8085 investigated as anticancer agents.

    Figure 17

    Figure 17. Chemical structures of TLR modulators 8688b endowed with anticancer activity.

    Figure 18

    Figure 18. Chemical structures of TLR modulators 8993 investigated against MS.

    Figure 19

    Figure 19. Chemical structures of TLR modulators 9498 investigated against RA and SLE treatment.

    Figure 20

    Figure 20. Chemical structures of TLR modulators 99103 investigated against CVDs.

    Figure 21

    Figure 21. Chemical structures of TLR modulators 104110 investigated against diabetes.

    Figure 22

    Figure 22. Chemical structures of TLR modulators 111117 useful in neurodegenerative diseases.

  • References

    ARTICLE SECTIONS
    Jump To

    This article references 322 other publications.

    1. 1
      Khajeh Alizadeh Attar, M.; Anwar, M. A.; Eskian, M.; Keshavarz-Fathi, M.; Choi, S.; Rezaei, N. Basic Understanding and Therapeutic Approaches to Target Toll-like Receptors in Cancerous Microenvironment and Metastasis. Med. Res. Rev. 2018, 38 (5), 14691484,  DOI: 10.1002/med.21480
    2. 2
      Patinote, C.; Karroum, N. B.; Moarbess, G.; Cirnat, N.; Kassab, I.; Bonnet, P. A.; Deleuze-Masquéfa, C. Agonist and Antagonist Ligands of Toll-like Receptors 7 and 8: Ingenious Tools for Therapeutic Purposes. Eur. J. Med. Chem. 2020, 193, 112238,  DOI: 10.1016/j.ejmech.2020.112238
    3. 3
      Anwar, M. A.; Shah, M.; Kim, J.; Choi, S. Recent Clinical Trends in Toll-like Receptor Targeting Therapeutics. Med. Res. Rev. 2019, 39 (3), 10531090,  DOI: 10.1002/med.21553
    4. 4
      Wang, Y.; Zhang, S.; Li, H.; Wang, H.; Zhang, T.; Hutchinson, M. R.; Yin, H.; Wang, X. Small-Molecule Modulators of Toll-like Receptors. Acc. Chem. Res. 2020, 53, 1046,  DOI: 10.1021/acs.accounts.9b00631
    5. 5
      Xu, Y.; Tao, X.; Shen, B.; Horng, T.; Medzhitov, R.; Manley, J. L.; Tong, L. Structural Basis for Signal Transduction by the Toll/Interleukin-1 Receptor Domains. Nature 2000, 408 (6808), 111115,  DOI: 10.1038/35040600
    6. 6
      Marciani, D. J. Vaccine Adjuvants: Role and Mechanisms of Action in Vaccine Immunogenicity. Drug Discovery Today 2003, 8 (20), 934943,  DOI: 10.1016/S1359-6446(03)02864-2
    7. 7
      Halperin, S. A.; Dobson, S.; McNeil, S.; Langley, J. M.; Smith, B.; McCall-Sani, R.; Levitt, D.; Van Nest, G.; Gennevois, D.; Eiden, J. J. Comparison of the Safety and Immunogenicity of Hepatitis B Virus Surface Antigen Co-Administered with an Immunostimulatory Phosphorothioate Oligonucleotide and a Licensed Hepatitis B Vaccine in Healthy Young Adults. Vaccine 2006, 24 (1), 2026,  DOI: 10.1016/j.vaccine.2005.08.095
    8. 8
      Kanzler, H.; Barrat, F. J.; Hessel, E. M.; Coffman, R. L. Therapeutic Targeting of Innate Immunity with Toll-like Receptor Agonists and Antagonists. Nat. Med. 2007, 13 (5), 552559,  DOI: 10.1038/nm1589
    9. 9
      Kurt-Jones, E. A.; Popova, L.; Kwinn, L.; Haynes, L. M.; Jones, L. P.; Tripp, R. A.; Walsh, E. E.; Freeman, M. W.; Golenbock, D. T.; Anderson, L. J.; Finberg, R. W. Pattern Recognition Receptors TLR4 and CD14 Mediate Response to Respiratory Syncytial Virus. Nat. Immunol. 2000, 1 (5), 398401,  DOI: 10.1038/80833
    10. 10
      Lester, S. N.; Li, K. Toll-like Receptors in Antiviral Innate Immunity. J. Mol. Biol. 2014, 426 (6), 12461264,  DOI: 10.1016/j.jmb.2013.11.024
    11. 11
      Carriere, J.; Rao, Y.; Liu, Q.; Lin, X.; Zhao, J.; Feng, P. Post-Translational Control of Innate Immune Signaling Pathways by Herpesviruses. Front. Microbiol. 2019, 10, 2647,  DOI: 10.3389/fmicb.2019.02647
    12. 12
      Patel, M. C.; Shirey, K. A.; Pletneva, L. M.; Boukhvalova, M. S.; Garzino-Demo, A.; Vogel, S. N.; Blanco, J. C. G. Novel Drugs Targeting Toll-like Receptors for Antiviral Therapy. Future Virol. 2014, 9 (9), 811829,  DOI: 10.2217/fvl.14.70
    13. 13
      Devhare, P. B.; Chatterjee, S. N.; Arankalle, V. A.; Lole, K. S. Analysis of Antiviral Response in Human Epithelial Cells Infected with Hepatitis E Virus. PLoS One 2013, 8 (5), e63793,  DOI: 10.1371/journal.pone.0063793
    14. 14
      Martínez-Aguado, P.; Serna-Gallego, A.; Marrugal-Lorenzo, J. A.; Gómez-Marín, I.; Sánchez-Céspedes, J. Antiadenovirus Drug Discovery: Potential Targets and Evaluation Methodologies. Drug Discovery Today 2015, 20 (10), 12351242,  DOI: 10.1016/j.drudis.2015.07.007
    15. 15
      Ma, Z.; Cao, Q.; Xiong, Y.; Zhang, E.; Lu, M. Interaction between Hepatitis B Virus and Toll-like Receptors: Current Status and Potential Therapeutic Use for Chronic Hepatitis B. Vaccines 2018, 6 (1), 6,  DOI: 10.3390/vaccines6010006
    16. 16
      Du, K.; Liu, J.; Broering, R.; Zhang, X.; Yang, D.; Dittmer, U.; Lu, M. Recent Advances in the Discovery and Development of TLR Ligands as Novel Therapeutics for Chronic HBV and HIV Infections. Expert Opin. Drug Discovery 2018, 13 (7), 661670,  DOI: 10.1080/17460441.2018.1473372
    17. 17
      Jung, H. E.; Kim, T. H.; Lee, H. K. Contribution of Dendritic Cells in Protective Immunity against Respiratory Syncytial Virus Infection. Viruses 2020, 12 (1), 102,  DOI: 10.3390/v12010102
    18. 18
      Jin, M. S.; Kim, S. E.; Heo, J. Y.; Lee, M. E.; Kim, H. M.; Paik, S. G.; Lee, H.; Lee, J. O. Crystal Structure of the TLR1-TLR2 Heterodimer Induced by Binding of a Tri-Acylated Lipopeptide. Cell 2007, 130 (6), 10711082,  DOI: 10.1016/j.cell.2007.09.008
    19. 19
      Shukla, N. M.; Chan, M.; Hayashi, T.; Carson, D. A.; Cottam, H. B. Recent Advances and Perspectives in Small-Molecule TLR Ligands and Their Modulators. ACS Med. Chem. Lett. 2018, 9 (12), 11561159,  DOI: 10.1021/acsmedchemlett.8b00566
    20. 20
      Shah, M.; Anwar, M. A.; Kim, J. H.; Choi, S. Advances in Antiviral Therapies Targeting Toll-like Receptors. Expert Opin. Invest. Drugs 2016, 25 (4), 437453,  DOI: 10.1517/13543784.2016.1154040
    21. 21
      Zhu, G.; Xu, Y.; Cen, X.; Nandakumar, K. S.; Liu, S.; Cheng, K. Targeting Pattern-Recognition Receptors to Discover New Small Molecule Immune Modulators. Eur. J. Med. Chem. 2018, 144, 8292,  DOI: 10.1016/j.ejmech.2017.12.026
    22. 22
      Lucifora, J.; Bonnin, M.; Aillot, L.; Fusil, F.; Maadadi, S.; Dimier, L.; Michelet, M.; Floriot, O.; Ollivier, A.; Rivoire, M.; Ait-Goughoulte, M.; Daffis, S.; Fletcher, S. P.; Salvetti, A.; Cosset, F. L.; Zoulim, F.; Durantel, D. Direct Antiviral Properties of TLR Ligands against HBV Replication in Immune-Competent Hepatocytes. Sci. Rep. 2018, 8 (1), 111,  DOI: 10.1038/s41598-018-23525-w
    23. 23
      Kim, W. J.; Choi, J. W.; Jang, W. J.; Kang, Y. S.; Lee, C. W.; Synytsya, A.; Park, Y. Il. Low-Molecular Weight Mannogalactofucans Prevent Herpes Simplex Virus Type 1 Infection via Activation of Toll-like Receptor 2. Int. J. Biol. Macromol. 2017, 103, 286293,  DOI: 10.1016/j.ijbiomac.2017.05.060
    24. 24
      Santone, M.; Aprea, S.; Wu, T. Y. H.; Cooke, M. P.; Mbow, M. L.; Valiante, N. M.; Rush, J. S.; Dougan, S.; Avalos, A.; Ploegh, H.; De Gregorio, E.; Buonsanti, C.; D’Oro, U. A New TLR2 Agonist Promotes Cross-Presentation by Mouse and Human Antigen Presenting Cells. Hum. Vaccines Immunother. 2015, 11 (8), 20382050,  DOI: 10.1080/21645515.2015.1027467
    25. 25
      Arora, S.; Ahmad, S.; Irshad, R.; Goyal, Y.; Rafat, S.; Siddiqui, N.; Dev, K.; Husain, M.; Ali, S.; Mohan, A.; Syed, M. A. TLRs in Pulmonary Diseases. Life Sci. 2019, 233, 116671,  DOI: 10.1016/j.lfs.2019.116671
    26. 26
      West, J. A.; Gregory, S. M.; Damania, B. Toll-like Receptor Sensing of Human Herpesvirus Infection. Front. Cell. Infect. Microbiol. 2012, 2, 122,  DOI: 10.3389/fcimb.2012.00122
    27. 27
      Li, Y.; Qu, C.; Yu, P.; Ou, X.; Pan, Q.; Wang, W. The Interplay between Host Innate Immunity and Hepatitis E Virus. Viruses 2019, 11 (6), 541,  DOI: 10.3390/v11060541
    28. 28
      Said, E. A.; Tremblay, N.; Al-Balushi, M. S.; Al-Jabri, A. A.; Lamarre, D. Viruses Seen by Our Cells: The Role of Viral RNA Sensors. J. Immunol. Res. 2018, 2018, 9480497,  DOI: 10.1155/2018/9480497
    29. 29
      Verma, R.; Bharti, K. Toll like Receptor 3 and Viral Infections of Nervous System. J. Neurol. Sci. 2017, 372, 4048,  DOI: 10.1016/j.jns.2016.11.034
    30. 30
      Lee, I.; Bos, S.; Li, G.; Wang, S.; Gadea, G.; Desprès, P.; Zhao, R. Y. Probing Molecular Insights into Zika Virus–Host Interactions. Viruses 2018, 10 (5), 233,  DOI: 10.3390/v10050233
    31. 31
      Mukherjee, S.; Huda, S.; Sinha Babu, S. P. Toll-like Receptor Polymorphism in Host Immune Response to Infectious Diseases: A Review. Scand. J. Immunol. 2019, 90 (1), e12771,  DOI: 10.1111/sji.12771
    32. 32
      Gambuzza, M. E.; Soraci, L.; Sofo, V. A New Era for Immunotherapeutic Approaches in Multiple Sclerosis Treatment. J. Clin. Trials 2016, 6 (1), 1012,  DOI: 10.4172/2167-0870.1000253
    33. 33
      Piret, J.; Boivin, G. Innate Immune Response during Herpes Simplex Virus Encephalitis and Development of Immunomodulatory Strategies. Rev. Med. Virol. 2015, 25 (5), 300319,  DOI: 10.1002/rmv.1848
    34. 34
      Mousavi, T.; Sattari Saravi, S.; Valadan, R.; Haghshenas, M. R.; Rafiei, A.; Jafarpour, H.; Shamshirian, A. Different Types of Adjuvants in Prophylactic and Therapeutic Human Papillomavirus Vaccines in Laboratory Animals: A Systematic Review. Arch. Virol. 2020, 165 (2), 263284,  DOI: 10.1007/s00705-019-04479-4
    35. 35
      Bardel, E.; Doucet-Ladeveze, R.; Mathieu, C.; Harandi, A. M.; Dubois, B.; Kaiserlian, D. Intradermal Immunisation Using the TLR3-Ligand Poly (I:C) as Adjuvant Induces Mucosal Antibody Responses and Protects against Genital HSV-2 Infection. npj Vaccines 2016, 1, 16010,  DOI: 10.1038/npjvaccines.2016.10
    36. 36
      Saxena, M.; Sabado, R. L.; La Mar, M.; Mohri, H.; Salazar, A. M.; Dong, H.; Correa Da Rosa, J.; Markowitz, M.; Bhardwaj, N.; Miller, E. Poly-ICLC, a TLR3 Agonist, Induces Transient Innate Immune Responses in Patients with Treated HIV-Infection: A Randomized Double-Blinded Placebo Controlled Trial. Front. Immunol. 2019, 10, 725,  DOI: 10.3389/fimmu.2019.00725
    37. 37
      Zhang, Y.; Zhang, S.; Li, W.; Hu, Y.; Zhao, J.; Liu, F.; Lin, H.; Liu, Y.; Wang, L.; Xu, S.; Hu, R.; Shao, H.; Li, L. A Novel Rabies Vaccine Based-on Toll-like Receptor 3 (TLR3) Agonist PIKA Adjuvant Exhibiting Excellent Safety and Efficacy in Animal Studies. Virology 2016, 489, 165172,  DOI: 10.1016/j.virol.2015.10.029
    38. 38
      Guo, F.; Mead, J.; Aliya, N.; Wang, L.; Cuconati, A.; Wei, L.; Li, K.; Block, T. M.; Guo, J. T.; Chang, J. RO 90–7501 Enhances TLR3 and RLR Agonist Induced Antiviral Response. PLoS One 2012, 7 (10), e42583,  DOI: 10.1371/journal.pone.0042583
    39. 39
      Peri, F.; Calabrese, V. Toll-like Receptor 4 (TLR4) Modulation by Synthetic and Natural Compounds: An Update. J. Med. Chem. 2014, 57 (9), 36123622,  DOI: 10.1021/jm401006s
    40. 40
      Olejnik, J.; Hume, A. J.; Mühlberger, E. Toll-like Receptor 4 in Acute Viral Infection: Too Much of a Good Thing. PLoS Pathog. 2018, 14 (12), e1007390,  DOI: 10.1371/journal.ppat.1007390
    41. 41
      Abouelasrar Salama, S.; Lavie, M.; De Buck, M.; Van Damme, J.; Struyf, S. Cytokines and Serum Amyloid A in the Pathogenesis of Hepatitis C Virus Infection. Cytokine Growth Factor Rev. 2019, 50, 2942,  DOI: 10.1016/j.cytogfr.2019.10.006
    42. 42
      Hendrickx, R.; Stichling, N.; Koelen, J.; Kuryk, L.; Lipiec, A.; Greber, U. F. Innate Immunity to Adenovirus. Hum. Gene Ther. 2014, 25 (4), 265284,  DOI: 10.1089/hum.2014.001
    43. 43
      Chen, K. R.; Ling, P. Interplays between Enterovirus A71 and the Innate Immune System. J. Biomed. Sci. 2019, 26 (1), 95,  DOI: 10.1186/s12929-019-0596-8
    44. 44
      Bahramabadi, R.; Dabiri, S.; Iranpour, M.; Kazemi Arababadi, M. TLR4: An Important Molecule Participating in Either Anti-Human Papillomavirus Immune Responses or Development of Its Related Cancers. Viral Immunol. 2019, 32 (10), 417423,  DOI: 10.1089/vim.2019.0061
    45. 45
      Tantawy, E. A.; El-Beyali, A. A.; Gohar, M. K.; Ibrahim, Z. S.; Nasr, M.; Marei, A. Association of TLR2 and TLR4 Gene Polymorphism with Susceptibility to Wart Infections and Their Response to Candida Antigen Immunotherapy. J. Dermatol. Treat. 2020,  DOI: 10.1080/09546634.2020.1732285
    46. 46
      Vasou, A.; Sultanoglu, N.; Goodbourn, S.; Randall, R. E.; Kostrikis, L. G. Targeting Pattern Recognition Receptors (PRR) for Vaccine Adjuvantation: From Synthetic PRR Agonists to the Potential of Defective Interfering Particles of Viruses. Viruses 2017, 9 (7), 186,  DOI: 10.3390/v9070186
    47. 47
      Chan, M.; Hayashi, T.; Mathewson, R. D.; Nour, A.; Hayashi, Y.; Yao, S.; Tawatao, R. I.; Crain, B.; Tsigelny, I. F.; Kouznetsova, V. L.; Messer, K.; Pu, M.; Corr, M.; Carson, D. A.; Cottam, H. B. Identification of Substituted Pyrimido[5,4-b]Indoles as Selective Toll-like Receptor 4 Ligands. J. Med. Chem. 2013, 56 (11), 42064223,  DOI: 10.1021/jm301694x
    48. 48
      Hayashi, T.; Crain, B.; Yao, S.; Caneda, C. D.; Cottam, H. B.; Chan, M.; Corr, M.; Carson, D. A. Novel Synthetic Toll-Like Receptor 4/MD2 Ligands Attenuate Sterile Inflammation. J. Pharmacol. Exp. Ther. 2014, 350 (2), 330340,  DOI: 10.1124/jpet.114.214312
    49. 49
      Goff, P. H.; Hayashi, T.; Martínez-Gil, L.; Corr, M.; Crain, B.; Yao, S.; Cottam, H. B.; Chan, M.; Ramos, I.; Eggink, D.; Heshmati, M.; Krammer, F.; Messer, K.; Pu, M.; Fernandez-Sesma, A.; Palese, P.; Carson, D. A. Synthetic Toll-Like Receptor 4 (TLR4) and TLR7 Ligands as Influenza Virus Vaccine Adjuvants Induce Rapid, Sustained, and Broadly Protective Responses. J. Virol. 2015, 89 (6), 32213235,  DOI: 10.1128/JVI.03337-14
    50. 50
      Rodríguez-Valentín, M.; López, S.; Rivera, M.; Ríos-Olivares, E.; Cubano, L.; Boukli, N. M. Naturally Derived Anti-HIV Polysaccharide Peptide (PSP) Triggers a Toll-like Receptor 4-Dependent Antiviral Immune Response. J. Immunol. Res. 2018, 2018, 8741698,  DOI: 10.1155/2018/8741698
    51. 51
      Li, M.; Jiang, Y.; Gong, T.; Zhang, Z.; Sun, X. Intranasal Vaccination against HIV-1 with Adenoviral Vector-Based Nanocomplex Using Synthetic TLR-4 Agonist Peptide as Adjuvant. Mol. Pharmaceutics 2016, 13 (3), 885894,  DOI: 10.1021/acs.molpharmaceut.5b00802
    52. 52
      Abdul-Careem, M. F.; Firoz Mian, M.; Gillgrass, A. E.; Chenoweth, M. J.; Barra, N. G.; Chan, T.; Al-Garawi, A. A.; Chew, M. V.; Yue, G.; van Roojen, N.; Xing, Z.; Ashkar, A. A. FimH, a TLR4 Ligand, Induces Innate Antiviral Responses in the Lung Leading to Protection against Lethal Influenza Infection in Mice. Antiviral Res. 2011, 92 (2), 346355,  DOI: 10.1016/j.antiviral.2011.09.004
    53. 53
      Fan, X.; Yue, Y.; Xiong, S. Incorporation of a Bi-Functional Protein FimH Enhances the Immunoprotection of Chitosan-PVP1 Vaccine against Coxsackievirus B3-Induced Myocarditis. Antiviral Res. 2017, 140, 121132,  DOI: 10.1016/j.antiviral.2017.01.020
    54. 54
      Salyer, A. C. D.; Caruso, G.; Khetani, K. K.; Fox, L. M.; Malladi, S. S.; David, S. A. Identification of Adjuvantic Activity of Amphotericin B in a Novel, Multiplexed, Poly-TLR/NLR High-Throughput Screen. PLoS One 2016, 11 (2), e0149848,  DOI: 10.1371/journal.pone.0149848
    55. 55
      Shirey, K. A.; Lai, W.; Scott, A. J.; Lipsky, M.; Mistry, P.; Pletneva, L. M.; Karp, C. L.; McAlees, J.; Gioannini, T. L.; Weiss, J.; Chen, W. H.; Ernst, R. K.; Rossignol, D. P.; Gusovsky, F.; Blanco, J. C. G.; Vogel, S. N. The TLR4 Antagonist Eritoran Protects Mice from Lethal Influenza Infection. Nature 2013, 497 (7450), 498502,  DOI: 10.1038/nature12118
    56. 56
      Prantner, D.; Shirey, K. A.; Lai, W.; Lu, W.; Cole, A. M.; Vogel, S. N.; Garzino-Demo, A. The θ-Defensin Retrocyclin 101 Inhibits TLR4- and TLR2-Dependent Signaling and Protects Mice against Influenza Infection. J. Leukocyte Biol. 2017, 102 (4), 11031113,  DOI: 10.1189/jlb.2A1215-567RR
    57. 57
      Hossain, M. S.; Ramachandiran, S.; Gewirtz, A. T.; Waller, E. K. Recombinant TLR5 Agonist CBLB502 Promotes NK Cell-Mediated Anti-CMV Immunity in Mice. PLoS One 2014, 9 (5), e96165,  DOI: 10.1371/journal.pone.0096165
    58. 58
      Jahanban-Esfahlan, R.; Seidi, K.; Majidinia, M.; Karimian, A.; Yousefi, B.; Nabavi, S. M.; Astani, A.; Berindan-Neagoe, I.; Gulei, D.; Fallarino, F.; Gargaro, M.; Manni, G.; Pirro, M.; Xu, S.; Sadeghi, M.; Nabavi, S. F.; Shirooie, S. Toll-like Receptors as Novel Therapeutic Targets for Herpes Simplex Virus Infection. Rev. Med. Virol. 2019, 29 (4), e2048,  DOI: 10.1002/rmv.2048
    59. 59
      Pickens, J. A.; Tripp, R. A. Verdinexor Targeting of CRM1 Is a Promising Therapeutic Approach against RSV and Influenza Viruses. Viruses 2018, 10 (1), 48,  DOI: 10.3390/v10010048
    60. 60
      Matz, K. M.; Guzman, R. M.; Goodman, A. G. The Role of Nucleic Acid Sensing in Controlling Microbial and Autoimmune Disorders. In International Review of Cell and Molecular Biology, Vol. 345; Elsevier, 2019; Chapter 2, pp 35136,  DOI: 10.1016/bs.ircmb.2018.08.002 .
    61. 61
      Uppal, T.; Sarkar, R.; Dhelaria, R.; Verma, S. C. Role of Pattern Recognition Receptors in KSHV Infection. Cancers 2018, 10 (3), 85,  DOI: 10.3390/cancers10030085
    62. 62
      Guo, H. Y.; Zhang, X. C.; Jia, R. Y. Toll-like Receptors and RIG-I-like Receptors Play Important Roles in Resisting Flavivirus. J. Immunol. Res. 2018, 2018, 6106582,  DOI: 10.1155/2018/6106582
    63. 63
      Macedo, A. B.; Novis, C. L.; Bosque, A. Targeting Cellular and Tissue HIV Reservoirs With Toll-Like Receptor Agonists. Front. Immunol. 2019, 10, 2450,  DOI: 10.3389/fimmu.2019.02450
    64. 64
      Das, D.; Sengupta, I.; Sarkar, N.; Pal, A.; Saha, D.; Bandopadhyay, M.; Das, C.; Narayan, J.; Singh, S. P.; Chakrabarti, S.; Chakravarty, R. Anti-Hepatitis B Virus (HBV) Response of Imiquimod Based Toll like Receptor 7 Ligand in Hbv-Positive Human Hepatocelluar Carcinoma Cell Line. BMC Infect. Dis. 2017, 17 (1), 112,  DOI: 10.1186/s12879-017-2189-z
    65. 65
      Lebold, K. M.; Jacoby, D. B.; Drake, M. G. Toll-Like Receptor 7-Targeted Therapy in Respiratory Disease. Transfus. Med. Hemotherapy 2016, 43 (2), 114119,  DOI: 10.1159/000445324
    66. 66
      Vanwalscappel, B.; Tada, T.; Landau, N. R. Toll-like Receptor Agonist R848 Blocks Zika Virus Replication by Inducing the Antiviral Protein Viperin. Virology 2018, 522, 199208,  DOI: 10.1016/j.virol.2018.07.014
    67. 67
      Sui, Y.; Berzofsky, J. A. Myeloid Cell-Mediated Trained Innate Immunity in Mucosal AIDS Vaccine Development. Front. Immunol. 2020, 11, 315,  DOI: 10.3389/fimmu.2020.00315
    68. 68
      Miller, S. M.; Cybulski, V.; Whitacre, M.; Bess, L. S.; Livesay, M. T.; Walsh, L.; Burkhart, D.; Bazin, H. G.; Evans, J. T. Novel Lipidated Imidazoquinoline TLR7/8 Adjuvants Elicit Influenza-Specific Th1 Immune Responses and Protect Against Heterologous H3N2 Influenza Challenge in Mice. Front. Immunol. 2020, 11, 406,  DOI: 10.3389/fimmu.2020.00406
    69. 69
      Macedo, A. B.; Novis, C. L.; De Assis, C. M.; Sorensen, E. S.; Moszczynski, P.; Huang, S. H.; Ren, Y.; Spivak, A. M.; Jones, R. B.; Planelles, V.; Bosque, A. Dual TLR2 and TLR7 Agonists as HIV Latency-Reversing Agents. JCI insight 2018, 3 (19), e122673,  DOI: 10.1172/jci.insight.122673
    70. 70
      Hu, Y.; Tang, L.; Zhu, Z.; Meng, H.; Chen, T.; Zhao, S.; Jin, Z.; Wang, Z.; Jin, G. A Novel TLR7 Agonist as Adjuvant to Stimulate High Quality HBsAg-Specific Immune Responses in an HBV Mouse Model. J. Transl. Med. 2020, 18 (1), 112,  DOI: 10.1186/s12967-020-02275-2
    71. 71
      Chan, M.; Hayashi, T.; Kuy, C. S.; Gray, C. S.; Wu, C. C. N.; Corr, M.; Wrasidlo, W.; Cottam, H. B.; Carson, D. A. Synthesis and Immunological Characterization of Toll-Like Receptor 7 Agonistic Conjugates. Bioconjugate Chem. 2009, 20 (6), 11941200,  DOI: 10.1021/bc900054q
    72. 72
      McGowan, D.; Herschke, F.; Pauwels, F.; Stoops, B.; Last, S.; Pieters, S.; Scholliers, A.; Thoné, T.; Van Schoubroeck, B.; De Pooter, D.; Mostmans, W.; Khamlichi, M. D.; Embrechts, W.; Dhuyvetter, D.; Smyej, I.; Arnoult, E.; Demin, S.; Borghys, H.; Fanning, G.; Vlach, J.; Raboisson, P. Novel Pyrimidine Toll-like Receptor 7 and 8 Dual Agonists to Treat Hepatitis B Virus. J. Med. Chem. 2016, 59 (17), 79367949,  DOI: 10.1021/acs.jmedchem.6b00747
    73. 73
      Embrechts, W.; Herschke, F.; Pauwels, F.; Stoops, B.; Last, S.; Pieters, S.; Pande, V.; Pille, G.; Amssoms, K.; Smyej, I.; Dhuyvetter, D.; Scholliers, A.; Mostmans, W.; Van Dijck, K.; Van Schoubroeck, B.; Thone, T.; De Pooter, D.; Fanning, G.; Jonckers, T. H. M.; Horton, H.; Raboisson, P.; McGowan, D. 2,4-Diaminoquinazolines as Dual Toll-like Receptor (TLR) 7/8 Modulators for the Treatment of Hepatitis B Virus. J. Med. Chem. 2018, 61 (14), 62366246,  DOI: 10.1021/acs.jmedchem.8b00643
    74. 74
      McGowan, D. C.; Herschke, F.; Pauwels, F.; Stoops, B.; Smyej, I.; Last, S.; Pieters, S.; Embrechts, W.; Khamlichi, M. D.; Thoné, T.; Van Schoubroeck, B.; Mostmans, W.; Wuyts, D.; Verstappen, D.; Scholliers, A.; De Pooter, D.; Dhuyvetter, D.; Borghys, H.; Tuefferd, M.; Arnoult, E.; Hong, J.; Fanning, G.; Bollekens, J.; Urmaliya, V.; Teisman, A.; Horton, H.; Jonckers, T. H. M.; Raboisson, P. Identification and Optimization of Pyrrolo[3,2-d]Pyrimidine Toll-like Receptor 7 (TLR7) Selective Agonists for the Treatment of Hepatitis B. J. Med. Chem. 2017, 60 (14), 61376151,  DOI: 10.1021/acs.jmedchem.7b00365
    75. 75
      Wang, H.-f.; Wang, S.-s.; Tang, Y.-J.; Chen, Y.; Zheng, M.; Tang, Y.-l.; Liang, X.-h. The Double-Edged Sword—How Human Papillomaviruses Interact with Immunity in Head and Neck Cancer. Front. Immunol. 2019, 10, 653,  DOI: 10.3389/fimmu.2019.00653
    76. 76
      Martinelli, E.; Cicala, C.; Van Ryk, D.; Goode, D. J.; Macleod, K.; Arthos, J.; Fauci, A. S. HIV-1 Gp120 Inhibits TLR9-Mediated Activation and IFN-α Secretion in Plasmacytoid Dendritic Cells. Proc. Natl. Acad. Sci. U. S. A. 2007, 104 (9), 33963401,  DOI: 10.1073/pnas.0611353104
    77. 77
      Kaminski, J. J.; Schattgen, S. A.; Tzeng, T.; Bode, C.; Klinman, D. M.; Fitzgerald, K. A. Synthetic Oligodeoxynucleotides Containing Suppressive TTAGGG Motifs Inhibit AIM2 Inflammasome Activation. J. Immunol. 2013, 191 (7), 38763883,  DOI: 10.4049/jimmunol.1300530
    78. 78
      Noh, J. Y.; Yoon, S. R.; Kim, T. D.; Choi, I.; Jung, H. Toll-Like Receptors in Natural Killer Cells and Their Application for Immunotherapy. J. Immunol. Res. 2020, 2020, 2045860,  DOI: 10.1155/2020/2045860
    79. 79
      Chen, L.; Yu, J. Modulation of Toll-like Receptor Signaling in Innate Immunity by Natural Products. Int. Immunopharmacol. 2016, 37, 6570,  DOI: 10.1016/j.intimp.2016.02.005
    80. 80
      Fraietta, J. A.; Mueller, Y. M.; Do, D. H.; Holmes, V. M.; Howett, M. K.; Lewis, M. G.; Boesteanu, A. C.; Alkan, S. S.; Katsikis, P. D. Phosphorothioate 2′ Deoxyribose Oligomers as Microbicides That Inhibit Human Immunodeficiency Virus Type 1 (HIV-1) Infection and Block Toll-like Receptor 7 (TLR7) and TLR9 Triggering by HIV-1. Antimicrob. Agents Chemother. 2010, 54 (10), 40644073,  DOI: 10.1128/AAC.00367-10
    81. 81
      Udgata, A.; Dolasia, K.; Ghosh, S.; Mukhopadhyay, S. Dribbling through the Host Defence: Targeting the TLRs by Pathogens. Crit. Rev. Microbiol. 2019, 45 (3), 354368,  DOI: 10.1080/1040841X.2019.1608904
    82. 82
      Oliveira-Nascimento, L.; Massari, P.; Wetzler, L. M. The Role of TLR2 in Infection and Immunity. Front. Immunol. 2012, 3, 117,  DOI: 10.3389/fimmu.2012.00079
    83. 83
      Vidya, M. K.; Kumar, V. G.; Sejian, V.; Bagath, M.; Krishnan, G.; Bhatta, R. Toll-like Receptors: Significance, Ligands, Signaling Pathways, and Functions in Mammals. Int. Rev. Immunol. 2018, 37 (1), 2036,  DOI: 10.1080/08830185.2017.1380200
    84. 84
      Fitzgerald, K. A.; Kagan, J. C. Toll-like Receptors and the Control of Immunity. Cell 2020, 180 (6), 10441066,  DOI: 10.1016/j.cell.2020.02.041
    85. 85
      Mifsud, E. J.; Tan, A. C. L.; Jackson, D. C. TLR Agonists as Modulators of the Innate Immune Response and Their Potential as Agents against Infectious Disease. Front. Immunol. 2014, 5, 79,  DOI: 10.3389/fimmu.2014.00079
    86. 86
      Salunke, D. B.; Connelly, S. W.; Shukla, N. M.; Hermanson, A. R.; Fox, L. M.; David, S. A. Design and Development of Stable, Water-Soluble, Human Toll-like Receptor 2 Specific Monoacyl Lipopeptides as Candidate Vaccine Adjuvants. J. Med. Chem. 2013, 56 (14), 58855900,  DOI: 10.1021/jm400620g
    87. 87
      Tan, A. C. L.; Deliyannis, G.; Bharadwaj, M.; Brown, L. E.; Zeng, W.; Jackson, D. C. The Design and Proof of Concept for a CD8+ T Cell-Based Vaccine Inducing Cross-Subtype Protection against Influenza A Virus. Immunol. Cell Biol. 2013, 91 (1), 96104,  DOI: 10.1038/icb.2012.54
    88. 88
      Mifsud, E. J.; Tan, A. C.; Short, K. R.; Brown, L. E.; Chua, B. Y.; Jackson, D. C. Reducing the Impact of Influenza-Associated Secondary Pneumococcal Infections. Immunol. Cell Biol. 2016, 94 (1), 101108,  DOI: 10.1038/icb.2015.71
    89. 89
      Wu, W.; Li, R.; Malladi, S. S.; Warshakoon, H. J.; Kimbrell, M. R.; Amolins, M. W.; Ukani, R.; Datta, A.; David, S. A. Structure-Activity Relationships in Toll-like Receptor-2 Agonistic Diacylthioglycerol Lipopeptides. J. Med. Chem. 2010, 53 (8), 31983213,  DOI: 10.1021/jm901839g
    90. 90
      Salunke, D. B.; Shukla, N. M.; Yoo, E.; Crall, B. M.; Balakrishna, R.; Malladi, S. S.; David, S. A. Structure-Activity Relationships in Human Toll-like Receptor 2-Specific Monoacyl Lipopeptides. J. Med. Chem. 2012, 55 (7), 33533363,  DOI: 10.1021/jm3000533
    91. 91
      Steinhagen, F.; Kinjo, T.; Bode, C.; Klinman, D. M. TLR-Based Immune Adjuvants. Vaccine 2011, 29 (17), 33413355,  DOI: 10.1016/j.vaccine.2010.08.002
    92. 92
      Luo, Y.; Friese, O. V.; Runnels, H. A.; Khandke, L.; Zlotnick, G.; Aulabaugh, A.; Gore, T.; Vidunas, E.; Raso, S. W.; Novikova, E.; Byrne, E.; Schlittler, M.; Stano, D.; Dufield, R. L.; Kumar, S.; Anderson, A. S.; Jansen, K. U.; Rouse, J. C. The Dual Role of Lipids of the Lipoproteins in Trumenba, a Self-Adjuvanting Vaccine Against Meningococcal Meningitis B Disease. AAPS J. 2016, 18 (6), 15621575,  DOI: 10.1208/s12248-016-9979-x
    93. 93
      Seib, K. L.; Scarselli, M.; Comanducci, M.; Toneatto, D.; Masignani, V. Neisseria Meningitidis Factor H-Binding Protein FHbp: Key Virulence Factor and Vaccine Antigen. Expert Rev. Vaccines 2015, 14 (6), 841859,  DOI: 10.1586/14760584.2015.1016915
    94. 94
      Murgueitio, M. S.; Rakers, C.; Frank, A.; Wolber, G. Balancing Inflammation: Computational Design of Small-Molecule Toll-like Receptor Modulators. Trends Pharmacol. Sci. 2017, 38 (2), 155168,  DOI: 10.1016/j.tips.2016.10.007
    95. 95
      Cheng, K.; Gao, M.; Godfroy, J. I.; Brown, P. N.; Kastelowitz, N.; Yin, H. Specific Activation of the TLR1-TLR2 Heterodimer by Small-Molecule Agonists. Sci. Adv. 2015, 1 (3), e1400139,  DOI: 10.1126/sciadv.1400139
    96. 96
      Botos, I.; Segal, D. M.; Davies, D. R. The Structural Biology of Toll-like Receptors. Structure 2011, 19 (4), 447459,  DOI: 10.1016/j.str.2011.02.004
    97. 97
      Hu, Z.; Banothu, J.; Beesu, M.; Gustafson, C. J.; Brush, M. J. H.; Trautman, K. L.; Salyer, A. C. D.; Pathakumari, B.; David, S. A. Identification of Human Toll-like Receptor 2 - Agonistic Activity in Dihydropyridine – Quinolone Carboxamides. ACS Med. Chem. Lett. 2019, 10, 132136,  DOI: 10.1021/acsmedchemlett.8b00540
    98. 98
      Ribes, S.; Adam, N.; Ebert, S.; Regen, T.; Bunkowski, S.; Hanisch, U. K.; Nau, R. The Viral TLR3 Agonist Poly(I:C) Stimulates Phagocytosis and Intracellular Killing of Escherichia Coli by Microglial Cells. Neurosci. Lett. 2010, 482 (1), 1720,  DOI: 10.1016/j.neulet.2010.06.078
    99. 99
      Molteni, M.; Gemma, S.; Rossetti, C. The Role of Toll-Like Receptor 4 in Infectious and Noninfectious Inflammation. Mediators Inflammation 2016, 2016, 6978936,  DOI: 10.1155/2016/6978936
    100. 100
      Kumar, S.; Sunagar, R.; Gosselin, E. Bacterial Protein Toll-like-Receptor Agonists: A Novel Perspective on Vaccine Adjuvants. Front. Immunol. 2019, 10, 1144,  DOI: 10.3389/fimmu.2019.01144
    101. 101
      Needham, B. D.; Trent, M. S. Fortifying the Barrier: The Impact of Lipid A Remodelling on Bacterial Pathogenesis. Nat. Rev. Microbiol. 2013, 11, 467481,  DOI: 10.1038/nrmicro3047
    102. 102
      Fensterheim, B. A.; Young, J. D.; Luan, L.; Kleinbard, R. R.; Stothers, C. L.; Patil, N. K.; Mcatee-pereira, A. G.; Guo, Y.; Trenary, I.; Hernandez, A.; Fults, J. B.; Williams, D. L.; Sherwood, E. R.; Bohannon, J. K. The TLR4 Agonist Monophosphoryl Lipid A Drives Broad Resistance to Infection via Dynamic Reprogramming of Macrophage Metabolism. J. Immunol. 2018, 200, 37773789,  DOI: 10.4049/jimmunol.1800085
    103. 103
      Bowen, W. S.; Minns, L. A.; Johnson, D. A.; Mitchell, T. C.; Hutton, M. M.; Evans, J. T. Selective TRIF-Dependent Signaling by a Synthetic Toll-Like Receptor 4 Agonist. Sci. Signaling 2012, 5 (211), ra13,  DOI: 10.1126/scisignal.2001963
    104. 104
      Garcia, M. M.; Goicoechea, C.; Molina-Álvarez, M.; Pascual, D. Toll-like Receptor 4: A Promising Crossroads in the Diagnosis and Treatment of Several Pathologies. Eur. J. Pharmacol. 2020, 874, 172975,  DOI: 10.1016/j.ejphar.2020.172975
    105. 105
      Yang, J.; Yan, H. TLR5: Beyond the Recognition of Flagellin. Cell. Mol. Immunol. 2017, 14, 10171019,  DOI: 10.1038/cmi.2017.122
    106. 106
      Song, W. S.; Jeon, Y. J.; Namgung, B.; Hong, M.; Yoon, S. Il. A Conserved TLR5 Binding and Activation Hot Spot on Flagellin. Sci. Rep. 2017, 7, 40878,  DOI: 10.1038/srep40878
    107. 107
      Taylor, D. N.; Treanor, J. J.; Strout, C.; Johnson, C.; Fitzgerald, T.; Kavita, U.; Ozer, K.; Tussey, L.; Shaw, A. Induction of a Potent Immune Response in the Elderly Using the TLR-5 Agonist, Flagellin, with a Recombinant Hemagglutinin Influenza-Flagellin Fusion Vaccine (VAX125, STF2.HA1 SI). Vaccine 2011, 29 (31), 48974902,  DOI: 10.1016/j.vaccine.2011.05.001
    108. 108
      Yan, L.; Liang, J.; Yao, C.; Wu, P.; Zeng, X.; Cheng, K.; Yin, H. Pyrimidine Triazole Thioether Derivatives as Toll-Like Receptor 5 (TLR5)/Flagellin Complex Inhibitors. ChemMedChem 2016, 11 (8), 822826,  DOI: 10.1002/cmdc.201500471
    109. 109
      Kauppila, J. H.; Mattila, A. E.; Karttunen, T. J.; Salo, T. Toll-like Receptor 5 and the Emerging Role of Bacteria in Carcinogenesis. Oncoimmunology 2013, 2 (4), e23620,  DOI: 10.4161/onci.23620
    110. 110
      Yazar, V.; Kilic, G.; Bulut, O.; Canavar Yildirim, T.; Yagci, F. C; Aykut, G.; Klinman, D. M; Gursel, M.; Gursel, I. A Suppressive Oligodeoxynucleotide Expressing TTAGGG Motifs Modulates Cellular Energetics through the MTOR Signaling Pathway. Int. Immunol. 2020, 32 (1), 3948,  DOI: 10.1093/intimm/dxz059
    111. 111
      Relitti, N.; Saraswati, A. P.; Federico, S.; Khan, T.; Brindisi, M.; Zisterer, D.; Brogi, S.; Gemma, S.; Butini, S.; Campiani, G. Telomerase-Based Cancer Therapeutics: A Review on Their Clinical Trials. Curr. Top. Med. Chem. 2020, 20 (6), 433457,  DOI: 10.2174/1568026620666200102104930
    112. 112
      Saraswati, A. P.; Relitti, N.; Brindisi, M.; Gemma, S.; Zisterer, D.; Butini, S.; Campiani, G. Raising the Bar in Anticancer Therapy: Recent Advances in, and Perspectives on, Telomerase Inhibitors. Drug Discovery Today 2019, 24 (7), 13701388,  DOI: 10.1016/j.drudis.2019.05.015
    113. 113
      Golenkina, E. A.; Viryasova, G. M.; Dolinnaya, N. G.; Bannikova, V. A.; Gaponova, T. V.; Romanova, Y. M.; Sud'ina, G. F. The Potential of Telomeric G-Quadruplexes Containing Modified Oligoguanosine Overhangs in Activation of Bacterial Phagocytosis and Leukotriene Synthesis in Human Neutrophils. Biomolecules 2020, 10, 249,  DOI: 10.3390/biom10020249
    114. 114
      Yeh, D.-W.; Lai, C.-Y.; Liu, Y.-L.; Lu, C.-H.; Tseng, P.-H.; Yuh, C.-H.; Yu, G.-Y.; Liu, S.-J.; Leng, C.-H.; Chuang, T.-H. CpG-Oligodeoxynucleotides Developed for Grouper Toll-like Receptor (TLR) 21s Effectively Activate Mouse and Human TLR9s Mediated Immune Responses. Sci. Rep. 2017, 7, 17297,  DOI: 10.1038/s41598-017-17609-2
    115. 115
      Mohamed, W.; Domann, E.; Chakraborty, T.; Mannala, G.; Lips, K. S.; Heiss, C.; Schnettler, R.; Alt, V. TLR9Mediates S. Aureus Killing inside Osteoblasts via Induction of Oxidative Stress. BMC Microbiol. 2016, 16, 230,  DOI: 10.1186/s12866-016-0855-8
    116. 116
      Kim, T. H.; Kim, D.; Lee, H.; Kwak, M. H.; Park, S.; Lee, Y.; Kwon, H. J. CpG-DNA Induces Bacteria-Reactive IgM Enhancing Phagocytic Activity against Staphylococcus Aureus Infection. BMB Rep. 2019, 52 (11), 635640,  DOI: 10.5483/BMBRep.2019.52.11.018
    117. 117
      Duggan, J. M.; You, D.; Cleaver, J. O.; Larson, D. T.; Garza, R. J.; Guzmán Pruneda, F. A.; Tuvim, M. J.; Zhang, J.; Dickey, B. F.; Evans, S. E. Synergistic Interactions of TLR2/6 and TLR9 Induce a High Level of Resistance to Lung Infection in Mice. J. Immunol. 2011, 186 (10), 59165926,  DOI: 10.4049/jimmunol.1002122
    118. 118
      Savva, A.; Roger, T. TargetingToll-like Receptors : Promising Therapeutic Strategies for the Management of Sepsis-Associated Pathology and Infectious Diseases. Front. Immunol. 2013, 4, 387,  DOI: 10.3389/fimmu.2013.00387
    119. 119
      Kuzmich, N. N.; Sivak, K. V.; Chubarev, V. N.; Porozov, Y. B.; Savateeva-lyubimova, T. N.; Peri, F. TLR4 Signaling Pathway Modulators as Potential Therapeutics in Inflammation and Sepsis. Vaccines 2017, 5, 34,  DOI: 10.3390/vaccines5040034
    120. 120
      Steinhagen, F.; Schmidt, S. V.; Schewe, J.; Peukert, K.; Klinman, D. M.; Bode, C. Immunotherapy in Sepsis - Brake or Accelerate?. Pharmacol. Ther. 2020, 208, 107476,  DOI: 10.1016/j.pharmthera.2020.107476
    121. 121
      Chavez, S. A.; Martinko, A. J.; Lau, C.; Pham, M. N.; Cheng, K.; Bevan, D. E.; Mollnes, T. E.; Yin, H. Development of β -Amino Alcohol Derivatives That Inhibit Toll-like Receptor 4 Mediated Inflammatory Response as Potential Antiseptics. J. Med. Chem. 2011, 54, 46594669,  DOI: 10.1021/jm2003365
    122. 122
      Cighetti, R.; Ciaramelli, C.; Sestito, E.; Zanoni, I.; Kubik, Ł.; Arda-Freire, A.; Calabrese, V.; Granucci, F.; Jerala, R.; Martín-Santamaría, S.; Jimenez-Barbero, J.; Peri, F. Modulation of CD14 and TLR4 · MD-2 Activities by a Synthetic Lipid A Mimetic. ChemBioChem 2014, 15, 250258,  DOI: 10.1002/cbic.201300588
    123. 123
      Zaffaroni, L.; Peri, F. Recent Advances on Toll-like Receptor 4 Modulation: New Therapeutic Perspectives. Future Med. Chem. 2018, 10 (4), 461476,  DOI: 10.4155/fmc-2017-0172
    124. 124
      Liang, Q.; Wu, Q.; Jiang, J.; Duan, J.; Wang, C.; Smith, M. D.; Lu, H.; Wang, Q.; Nagarkatti, P.; Fan, D. Characterization of Sparstolonin B, a Chinese Herb-Derived Compound, as a Selective Toll-like Receptor Antagonist with Potent Anti-Inflammatory Properties. J. Biol. Chem. 2011, 286 (30), 2647026479,  DOI: 10.1074/jbc.M111.227934
    125. 125
      Pollock, J. A.; Sharma, N.; Ippagunta, S. K.; Redecke, V.; Häcker, H.; Katzenellenbogen, J. A. Triaryl Pyrazole Toll-Like Receptor Signaling Inhibitors: Structure–Activity Relationships Governing Pan- and Selective Signaling Inhibitors. ChemMedChem 2018, 13 (20), 22082216,  DOI: 10.1002/cmdc.201800417
    126. 126
      Paul, B.; Rahaman, O.; Roy, S.; Pal, S.; Satish, S.; Mukherjee, A.; Ghosh, A. R.; Raychaudhuri, D.; Bhattacharya, R.; Goon, S.; Ganguly, D.; Talukdar, A. Activity-Guided Development of Potent and Selective Toll-like Receptor 9 Antagonists. Eur. J. Med. Chem. 2018, 159, 187205,  DOI: 10.1016/j.ejmech.2018.09.058
    127. 127
      D’Alessandro, S.; Alfano, G.; Di Cerbo, L.; Brogi, S.; Chemi, G.; Relitti, N.; Brindisi, M.; Lamponi, S.; Novellino, E.; Campiani, G.; Gemma, S.; Basilico, N.; Taramelli, D.; Baratto, M. C.; Pogni, R.; Butini, S. Bridged Bicyclic 2,3-Dioxabicyclo[3.3.1]Nonanes as Antiplasmodial Agents: Synthesis, Structure-Activity Relationships and Studies on Their Biomimetic Reaction with Fe(II). Bioorg. Chem. 2019, 89, 103020,  DOI: 10.1016/j.bioorg.2019.103020
    128. 128
      Kalantari, P. The Emerging Role of Pattern Recognition Receptors in the Pathogenesis of Malaria. Vaccines 2018, 6, 13,  DOI: 10.3390/vaccines6010013
    129. 129
      Eriksson, E. M.; Sampaio, N. G.; Schofield, L. Toll-Like Receptors and Malaria – Sensing and Susceptibility. J. Trop. Dis. 2014, 2 (1), 17,  DOI: 10.4172/2329-891X.1000126
    130. 130
      Ernest, M.; Hunja, C.; Arakura, Y.; Haraga, Y.; Abkallo, H. M.; Zeng, W.; Jackson, D. C.; Chua, B.; Culleton, R. The Toll-Like Receptor 2 Agonist PEG-Pam2Cys as an Immunochemoprophylactic and Immunochemotherapeutic against the Liver and Transmission Stages of Malaria Parasites. Int. J. Parasitol.: Drugs Drug Resist. 2018, 8 (3), 451458,  DOI: 10.1016/j.ijpddr.2018.10.006
    131. 131
      Kaur, A.; Kannan, D.; Mehta, S. K.; Singh, S.; Salunke, D. B. Synthetic Toll-like Receptor Agonists for the Development of Powerful Malaria Vaccines: A Patent Review. Expert Opin. Ther. Pat. 2018, 28 (11), 837847,  DOI: 10.1080/13543776.2018.1530217
    132. 132
      Coban, C.; Horii, T.; Akira, S.; Ishii, K. J. TLR9 and Endogenous Adjuvants of the Whole Blood-Stage Malaria Vaccine. Expert Rev. Vaccines 2010, 9 (7), 775784,  DOI: 10.1586/erv.10.60
    133. 133
      Battista, T.; Colotti, G.; Ilari, A.; Fiorillo, A. Targeting Trypanothione Reductase, a Key Enzyme in the Redox Trypanosomatid Metabolism, to Develop New Drugs against Leishmaniasis and Trypanosomiases. Molecules 2020, 25 (8), 1924,  DOI: 10.3390/molecules25081924
    134. 134
      Gemma, S.; Federico, S.; Brogi, S.; Brindisi, M.; Butini, S.; Campiani, G. Dealing with Schistosomiasis: Current Drug Discovery Strategies. Annu. Rep. Med. Chem. 2019, 53, 107138,  DOI: 10.1016/bs.armc.2019.06.002
    135. 135
      Fouzder, C.; Mukhuty, A.; Das, S.; Chattopadhyay, D. TLR Signaling on Protozoan and Helminthic Parasite Infection. IntechOpen 2020, 120,  DOI: 10.5772/intechopen.84711
    136. 136
      Mukherjee, S.; Karmakar, S.; Babu, S. P. S. TLR2 and TLR4Mediated Host Immune Responses in Major Infectious Diseases: A Review. Braz. J. Infect. Dis. 2016, 20 (2), 193204,  DOI: 10.1016/j.bjid.2015.10.011
    137. 137
      Wang, X.; Dong, L.; Ni, H.; Zhou, S.; Xu, Z.; Hoellwarth, J. S.; Chen, X.; Zhang, R.; Chen, Q.; Liu, F.; Wang, J.; Su, C. Combined TLR7/8 and TLR9 Ligands Potentiate the Activity of a Schistosoma Japonicum DNA Vaccine. PLoS Neglected Trop. Dis. 2013, 7 (4), e2164,  DOI: 10.1371/journal.pntd.0002164
    138. 138
      Bourgeois, C.; Kuchler, K. Fungal Pathogens-a Sweet and Sour Treat for Toll-like Receptors. Front. Cell. Infect. Microbiol. 2012, 2, 142,  DOI: 10.3389/fcimb.2012.00142
    139. 139
      Patin, E. C.; Thompson, A.; Orr, S. J. Pattern Recognition Receptors in Fungal Immunity. Semin. Cell Dev. Biol. 2019, 89, 2433,  DOI: 10.1016/j.semcdb.2018.03.003
    140. 140
      Martínez, A.; Bono, C.; Megías, J.; Yáñez, A.; Gozalbo, D.; Gil, M. L. Systemic Candidiasis and TLR2 Agonist Exposure Impact the Antifungal Response of Hematopoietic Stem and Progenitor Cells. Front. Cell. Infect. Microbiol. 2018, 8, 309,  DOI: 10.3389/fcimb.2018.00309
    141. 141
      Redlich, S.; Ribes, S.; Schütze, S.; Eiffert, H.; Nau, R. Toll-like Receptor Stimulation Increases Phagocytosis of Cryptococcus Neoformans by Microglial Cells. J. Neuroinflammation 2013, 10, 841,  DOI: 10.1186/1742-2094-10-71
    142. 142
      Oh, H. M.; Lee, S. W.; Park, M. H.; Kim, M. H.; Ryu, Y. B.; Kim, M. S.; Kim, H. H.; Park, K. H.; Lee, W. S.; Park, S. J.; Rho, M. C. Norkurarinol Inhibits Toll-Like Receptor 3 (TLR3)-Mediated pro-Inflammatory Signaling Pathway and Rotavirus Replication. J. Pharmacol. Sci. 2012, 118 (2), 161170,  DOI: 10.1254/jphs.11077FP
    143. 143
      Engelmann, C.; Sheikh, M.; Sharma, S.; Kondo, T.; Loeffler-Wirth, H.; Zheng, Y. B.; Novelli, S.; Hall, A.; Kerbert, A. J. C.; Macnaughtan, J.; Mookerjee, R.; Habtesion, A.; Davies, N.; Ali, T.; Gupta, S.; Andreola, F.; Jalan, R. Toll-like Receptor 4 Is a Therapeutic Target for Prevention and Treatment of Liver Failure. J. Hepatol. 2020, 73 (1), 102112,  DOI: 10.1016/j.jhep.2020.01.011
    144. 144
      Papaioannou, A. I.; Spathis, A.; Kostikas, K.; Karakitsos, P.; Papiris, S.; Rossios, C. The Role of Endosomal Toll-like Receptors in Asthma. Eur. J. Pharmacol. 2017, 808 (September), 1420,  DOI: 10.1016/j.ejphar.2016.09.033
    145. 145
      Kim, J.; Durai, P.; Jeon, D.; Jung, I. D.; Lee, S. J.; Park, Y. M.; Kim, Y. Phloretin as a Potent Natural TLR2/1 Inhibitor Suppresses TLR2-Induced Inflammation. Nutrients 2018, 10 (7), 868,  DOI: 10.3390/nu10070868
    146. 146
      Fußbroich, D.; Schubert, R.; Schneider, P.; Zielen, S.; Beermann, C. Impact of Soyasaponin I on TLR2 and TLR4 Induced Inflammation in the MUTZ-3-Cell Model. Food Funct. 2015, 6 (3), 10011010,  DOI: 10.1039/C4FO01065E
    147. 147
      Lim, H. J.; Jang, H.-J.; Kim, M. H.; Lee, S.; Lee, S. W.; Lee, S.-J.; Rho, M.-C. Oleanolic Acid Acetate Exerts Anti-Inflammatory Activity via IKKα/β Suppression in TLR3-Mediated NF-KB Activation. Molecules 2019, 24 (21), 4002,  DOI: 10.3390/molecules24214002
    148. 148
      Okada, T.; Kawakita, F.; Nishikawa, H.; Nakano, F.; Liu, L.; Suzuki, H. Selective Toll-Like Receptor 4 Antagonists Prevent Acute Blood-Brain Barrier Disruption After Subarachnoid Hemorrhage in Mice. Mol. Neurobiol. 2019, 56 (2), 976985,  DOI: 10.1007/s12035-018-1145-2
    149. 149
      Plunk, M. A.; Alaniz, A.; Olademehin, O. P.; Ellington, T. L.; Shuford, K. L.; Kane, R. R. Design and Catalyzed Activation of Tak-242 Prodrugs for Localized Inhibition of TLR4-Induced Inflammation. ACS Med. Chem. Lett. 2020, 11 (2), 141146,  DOI: 10.1021/acsmedchemlett.9b00518
    150. 150
      Facchini, F. A.; Zaffaroni, L.; Minotti, A.; Rapisarda, S.; Calabrese, V.; Forcella, M.; Fusi, P.; Airoldi, C.; Ciaramelli, C.; Billod, J. M.; Schromm, A. B.; Braun, H.; Palmer, C.; Beyaert, R.; Lapenta, F.; Jerala, R.; Pirianov, G.; Martin-Santamaria, S.; Peri, F. Structure-Activity Relationship in Monosaccharide-Based Toll-like Receptor 4 (TLR4) Antagonists. J. Med. Chem. 2018, 61 (7), 28952909,  DOI: 10.1021/acs.jmedchem.7b01803
    151. 151
      Fernández, G.; Moraga, A.; Cuartero, M. I.; García-Culebras, A.; Peña-Martínez, C.; Pradillo, J. M.; Hernández-Jiménez, M.; Sacristán, S.; Ayuso, M. I.; Gonzalo-Gobernado, R.; Fernández-López, D.; Martín, M. E.; Moro, M. A.; González, V. M.; Lizasoain, I. TLR4-Binding DNA Aptamers Show a Protective Effect against Acute Stroke in Animal Models. Mol. Ther. 2018, 26 (8), 20472059,  DOI: 10.1016/j.ymthe.2018.05.019
    152. 152
      Flacher, V.; Neuberg, P.; Point, F.; Daubeuf, F.; Muller, Q.; Sigwalt, D.; Fauny, J. D.; Remy, J. S.; Frossard, N.; Wagner, A.; Mueller, C. G.; Schaeffer, E. Mannoside Glycolipid Conjugates Display Anti-Inflammatory Activity by Inhibition of Toll-like Receptor-4 Mediated Cell Activation. ACS Chem. Biol. 2015, 10 (12), 26972705,  DOI: 10.1021/acschembio.5b00552
    153. 153
      Lu, M. Y.; Chen, C. C.; Lee, L. Y.; Lin, T. W.; Kuo, C. F. N6-(2-Hydroxyethyl)Adenosine in the Medicinal Mushroom Cordyceps Cicadae Attenuates Lipopolysaccharide-Stimulated Pro-Inflammatory Responses by Suppressing TLR4-Mediated NF-KB Signaling Pathways. J. Nat. Prod. 2015, 78 (10), 24522460,  DOI: 10.1021/acs.jnatprod.5b00573
    154. 154
      Li, S.; Gao, X.; Wu, X.; Wu, Z.; Cheng, L.; Zhu, L.; Shen, D.; Tong, X. Parthenolide Inhibits LPS-Induced Inflammatory Cytokines through the Toll-like Receptor 4 Signal Pathway in THP-1 Cells. Acta Biochim. Biophys. Sin. 2015, 47 (5), 368375,  DOI: 10.1093/abbs/gmv019
    155. 155
      Ye, S.; Zheng, Q.; Zhou, Y.; Bai, B.; Yang, D.; Zhao, Z. Chlojaponilactone B Attenuates Lipopolysaccharide-Induced Inflammatory Responses by Suppressing TLR4-Mediated ROS Generation and NF-KB Signaling Pathway. Molecules 2019, 24 (20), 3731,  DOI: 10.3390/molecules24203731
    156. 156
      He, J.; Han, S.; Li, X. X.; Wang, Q. Q.; Cui, Y.; Chen, Y.; Gao, H.; Huang, L.; Yang, S. Diethyl Blechnic Exhibits Anti-Inflammatory and Antioxidative Activity via the TLR4/MyD88 Signaling Pathway in LPS-Stimulated RAW264.7 Cells. Molecules 2019, 24 (24), 4502,  DOI: 10.3390/molecules24244502
    157. 157
      Thakur, V. R.; Beladiya, J. V.; Chaudagar, K. K.; Mehta, A. A. An Anti-Asthmatic Activity of Natural Toll-like Receptor-4 Antagonist in OVA-LPS-Induced Asthmatic Rats. Clin. Exp. Pharmacol. Physiol. 2018, 45 (11), 11871197,  DOI: 10.1111/1440-1681.13002
    158. 158
      Sun, H.; Zhu, X.; Cai, W.; Qiu, L. Hypaphorine Attenuates Lipopolysaccharide-Induced Endothelial Inflammation via Regulation of TLR4 and PPAR-γ Dependent on PI3K/Akt/MTOR Signal Pathway. Int. J. Mol. Sci. 2017, 18 (4), 844,  DOI: 10.3390/ijms18040844
    159. 159
      Malgorzata-Miller, G.; Heinbockel, L.; Brandenburg, K.; Van Der Meer, J. W. M.; Netea, M. G.; Joosten, L. A. B. Bartonella Quintana Lipopolysaccharide (LPS): Structure and Characteristics of a Potent TLR4 Antagonist for in-Vitro and in-Vivo Applications. Sci. Rep. 2016, 6, 34221,  DOI: 10.1038/srep34221
    160. 160
      Shih, T. L.; Liu, M. H.; Li, C. W.; Kuo, C. F. Halo-Substituted Chalcones and Azachalcones-Inhibited, Lipopolysaccharited-Stimulated, pro-Inflammatory Responses through the TLR4-Mediated Pathway. Molecules 2018, 23 (3), 597,  DOI: 10.3390/molecules23030597
    161. 161
      Guo, X. Y.; Cao, Q. Y.; Tang, Y. M.; Liang, Q. L. Simple Synthesis and Anti-Inflammatory Activities of Spanrstolonin B Derivatives. Phytochem. Lett. 2018, 24, 158162,  DOI: 10.1016/j.phytol.2018.02.011
    162. 162
      Arora, S.; Ahmad, S.; Irshad, R.; Goyal, Y.; Rafat, S.; Siddiqui, N.; Dev, K.; Husain, M.; Ali, S.; Mohan, A.; Syed, M. A. TLRs in Pulmonary Diseases. Life Sci. 2019, 233, 116671,  DOI: 10.1016/j.lfs.2019.116671
    163. 163
      Biggadike, K.; Ahmed, M.; Ball, D. I.; Coe, D. M.; Dalmas Wilk, D. A.; Edwards, C. D.; Gibbon, B. H.; Hardy, C. J.; Hermitage, S. A.; Hessey, J. O.; Hillegas, A. E.; Hughes, S. C.; Lazarides, L.; Lewell, X. Q.; Lucas, A.; Mallett, D. N.; Price, M. A.; Priest, F. M.; Quint, D. J.; Shah, P.; Sitaram, A.; Smith, S. A.; Stocker, R.; Trivedi, N. A.; Tsitoura, D. C.; Weller, V. Discovery of 6-Amino-2-{[(1S)-1-Methylbutyl]Oxy}-9-[5-(1-Piperidinyl)Pentyl]-7,9-Dihydro-8H-Purin-8-One (GSK2245035), a Highly Potent and Selective Intranasal Toll-Like Receptor 7 Agonist for the Treatment of Asthma. J. Med. Chem. 2016, 59 (5), 17111726,  DOI: 10.1021/acs.jmedchem.5b01647
    164. 164
      Yoo, E.; Crall, B. M.; Balakrishna, R.; Malladi, S. S.; Fox, L. M.; Hermanson, A. R.; David, S. A. Structure-Activity Relationships in Toll-like Receptor 7 Agonistic 1H-Imidazo[4,5-c]Pyridines. Org. Biomol. Chem. 2013, 11 (38), 65266545,  DOI: 10.1039/c3ob40816g
    165. 165
      Beesu, M.; Caruso, G.; Salyer, A. C. D.; Shukla, N. M.; Khetani, K. K.; Smith, L. J.; Fox, L. M.; Tanji, H.; Ohto, U.; Shimizu, T.; David, S. A. Identification of a Human Toll-Like Receptor (TLR) 8-Specific Agonist and a Functional Pan-TLR Inhibitor in 2-Aminoimidazoles. J. Med. Chem. 2016, 59 (7), 33113330,  DOI: 10.1021/acs.jmedchem.6b00023
    166. 166
      Beesu, M.; Salyer, A. C. D.; Trautman, K. L.; Hill, J. K.; David, S. A. Human Toll-like Receptor (TLR) 8-Specific Agonistic Activity in Substituted Pyrimidine-2,4-Diamines. J. Med. Chem. 2016, 59 (17), 80828093,  DOI: 10.1021/acs.jmedchem.6b00872
    167. 167
      Jiang, S.; Tanji, H.; Yin, K.; Zhang, S.; Sakaniwa, K.; Huang, J.; Yang, Y.; Li, J.; Ohto, U.; Shimizu, T.; Yin, H. Rationally Designed Small-Molecule Inhibitors Targeting an Unconventional Pocket on the TLR8 Protein–Protein Interface. J. Med. Chem. 2020, 63 (8), 41174132,  DOI: 10.1021/acs.jmedchem.9b02128
    168. 168
      Cheng, B.; Yuan, W. E.; Su, J.; Liu, Y.; Chen, J. Recent Advances in Small Molecule Based Cancer Immunotherapy. Eur. J. Med. Chem. 2018, 157, 582598,  DOI: 10.1016/j.ejmech.2018.08.028
    169. 169
      Basith, S.; Manavalan, B.; Yoo, T. H.; Kim, S. G.; Choi, S. Roles of Toll-like Receptors in Cancer: A Double-Edged Sword for Defense and Offense. Arch. Pharmacal Res. 2012, 35 (8), 12971316,  DOI: 10.1007/s12272-012-0802-7
    170. 170
      Hennessy, E. J.; Parker, A. E.; O’Neill, L. A. J. Targeting Toll-like Receptors: Emerging Therapeutics?. Nat. Rev. Drug Discovery 2010, 9 (4), 293307,  DOI: 10.1038/nrd3203
    171. 171
      Pradere, J. P.; Dapito, D. H.; Schwabe, R. F. The Yin and Yang of Toll-like Receptors in Cancer. Oncogene 2014, 33 (27), 34853495,  DOI: 10.1038/onc.2013.302
    172. 172
      Schmidt, J.; Welsch, T.; Jäger, D.; Mühlradt, P. F.; Büchler, M. W.; Märten, A. Intratumoural Injection of the Toll-like Receptor-2/6 Agonist ‘Macrophage-Activating Lipopeptide-2′ in Patients with Pancreatic Carcinoma: A Phase I/II Trial. Br. J. Cancer 2007, 97 (5), 598604,  DOI: 10.1038/sj.bjc.6603903
    173. 173
      Ingale, S.; Wolfert, M. A.; Buskas, T.; Boons, G. J. Increasing the Antigenicity of Synthetic Tumor-Associated Carbohydrate Antigens by Targeting Toll-like Receptors. ChemBioChem 2009, 10 (3), 455463,  DOI: 10.1002/cbic.200800596
    174. 174
      Abdel-Aal, A. B. M.; Lakshminarayanan, V.; Thompson, P.; Supekar, N.; Bradley, J. M.; Wolfert, M. A.; Cohen, P. A.; Gendler, S. J.; Boons, G. J. Immune and Anticancer Responses Elicited by Fully Synthetic Aberrantly Glycosylated MUC1 Tripartite Vaccines Modified by a TLR2 or TLR9 Agonist. ChemBioChem 2014, 15 (10), 15081513,  DOI: 10.1002/cbic.201402077
    175. 175
      Shi, L.; Cai, H.; Huang, Z. H.; Sun, Z. Y.; Chen, Y. X.; Zhao, Y. F.; Kunz, H.; Li, Y. M. Synthetic MUC1 Antitumor Vaccine Candidates with Varied Glycosylation Pattern Bearing R/S-Configured Pam3CysSerLys4. ChemBioChem 2016, 17, 14121415,  DOI: 10.1002/cbic.201600206
    176. 176
      Willems, M. M. J. H. P.; Zom, G. G.; Khan, S.; Meeuwenoord, N.; Melief, C. J. M.; Van Der Stelt, M.; Overkleeft, H. S.; Codée, J. D. C.; Van Der Marel, G. A.; Ossendorp, F.; Filippov, D. V. N-Tetradecylcarbamyl Lipopeptides as Novel Agonists for Toll-like Receptor 2. J. Med. Chem. 2014, 57 (15), 68736878,  DOI: 10.1021/jm500722p
    177. 177
      Zom, G. G.; Willems, M. M. J. H. P.; Khan, S.; Van Der Sluis, T. C.; Kleinovink, J. W.; Camps, M. G. M.; Van Der Marel, G. A.; Filippov, D. V.; Melief, C. J. M.; Ossendorp, F. Novel TLR2-Binding Adjuvant Induces Enhanced T Cell Responses and Tumor Eradication. J. Immunother. Cancer 2018, 6, 146,  DOI: 10.1186/s40425-018-0455-2
    178. 178
      Huynh, A. S.; Chung, W. J.; Cho, H. Il; Moberg, V. E.; Celis, E.; Morse, D. L.; Vagner, J. Novel Toll-like Receptor 2 Ligands for Targeted Pancreatic Cancer Imaging and Immunotherapy. J. Med. Chem. 2012, 55 (22), 97519762,  DOI: 10.1021/jm301002f
    179. 179
      Bowdish, D. M. E.; Sakamoto, K.; Kim, M.-J.; Kroos, M.; Mukhopadhyay, S.; Leifer, C. A.; Tryggvason, K.; Gordon, S.; Russell, D. G. MARCO, TLR2, and CD14 Are Required for Macrophage Cytokine Responses to Mycobacterial Trehalose Dimycolate and Mycobacterium Tuberculosis. PLoS Pathog. 2009, 5 (6), e1000474,  DOI: 10.1371/journal.ppat.1000474
    180. 180
      Yamamoto, H.; Oda, M.; Nakano, M.; Watanabe, N.; Yabiku, K.; Shibutani, M.; Inoue, M.; Imagawa, H.; Nagahama, M.; Himeno, S.; Setsu, K.; Sakurai, J.; Nishizawa, M. Development of Vizantin, a Safe Immunostimulant, Based on the Structure-Activity Relationship of Trehalose-6,6′-Dicorynomycolate. J. Med. Chem. 2013, 56 (1), 381385,  DOI: 10.1021/jm3016443
    181. 181
      Morin, M. D.; Wang, Y.; Jones, B. T.; Mifune, Y.; Su, L.; Shi, H.; Moresco, E. M. Y.; Zhang, H.; Beutler, B.; Boger, D. L. Diprovocims: A New and Exceptionally Potent Class of Toll-like Receptor Agonists. J. Am. Chem. Soc. 2018, 140 (43), 1444014454,  DOI: 10.1021/jacs.8b09223
    182. 182
      Wang, Y.; Su, L.; Morin, M. D.; Jones, B. T.; Mifune, Y.; Shi, H.; Wang, K.-w.; Zhan, X.; Liu, A.; Wang, J.; Li, X.; Tang, M.; Ludwig, S.; Hildebrand, S.; Zhou, K.; Siegwart, D. J.; Moresco, E. M. Y.; Zhang, H.; Boger, D. L.; Beutler, B. Adjuvant Effect of the Novel TLR1/TLR2 Agonist Diprovocim Synergizes with Anti–PD-L1 to Eliminate Melanoma in Mice. Proc. Natl. Acad. Sci. U. S. A. 2018, 115 (37), E8698E8706,  DOI: 10.1073/pnas.1809232115
    183. 183
      Su, L.; Wang, Y.; Wang, J.; Mifune, Y.; Morin, M. D.; Jones, B. T.; Moresco, E. M. Y.; Boger, D. L.; Beutler, B.; Zhang, H. Structural Basis of TLR2/TLR1 Activation by the Synthetic Agonist Diprovocim. J. Med. Chem. 2019, 62 (6), 29382949,  DOI: 10.1021/acs.jmedchem.8b01583
    184. 184
      Cen, X.; Zhu, G.; Yang, J.; Yang, J.; Guo, J.; Jin, J.; Nandakumar, K. S.; Yang, W.; Yin, H.; Liu, S.; Cheng, K. TLR1/2 Specific Small-Molecule Agonist Suppresses Leukemia Cancer Cell Growth by Stimulating Cytotoxic T Lymphocytes. Adv. Sci. 2019, 6 (10), 1802042,  DOI: 10.1002/advs.201802042
    185. 185
      Chen, Z.; Cen, X.; Yang, J.; Tang, X.; Cui, K.; Cheng, K. Structure-Based Discovery of a Specific TLR1-TLR2 Small Molecule Agonist from the ZINC Drug Library Database. Chem. Commun. 2018, 54 (81), 1141111414,  DOI: 10.1039/C8CC06618C
    186. 186
      Kitada, S.; Leone, M.; Sareth, S.; Zhai, D.; Reed, J. C.; Pellecchia, M. Discovery, Characterization, and Structure - Activity Relationships Studies of Proapoptotic Polyphenols Targeting B-Cell Lymphocyte/Leukemia-2 Proteins. J. Med. Chem. 2003, 46 (20), 42594264,  DOI: 10.1021/jm030190z
    187. 187
      Cheng, K.; Wang, X.; Zhang, S.; Yin, H. Discovery of Small-Molecule Inhibitors of the TLR1/TLR2 Complex. Angew. Chem., Int. Ed. 2012, 51 (49), 1224612249,  DOI: 10.1002/anie.201204910
    188. 188
      Xu, Y. Y.; Chen, L.; Zhou, I. M.; Wu, Y. Y.; Zhu, Y. Y. Inhibitory Effect of DsRNA TLR3 Agonist in a Rat Hepatocellular Carcinoma Model. Mol. Med. Rep. 2013, 8 (4), 10371042,  DOI: 10.3892/mmr.2013.1646
    189. 189
      Basith, S.; Manavalan, B.; Lee, G.; Kim, S. G.; Choi, S. Toll-like Receptor Modulators: A Patent Review (2006 - 2010). Expert Opin. Ther. Pat. 2011, 21 (6), 927944,  DOI: 10.1517/13543776.2011.569494
    190. 190
      Matsumoto, M.; Takeda, Y.; Seya, T. Targeting Toll-like Receptor 3 in Dendritic Cells for Cancer Immunotherapy. Expert Opin. Biol. Ther. 2020, 20 (8), 937946,  DOI: 10.1080/14712598.2020.1749260
    191. 191
      Seya, T.; Takeda, Y.; Matsumoto, M. A Toll-like Receptor 3 (TLR3) Agonist ARNAX for Therapeutic Immunotherapy. Adv. Drug Delivery Rev. 2019, 147, 3743,  DOI: 10.1016/j.addr.2019.07.008
    192. 192
      Wang, Y.; Tu, Q.; Yan, W.; Xiao, D.; Zeng, Z.; Ouyang, Y.; Huang, L.; Cai, J.; Zeng, X.; Chen, Y. J.; Liu, A. CXC195 Suppresses Proliferation and Inflammatory Response in LPS-Induced Human Hepatocellular Carcinoma Cells via Regulating TLR4-MyD88-TAK1-Mediated NF-KB and MAPK Pathway. Biochem. Biophys. Res. Commun. 2015, 456 (1), 373379,  DOI: 10.1016/j.bbrc.2014.11.090
    193. 193
      Liu, H.; Zhang, G.; Huang, J.; Ma, S.; Mi, K.; Cheng, J.; Zhu, Y.; Zha, X.; Huang, W. Atractylenolide I Modulates Ovarian Cancer Cell-Mediated Immunosuppression by Blocking MD-2/TLR4 Complex-Mediated MyD88/NF-KB Signaling in Vitro. J. Transl. Med. 2016, 14 (1), 415,  DOI: 10.1186/s12967-016-0845-5
    194. 194
      Zandi, Z.; Kashani, B.; Poursani, E. M.; Bashash, D.; Kabuli, M.; Momeny, M.; Mousavi-pak, S. H.; Sheikhsaran, F.; Alimoghaddam, K.; Mousavi, S. A.; Ghaffari, S. H. TLR4 Blockade Using TAK-242 Suppresses Ovarian and Breast Cancer Cells Invasion through the Inhibition of Extracellular Matrix Degradation and Epithelial-Mesenchymal Transition. Eur. J. Pharmacol. 2019, 853, 256263,  DOI: 10.1016/j.ejphar.2019.03.046
    195. 195
      Kashani, B.; Zandi, Z.; Karimzadeh, M. R.; Bashash, D.; Nasrollahzadeh, A.; Ghaffari, S. H. Blockade of TLR4 Using TAK-242 (Resatorvid) Enhances Anti-Cancer Effects of Chemotherapeutic Agents: A Novel Synergistic Approach for Breast and Ovarian Cancers. Immunol. Res. 2019, 67 (6), 505516,  DOI: 10.1007/s12026-019-09113-8
    196. 196
      Kashani, B.; Zandi, Z.; Bashash, D.; Zaghal, A.; Momeny, M.; Poursani, E. M.; Pourbagheri-Sigaroodi, A.; Mousavi, S. A.; Ghaffari, S. H. Small Molecule Inhibitor of TLR4 Inhibits Ovarian Cancer Cell Proliferation: New Insight into the Anticancer Effect of TAK-242 (Resatorvid). Cancer Chemother. Pharmacol. 2020, 85 (1), 4759,  DOI: 10.1007/s00280-019-03988-y
    197. 197
      Premkumar, V.; Dey, M.; Dorn, R.; Raskin, I. MyD88-Dependent and Independent Pathways of Toll-Like Receptors Are Engaged in Biological Activity of Triptolide in Ligand-Stimulated Macrophages. BMC Chem. Biol. 2010, 10, 3,  DOI: 10.1186/1472-6769-10-3
    198. 198
      Ma, J. X.; Sun, Y. L.; Yu, Y.; Zhang, J.; Wu, H. Y.; Yu, X. F. Triptolide Enhances the Sensitivity of Pancreatic Cancer PANC-1 Cells to Gemcitabine by Inhibiting TLR4/NF-KB Signaling. Am. J. Transl. Res. 2019, 11 (6), 37503760
    199. 199
      Zhou, J.; Liu, Q.; Qian, R.; Liu, S.; Hu, W.; Liu, Z. Paeonol Antagonizes Oncogenesis of Osteosarcoma by Inhibiting the Function of TLR4/MAPK/NF-KB Pathway. Acta Histochem. 2020, 122 (1), 151455,  DOI: 10.1016/j.acthis.2019.151455
    200. 200
      Wu, H. C.; Ge, H. M.; Zang, L. Y.; Bei, Y. C.; Niu, Z. Y.; Wei, W.; Feng, X. J.; Ding, S.; Ng, S. W.; Shen, P. P.; Tan, R. X. Diaporine, a Novel Endophyte-Derived Regulator of Macrophage Differentiation. Org. Biomol. Chem. 2014, 12 (34), 65456548,  DOI: 10.1039/C4OB01123F
    201. 201
      Zhuang, H.; Dai, X.; Zhang, X.; Mao, Z.; Huang, H. Sophoridine Suppresses Macrophage-Mediated Immunosuppression through TLR4/IRF3 Pathway and Subsequently Upregulates CD8+ T Cytotoxic Function against Gastric Cancer. Biomed. Pharmacother. 2020, 121, 109636,  DOI: 10.1016/j.biopha.2019.109636
    202. 202
      Xie, X.; Ma, L.; Zhou, Y.; Shen, W.; Xu, D.; Dou, J.; Shen, B.; Zhou, C. Polysaccharide Enhanced NK Cell Cytotoxicity against Pancreatic Cancer via TLR4/MAPKs/NF-KB Pathway in Vitro/Vivo. Carbohydr. Polym. 2019, 225, 115223,  DOI: 10.1016/j.carbpol.2019.115223
    203. 203
      Xia, Y.; Wang, M.; Demaria, O.; Tang, J.; Rocchi, P.; Qu, F.; Iovanna, J. L.; Alexopoulou, L.; Peng, L. A Novel Bitriazolyl Acyclonucleoside Endowed with Dual Antiproliferative and Immunomodulatory Activity. J. Med. Chem. 2012, 55 (11), 56425646,  DOI: 10.1021/jm300534u
    204. 204
      Zhang, L.; Shi, L.; Soars, S. M.; Kamps, J.; Yin, H. Discovery of Novel Small-Molecule Inhibitors of NF-KB Signaling with Antiinflammatory and Anticancer Properties. J. Med. Chem. 2018, 61 (14), 58815899,  DOI: 10.1021/acs.jmedchem.7b01557
    205. 205
      Krieg, A. M. Toll-like Receptor 9 (TLR9) Agonists in the Treatment of Cancer. Oncogene 2008, 27 (2), 161167,  DOI: 10.1038/sj.onc.1210911
    206. 206
      Lim, K.-H. TLR9. Cancer Ther. Targets 2017, 1–2, 495502,  DOI: 10.1007/978-1-4419-0717-2_70
    207. 207
      Cho, H. C.; Kim, B. H.; Kim, K.; Park, J. Y.; Chang, J. H.; Kim, S. K. Cancer Immunotherapeutic Effects of Novel CpG ODN in Murine Tumor Model. Int. Immunopharmacol. 2008, 8 (10), 14011407,  DOI: 10.1016/j.intimp.2008.05.010
    208. 208
      Qi, X. F.; Zheng, L.; Kim, C. S.; Lee, K. J.; Kim, D. H.; Cai, D. Q.; Qin, J. W.; Yu, Y. H.; Wu, Z.; Kim, S. K. CpG Oligodeoxynucleotide Induces Apoptosis and Cell Cycle Arrest in A20 Lymphoma Cells via TLR9-Mediated Pathways. Mol. Immunol. 2013, 54 (3–4), 327337,  DOI: 10.1016/j.molimm.2013.01.001
    209. 209
      Zhang, Y.; Lin, A.; Zhang, C.; Tian, Z.; Zhang, J. Phosphorothioate-Modified CpG Oligodeoxynucleotide (CpG ODN) Induces Apoptosis of Human Hepatocellular Carcinoma Cells Independent of TLR9. Cancer Immunol. Immunother. 2014, 63 (4), 357367,  DOI: 10.1007/s00262-014-1518-y
    210. 210
      Yang, L.; Sun, L.; Wu, X.; Wang, L.; Wei, H.; Wan, M.; Zhang, P.; Yu, Y.; Wang, L. Therapeutic Injection of C-Class CpG ODN in Draining Lymph Node Area Induces Potent Activation of Immune Cells and Rejection of Established Breast Cancer in Mice. Clin. Immunol. 2009, 131 (3), 426437,  DOI: 10.1016/j.clim.2009.01.011
    211. 211
      Yang, M.; Yan, Y.; Fang, M.; Wan, M.; Wu, X.; Zhang, X.; Zhao, T.; Wei, H.; Song, D.; Wang, L.; Yu, Y. MF59 Formulated with CpG ODN as a Potent Adjuvant of Recombinant HSP65-MUC1 for Inducing Anti-MUC1 + Tumor Immunity in Mice. Int. Immunopharmacol. 2012, 13 (4), 408416,  DOI: 10.1016/j.intimp.2012.05.003
    212. 212
      Jordan, M.; Waxman, D. J. CpG-1826 Immunotherapy Potentiates Chemotherapeutic and Anti-Tumor Immune Responses to Metronomic Cyclophosphamide in a Preclinical Glioma Model. Cancer Lett. 2016, 373 (1), 8896,  DOI: 10.1016/j.canlet.2015.11.029
    213. 213
      Xu, A.; Zhang, L.; Yuan, J.; Babikr, F.; Freywald, A.; Chibbar, R.; Moser, M.; Zhang, W.; Zhang, B.; Fu, Z.; Xiang, J. TLR9 Agonist Enhances Radiofrequency Ablation-Induced CTL Responses, Leading to the Potent Inhibition of Primary Tumor Growth and Lung Metastasis. Cell. Mol. Immunol. 2019, 16 (10), 820832,  DOI: 10.1038/s41423-018-0184-y
    214. 214
      Babaer, D.; Amara, S.; McAdory, B. S.; Johnson, O.; Myles, E. L.; Zent, R.; Rathmell, J. C.; Tiriveedhi, V. Oligodeoxynucleotides ODN 2006 and M362 Exert Potent Adjuvant Effect through TLR-9/-6 Synergy to Exaggerate Mammaglobin-a Peptide Specific Cytotoxic CD8+T Lymphocyte Responses against Breast Cancer Cells. Cancers 2019, 11 (5), 672,  DOI: 10.3390/cancers11050672
    215. 215
      Kapp, K.; Volz, B.; Curran, M. A.; Oswald, D.; Wittig, B.; Schmidt, M. EnanDIM - a Novel Family of L-Nucleotide-Protected TLR9 Agonists for Cancer Immunotherapy. J. Immunother. Cancer 2019, 7, 5,  DOI: 10.1186/s40425-018-0470-3
    216. 216
      Jia, H.; Guo, J.; Wang, P.; Sun, K.; Chen, J.; Ren, W.; Wei, T.; Yang, Y.; Li, J.; Liu, X.; Li, R.; Zhong, J.; Wang, M.; Tian, Z.; Feng, Z.; Zhao, T. A Self-Designed CpG ODN Enhanced the Anti-Melanoma Effect of Pimozide. Int. Immunopharmacol. 2020, 83, 106397,  DOI: 10.1016/j.intimp.2020.106397
    217. 217
      Zhang, L.; Dewan, V.; Yin, H. Discovery of Small Molecules as Multi-Toll-like Receptor Agonists with Proinflammatory and Anticancer Activities. J. Med. Chem. 2017, 60 (12), 50295044,  DOI: 10.1021/acs.jmedchem.7b00419
    218. 218
      Davidson, A.; Diamond, B. Autoimmune Diseases. N. Engl. J. Med. 2001, 345 (5), 340350,  DOI: 10.1056/NEJM200108023450506
    219. 219
      Liu, Y.; Yin, H.; Zhao, M.; Lu, Q. TLR2 and TLR4 in Autoimmune Diseases: A Comprehensive Review. Clin. Rev. Allergy Immunol. 2014, 47 (2), 136147,  DOI: 10.1007/s12016-013-8402-y
    220. 220
      Joosten, L. A. B.; Abdollahi-Roodsaz, S.; Dinarello, C. A.; O’Neill, L.; Netea, M. G. Toll-like Receptors and Chronic Inflammation in Rheumatic Diseases: New Developments. Nat. Rev. Rheumatol. 2016, 12 (6), 344357,  DOI: 10.1038/nrrheum.2016.61
    221. 221
      Minagar, A. Multiple Sclerosis: An Overview of Clinical Features, Pathophysiology, Neuroimaging, and Treatment Options. Colloq. Ser. Integr. Syst. Physiol. From Mol. to Funct. 2014, 6, 1117,  DOI: 10.4199/C00116ED1V01Y201408ISP055
    222. 222
      Kumar, V. Toll-like Receptors in the Pathogenesis of Neuroinflammation. J. Neuroimmunol. 2019, 332, 1630,  DOI: 10.1016/j.jneuroim.2019.03.012
    223. 223
      Hansen, B. S.; Hussain, R. Z.; Lovett-Racke, A. E.; Thomas, J. A.; Racke, M. K. Multiple Toll-like Receptor Agonists Act as Potent Adjuvants in the Induction of Autoimmunity. J. Neuroimmunol. 2006, 172 (1–2), 94103,  DOI: 10.1016/j.jneuroim.2005.11.006
    224. 224
      Clements, M. TLR2 and TLR4 Cascade Involved in the Multifaceted Symptoms of Experimental Autoimmune Encephalomyelitis (EAE), a Model of Multiple Sclerosis, Thesis, University of Colorado at Boulder, Boulder, CO, 2019.
    225. 225
      Touil, T.; Fitzgerald, D.; Zhang, G.-X.; Rostami, A.; Gran, B. Cutting Edge: TLR3 Stimulation Suppresses Experimental Autoimmune Encephalomyelitis by Inducing Endogenous IFN-β. J. Immunol. 2006, 177 (11), 75057509,  DOI: 10.4049/jimmunol.177.11.7505
    226. 226
      Hirotani, M.; Niino, M.; Fukazawa, T.; Kikuchi, S.; Yabe, I.; Hamada, S.; Tajima, Y.; Sasaki, H. Decreased IL-10 Production Mediated by Toll-like Receptor 9 in B Cells in Multiple Sclerosis. J. Neuroimmunol. 2010, 221 (1–2), 95100,  DOI: 10.1016/j.jneuroim.2010.02.012
    227. 227
      Dishon, S.; Schumacher, A.; Fanous, J.; Talhami, A.; Kassis, I.; Karussis, D.; Gilon, C.; Hoffman, A.; Nussbaum, G. Development of a Novel Backbone Cyclic Peptide Inhibitor of the Innate Immune TLR/IL1R Signaling Protein MyD88. Sci. Rep. 2018, 8, 9476,  DOI: 10.1038/s41598-018-27773-8
    228. 228
      Hultqvist, M.; Nandakumar, K. S.; Björklund, U.; Holmdahl, R. The Novel Small Molecule Drug Rabeximod Is Effective in Reducing Disease Severity of Mouse Models of Autoimmune Disorders. Ann. Rheum. Dis. 2009, 68 (1), 130135,  DOI: 10.1136/ard.2007.085241
    229. 229
      Crowley, T.; Fitzpatrick, J. M.; Kuijper, T.; Cryan, J. F.; O’Toole, O.; O’Leary, O. F.; Downer, E. J. Modulation of TLR3/TLR4 Inflammatory Signaling by the GABAB Receptor Agonist Baclofen in Glia and Immune Cells: Relevance to Therapeutic Effects in Multiple Sclerosis. Front. Cell. Neurosci. 2015, 9, 284,  DOI: 10.3389/fncel.2015.00284
    230. 230
      Li, X.; Li, T. T.; Zhang, X. H.; Hou, L. F.; Yang, X. Q.; Zhu, F. H.; Tang, W.; Zuo, J. P. Artemisinin Analogue SM934 Ameliorates Murine Experimental Autoimmune Encephalomyelitis through Enhancing the Expansion and Functions of Regulatory T Cell. PLoS One 2013, 8 (8), e74108,  DOI: 10.1371/journal.pone.0074108
    231. 231
      Angelotti, F.; Parma, A.; Cafaro, G.; Capecchi, R.; Alunno, A.; Puxeddu, I. One Year in Review 2017: Pathogenesis of Rheumatoid Arthritis. Clin. Exp. Rheumatol. 2017, 35 (3), 368378
    232. 232
      McInnes, I. B.; Schett, G. The Pathogenesis of Rheumatoid Arthritis. N. Engl. J. Med. 2011, 365 (23), 22052219,  DOI: 10.1056/NEJMra1004965
    233. 233
      Seibl, R.; Birchler, T.; Loeliger, S.; Hossle, J. P.; Gay, R. E.; Saurenmann, T.; Michel, B. A.; Seger, R. A.; Gay, S.; Lauener, R. P. Expression and Regulation of Toll-like Receptor 2 in Rheumatoid Arthritis Synovium. Am. J. Pathol. 2003, 162 (4), 12211227,  DOI: 10.1016/S0002-9440(10)63918-1
    234. 234
      Huang, Q. Q.; Ma, Y.; Adebayo, A.; Pope, R. M. Increased Macrophage Activation Mediated through Toll-like Receptors in Rheumatoid Arthritis. Arthritis Rheum. 2007, 56 (7), 21922201,  DOI: 10.1002/art.22707
    235. 235
      Ospelt, C.; Brentano, F.; Rengel, Y.; Stanczyk, J.; Kolling, C.; Tak, P. P.; Gay, R. E.; Gay, S.; Kyburz, D. Overexpression of Toll-like Receptors 3 and 4 in Synovial Tissue from Patients with Early Rheumatoid Arthritis: Toll-like Receptor Expression in Early and Longstanding Arthritis. Arthritis Rheum. 2008, 58 (12), 36843692,  DOI: 10.1002/art.24140
    236. 236
      Roelofs, M. F.; Joosten, L. A. B.; Abdollahi-Roodsaz, S.; Van Lieshout, A. W. T.; Sprong, T.; Van Den Hoogen, F. H.; Van Den Berg, W. B.; Radstake, T. R. D. J. The Expression of Toll-like Receptors 3 and 7 in Rheumatoid Arthritis Synovium Is Increased and Costimulation of Toll-like Receptors 3, 4, and 7/8 Results in Synergistic Cytokine Production by Dendritic Cells. Arthritis Rheum. 2005, 52 (8), 23132322,  DOI: 10.1002/art.21278
    237. 237
      Hayashi, T.; Gray, C. S.; Chan, M.; Tawatao, R. I.; Ronacher, L.; McGargill, M. A.; Datta, S. K.; Carson, D. A.; Corr, M. Prevention of Autoimmune Disease by Induction of Tolerance to Toll-like Receptor 7. Proc. Natl. Acad. Sci. U. S. A. 2009, 106 (8), 27642769,  DOI: 10.1073/pnas.0813037106
    238. 238
      Sacre, S. M.; Lo, A.; Gregory, B.; Simmonds, R. E.; Williams, L.; Feldmann, M.; Brennan, F. M.; Foxwell, B. M. Inhibitors of TLR8 Reduce TNF Production from Human Rheumatoid Synovial Membrane Cultures. J. Immunol. 2008, 181 (11), 80028009,  DOI: 10.4049/jimmunol.181.11.8002
    239. 239
      Lacerte, P.; Brunet, A.; Egarnes, B.; Duchêne, B.; Brown, J. P.; Gosselin, J. Overexpression of TLR2 and TLR9 on Monocyte Subsets of Active Rheumatoid Arthritis Patients Contributes to Enhance Responsiveness to TLR Agonists. Arthritis Res. Ther. 2016, 18, 10,  DOI: 10.1186/s13075-015-0901-1
    240. 240
      Nic An Ultaigh, S.; Saber, T. P.; McCormick, J.; Connolly, M.; Dellacasagrande, J.; Keogh, B.; McCormack, W.; Reilly, M.; O’Neill, L. A.; McGuirk, P.; Fearon, U.; Veale, D. J. Blockade of Toll-like Receptor 2 Prevents Spontaneous Cytokine Release from Rheumatoid Arthritis Ex Vivo Synovial Explant Cultures. Arthritis Res. Ther. 2011, 13, R33,  DOI: 10.1186/ar3261
    241. 241
      Monnet, E.; Choy, E. H.; McInnes, I.; Kobakhidze, T.; De Graaf, K.; Jacqmin, P.; Lapeyre, G.; De Min, C. Efficacy and Safety of NI-0101, an Anti-Toll-like Receptor 4 Monoclonal Antibody, in Patients with Rheumatoid Arthritis after Inadequate Response to Methotrexate: A Phase II Study. Ann. Rheum. Dis. 2020, 79, 316323,  DOI: 10.1136/annrheumdis-2019-216487
    242. 242
      Monnet, E.; Shang, L.; Lapeyre, G.; DeGraaf, K.; Hatterer, E.; Buatois, V.; Elson, G.; Ferlin, W.; Gabay, C.; Sokolove, J.; Jones, S. A.; Choy, E. H.; McInnes, I. B.; Kosco-Vilbois, M.; de Min, C. AB0451 NI-0101, a Monoclonal Antibody Targeting Toll Like Receptor 4 (TLR4) Being Developed for Rheumatoid Arthritis (RA) Treatment with a Potential for Personalized Medicine. Ann. Rheum. Dis. 2015, 74, 1046,  DOI: 10.1136/annrheumdis-2015-eular.3801
    243. 243
      Park, S. J.; Lee, A. N.; Youn, H. S. TBK1-Targeted Suppression of TRIF-Dependent Signaling Pathway of Toll-like Receptor 3 by Auranofin. Arch. Pharmacal Res. 2010, 33 (6), 939945,  DOI: 10.1007/s12272-010-0618-2
    244. 244
      Hultqvist, M.; Nandakumar, K. S.; Björklund, U.; Holmdahl, R. Rabeximod Reduces Arthritis Severity in Mice by Decreasing Activation of Inflammatory Cells. Ann. Rheum. Dis. 2010, 69 (8), 15271532,  DOI: 10.1136/ard.2009.121178
    245. 245
      Samarpita, S.; Kim, J. Y.; Rasool, M. K.; Kim, K. S. Investigation of Toll-like Receptor (TLR) 4 Inhibitor TAK-242 as a New Potential Anti-Rheumatoid Arthritis Drug. Arthritis Res. Ther. 2020, 22, 16,  DOI: 10.1186/s13075-020-2097-2
    246. 246
      Danto, S. I.; Shojaee, N.; Singh, R. S. P.; Li, C.; Gilbert, S. A.; Manukyan, Z.; Kilty, I. Safety, Tolerability, Pharmacokinetics, and Pharmacodynamics of PF-06650833, a Selective Interleukin-1 Receptor-Associated Kinase 4 (IRAK4) Inhibitor, in Single and Multiple Ascending Dose Randomized Phase 1 Studies in Healthy Subjects. Arthritis Res. Ther. 2019, 21, 269,  DOI: 10.1186/s13075-019-2008-6
    247. 247
      Zhang, S.; Hu, Z.; Tanji, H.; Jiang, S.; Das, N.; Li, J.; Sakaniwa, K.; Jin, J.; Bian, Y.; Ohto, U.; Shimizu, T.; Yin, H. Small-Molecule Inhibition of TLR8 through Stabilization of Its Resting State. Nat. Chem. Biol. 2018, 14 (1), 5864,  DOI: 10.1038/nchembio.2518
    248. 248
      Schrezenmeier, E.; Dörner, T. Mechanisms of Action of Hydroxychloroquine and Chloroquine: Implications for Rheumatology. Nat. Rev. Rheumatol. 2020, 16 (3), 155166,  DOI: 10.1038/s41584-020-0372-x
    249. 249
      Crispín, J. C.; Liossis, S. N. C.; Kis-Toth, K.; Lieberman, L. A.; Kyttaris, V. C.; Juang, Y. T.; Tsokos, G. C. Pathogenesis of Human Systemic Lupus Erythematosus: Recent Advances. Trends Mol. Med. 2010, 16 (2), 4757,  DOI: 10.1016/j.molmed.2009.12.005
    250. 250
      Berden, J. H. M. Lupus Nephritis. Kidney Int. 1997, 52 (2), 538558,  DOI: 10.1038/ki.1997.365
    251. 251
      Kruse, K.; Janko, C.; Urbonaviciute, V.; Mierke, C. T.; Winkler, T. H.; Voll, R. E.; Schett, G.; Muñoz, L. E.; Herrmann, M. Inefficient Clearance of Dying Cells in Patients with SLE: Anti-DsDNA Autoantibodies, MFG-E8, HMGB-1 and Other Players. Apoptosis 2010, 15 (9), 10981113,  DOI: 10.1007/s10495-010-0478-8
    252. 252
      Lartigue, A.; Colliou, N.; Calbo, S.; François, A.; Jacquot, S.; Arnoult, C.; Tron, F.; Gilbert, D.; Musette, P. Critical Role of TLR2 and TLR4 in Autoantibody Production and Glomerulonephritis in Lpr Mutation-Induced Mouse Lupus. J. Immunol. 2009, 183 (10), 62076216,  DOI: 10.4049/jimmunol.0803219
    253. 253
      Liu, B.; Yang, Y.; Dai, J.; Medzhitov, R.; Freudenberg, M. A.; Zhang, P. L.; Li, Z. TLR4 Up-Regulation at Protein or Gene Level Is Pathogenic for Lupus-Like Autoimmune Disease. J. Immunol. 2006, 177 (10), 68806888,  DOI: 10.4049/jimmunol.177.10.6880
    254. 254
      Patole, P. S.; Gröne, H. J.; Segerer, S.; Ciubar, R.; Belemezova, E.; Henger, A.; Kretzler, M.; Schlöndorff, D.; Anders, H. J. Viral Double-Stranded RNA Aggravates Lupus Nephritis through Toll-like Receptor 3 on Glomerular Mesangial Cells and Antigen-Presenting Cells. J. Am. Soc. Nephrol. 2005, 16 (5), 13261338,  DOI: 10.1681/ASN.2004100820
    255. 255
      Kono, D. H.; Haraldsson, M. K.; Lawson, B. R.; Pollard, K. M.; Koh, Y. T.; Du, X.; Arnold, C. N.; Baccala, R.; Silverman, G. J.; Beutler, B. A.; Theofilopoulos, A. N. Endosomal TLR Signaling Is Required for Anti-Nucleic Acid and Rheumatoid Factor Autoantibodies in Lupus. Proc. Natl. Acad. Sci. U. S. A. 2009, 106 (29), 1206112066,  DOI: 10.1073/pnas.0905441106
    256. 256
      Lyn-Cook, B. D.; Xie, C.; Oates, J.; Treadwell, E.; Word, B.; Hammons, G.; Wiley, K. Increased Expression of Toll-like Receptors (TLRs) 7 and 9 and Other Cytokines in Systemic Lupus Erythematosus (SLE) Patients: Ethnic Differences and Potential New Targets for Therapeutic Drugs. Mol. Immunol. 2014, 61 (1), 3843,  DOI: 10.1016/j.molimm.2014.05.001
    257. 257
      Tran, N. L.; Manzin-Lorenzi, C.; Santiago-Raber, M. L. Toll-like Receptor 8 Deletion Accelerates Autoimmunity in a Mouse Model of Lupus through a Toll-like Receptor 7-Dependent Mechanism. Immunology 2015, 145 (1), 6070,  DOI: 10.1111/imm.12426
    258. 258
      Capolunghi, F.; Rosado, M. M.; Cascioli, S.; Girolami, E.; Bordasco, S.; Vivarelli, M.; Ruggiero, B.; Cortis, E.; Insalaco, A.; Fantò, N.; Gallo, G.; Nucera, E.; Loiarro, M.; Sette, C.; De santis, R.; Carsetti, R.; Ruggiero, V. Pharmacological Inhibition of TLR9 Activation Blocks Autoantibody Production in Human B Cells from SLE Patients. Rheumatology 2010, 49 (12), 22812289,  DOI: 10.1093/rheumatology/keq226
    259. 259
      Li, B.; Xia, Y.; Hu, B. Infection and Atherosclerosis: TLR-Dependent Pathways. Cell. Mol. Life Sci. 2020, 77, 27512769,  DOI: 10.1007/s00018-020-03453-7
    260. 260
      Zhou, Y.; Little, P. J.; Downey, L.; Afroz, R.; Wu, Y.; Ta, H. T.; Xu, S.; Kamato, D. The Role of Toll-like Receptors in Atherothrombotic Cardiovascular Disease. ACS Pharmacol. Transl. Sci. 2020, 3 (3), 457471,  DOI: 10.1021/acsptsci.9b00100
    261. 261
      Adamczak, D. M. The Role of Toll-like Receptors and Vitamin D in Cardiovascular Diseases—a Review. Int. J. Mol. Sci. 2017, 18 (11), 2252,  DOI: 10.3390/ijms18112252
    262. 262
      Balistreri, C. R.; Ruvolo, G.; Lio, D.; Madonna, R. Toll-like Receptor-4 Signaling Pathway in Aorta Aging and Diseases: “Its Double Nature.. J. Mol. Cell. Cardiol. 2017, 110, 3853,  DOI: 10.1016/j.yjmcc.2017.06.011
    263. 263
      Bomfim, G. F.; Echem, C.; Martins, C. B.; Costa, T. J.; Sartoretto, S. M.; Dos Santos, R. A.; Oliveira, M. A.; Akamine, E. H.; Fortes, Z. B.; Tostes, R. C.; Webb, R. C.; Carvalho, M. H. C. Toll-like Receptor 4 Inhibition Reduces Vascular Inflammation in Spontaneously Hypertensive Rats. Life Sci. 2015, 122, 17,  DOI: 10.1016/j.lfs.2014.12.001
    264. 264
      Kim, J.; Yoo, J. Y.; Suh, J. M.; Park, S.; Kang, D.; Jo, H.; Bae, Y. S. The Flagellin-TLR5-Nox4 Axis Promotes the Migration of Smooth Muscle Cells in Atherosclerosis. Exp. Mol. Med. 2019, 51, 78,  DOI: 10.1038/s12276-019-0275-6
    265. 265
      Fukuda, D.; Nishimoto, S.; Aini, K.; Tanaka, A.; Nishiguchi, T.; Kim-Kaneyama, J. R.; Lei, X. F.; Masuda, K.; Naruto, T.; Tanaka, K.; Higashikuni, Y.; Hirata, Y.; Yagi, S.; Kusunose, K.; Yamada, H.; Soeki, T.; Imoto, I.; Akasaka, T.; Shimabukuro, M.; Sata, M. Toll-like Receptor 9 Plays a Pivotal Role in Angiotensin II-Induced Atherosclerosis. J. Am. Heart Assoc. 2019, 8 (7), e010860,  DOI: 10.1161/JAHA.118.010860
    266. 266
      Navi, A.; Patel, H.; Shaw, S.; Baker, D.; Tsui, J. Therapeutic Role of Toll-like Receptor Modification in Cardiovascular Dysfunction. Vasc. Pharmacol. 2013, 58 (3), 231239,  DOI: 10.1016/j.vph.2012.10.001
    267. 267
      Wang, Z.; Wang, Z.; Zhu, J.; Long, X.; Yan, J. Vitamin K2 Can Suppress the Expression of Toll-like Receptor 2 (TLR2) and TLR4, and Inhibit Calcification of Aortic Intima in ApoE–/– Mice as Well as Smooth Muscle Cells. Vascular 2018, 26 (1), 1826,  DOI: 10.1177/1708538117713395
    268. 268
      Owens, A. P.; Passam, F. H.; Antoniak, S.; Marshall, S. M.; McDaniel, A. L.; Rudel, L.; Williams, J. C.; Hubbard, B. K.; Dutton, J. A.; Wang, J.; Tobias, P. S.; Curtiss, L. K.; Daugherty, A.; Kirchhofer, D.; Luyendyk, J. P.; Moriarty, P. M.; Nagarajan, S.; Furie, B. C.; Furie, B.; Johns, D. G.; Temel, R. E.; Mackman, N. Monocyte Tissue Factor - Dependent Activation of Coagulation in Hypercholesterolemic Mice and Monkeys Is Inhibited by Simvastatin. J. Clin. Invest. 2012, 122 (2), 558568,  DOI: 10.1172/JCI58969
    269. 269
      Farkas, D.; Thompson, A. A. R.; Bhagwani, A. R.; Hultman, S.; Ji, H.; Kotha, N.; Farr, G.; Arnold, N. D.; Braithwaite, A.; Casbolt, H.; Cole, J. E.; Sabroe, I.; Monaco, C.; Cool, C. D.; Goncharova, E. A.; Lawrie, A.; Farkas, L. Toll-like Receptor 3 Is a Therapeutic Target for Pulmonary Hypertension. Am. J. Respir. Crit. Care Med. 2019, 199 (2), 199210,  DOI: 10.1164/rccm.201707-1370OC
    270. 270
      Wang, P.-F.; Fang, H.; Chen, J.; Lin, S.; Liu, Y.; Xiong, X.-Y.; Wang, Y.-C.; Xiong, R.-P.; lv, F.-L.; Wang, J.; Yang, Q.-W. Polyinosinic-Polycytidylic Acid Has Therapeutic Effects against Cerebral Ischemia/Reperfusion Injury through the Downregulation of TLR4 Signaling via TLR3. J. Immunol. 2014, 192 (10), 47834794,  DOI: 10.4049/jimmunol.1303108
    271. 271
      Chen, G.; Chen, X. L.; Xu, C. B.; Lin, J.; Luo, H. L.; Xie, X.; Li, J. Toll-like Receptor Protein 4 Monoclonal Antibody Inhibits MmLDL-Induced Endothelium-Dependent Vasodilation Dysfunction of Mouse Mesenteric Arteries. Microvasc. Res. 2020, 127, 103923,  DOI: 10.1016/j.mvr.2019.103923
    272. 272
      Huggins, C.; Pearce, S.; Peri, F.; Neumann, F.; Cockerill, G.; Pirianov, G. A Novel Small Molecule TLR4 Antagonist (IAXO-102) Negatively Regulates Non-Hematopoietic Toll like Receptor 4 Signalling and Inhibits Aortic Aneurysms Development. Atherosclerosis 2015, 242 (2), 563570,  DOI: 10.1016/j.atherosclerosis.2015.08.010
    273. 273
      Sun, M.; Deng, B.; Zhao, X.; Gao, C.; Yang, L.; Zhao, H.; Yu, D.; Zhang, F.; Xu, L.; Chen, L.; Sun, X. Isoflurane Preconditioning Provides Neuroprotection against Stroke by Regulating the Expression of the TLR4 Signalling Pathway to Alleviate Microglial Activation. Sci. Rep. 2015, 5, 11445,  DOI: 10.1038/srep11445
    274. 274
      Kapelouzou, A.; Giaglis, S.; Peroulis, M.; Katsimpoulas, M.; Moustardas, P.; Aravanis, C. V.; Kostakis, A.; Karayannakos, P. E.; Cokkinos, D. V. Overexpression of Toll-Like Receptors 2, 3, 4, and 8 Is Correlated to the Vascular Atherosclerotic Process in the Hyperlipidemic Rabbit Model: The Effect of Statin Treatment. J. Vasc. Res. 2017, 54 (3), 156169,  DOI: 10.1159/000457797
    275. 275
      Koulis, C.; Chen, Y. C.; Hausding, C.; Ahrens, I.; Kyaw, T. S.; Tay, C.; Allen, T.; Jandeleit-Dahm, K.; Sweet, M. J.; Akira, S.; Bobik, A.; Peter, K.; Agrotis, A. Protective Role for Toll-like Receptor-9 in the Development of Atherosclerosis in Apolipoprotein e-Deficient Mice. Arterioscler., Thromb., Vasc. Biol. 2014, 34 (3), 516525,  DOI: 10.1161/ATVBAHA.113.302407
    276. 276
      McCarthy, C. G.; Wenceslau, C. F.; Goulopoulou, S.; Baban, B.; Matsumoto, T.; Webb, R. C. Chloroquine Suppresses the Development of Hypertension in Spontaneously Hypertensive Rats. Am. J. Hypertens. 2017, 30 (2), 173181,  DOI: 10.1093/ajh/hpw113
    277. 277
      Carullo, G.; Governa, P.; Leo, A.; Gallelli, L.; Citraro, R.; Cione, E.; Caroleo, M. C.; Biagi, M.; Aiello, F.; Manetti, F. Quercetin-3-Oleate Contributes to Skin Wound Healing Targeting FFA1/GPR40. ChemistrySelect 2019, 4 (29), 84298433,  DOI: 10.1002/slct.201902572
    278. 278
      Carullo, G.; Perri, M.; Manetti, F.; Aiello, F.; Caroleo, M. C.; Cione, E. Quercetin-3-Oleoyl Derivatives as New GPR40 Agonists: Molecular Docking Studies and Functional Evaluation. Bioorg. Med. Chem. Lett. 2019, 29 (14), 17611764,  DOI: 10.1016/j.bmcl.2019.05.018
    279. 279
      Westwell-Roper, C.; Nackiewicz, D.; Dan, M.; Ehses, J. A. Toll-like Receptors and NLRP3 as Central Regulators of Pancreatic Islet Inflammation in Type 2 Diabetes. Immunol. Cell Biol. 2014, 92 (4), 314323,  DOI: 10.1038/icb.2014.4
    280. 280
      Rada, I.; Deldicque, L.; Francaux, M.; Zbinden-Foncea, H. Toll like Receptor Expression Induced by Exercise in Obesity and Metabolic Syndrome: A Systematic Review. Exerc. Immunol. Rev. 2018, 24 (14), 6071
    281. 281
      Singh, K.; Singh, K.; Agrawal, N. K.; Gupta, S. K.; Mohan, G.; Chaturvedi, S. Genetic and Epigenetic Alterations in Toll like Receptor 2 and Wound Healing Impairment in Type 2 Diabetes Patients. J. Diabetes Complications 2015, 29 (2), 222229,  DOI: 10.1016/j.jdiacomp.2014.11.015
    282. 282
      Zaharieva, E.; Velikova, T.; Tsakova, A.; Kamenov, Z. Reduced Soluble Toll-like Receptors 2 in Type 2 Diabetes. Arch. Physiol. Biochem. 2018, 124 (4), 326329,  DOI: 10.1080/13813455.2017.1401642
    283. 283
      Pahwa, R.; Jialal, I. Hyperglycemia Induces Toll-Like Receptor Activity Through Increased Oxidative Stress. Metab. Syndr. Relat. Disord. 2016, 14 (5), 239241,  DOI: 10.1089/met.2016.29006.pah
    284. 284
      Sepehri, Z.; Kiani, Z.; Nasiri, A. A.; Kohan, F. Toll-like Receptor 2 and Type 2 Diabetes. Cell. Mol. Biol. Lett. 2016, 21, 2,  DOI: 10.1186/s11658-016-0002-4
    285. 285
      Sepehri, Z.; Kiani, Z.; Javadian, F.; Akbar Nasiri, A.; Kohan, F.; Sepehrikia, S.; Javan Siamardi, S.; Aali, H.; Daneshvar, H.; Kennedy, D. TLR3 and Its Roles in the Pathogenesis of Type 2 Diabetes. Cell. Mol. Biol. 2015, 61 (3), 4650,  DOI: 10.14715/cmb/2015.61.3.10
    286. 286
      Rogero, M. M.; Calder, P. C. Obesity, Inflammation, Toll-like Receptor 4 and Fatty Acids. Nutrients 2018, 10 (4), 432,  DOI: 10.3390/nu10040432
    287. 287
      Portou, M. J.; Yu, R.; Baker, D.; Xu, S.; Abraham, D.; Tsui, J. Hyperglycaemia and Ischaemia Impair Wound Healing via Toll-like Receptor 4 Pathway Activation in Vitro and in an Experimental Murine Model. Eur. J. Vasc. Endovasc. Surg. 2020, 59 (1), 117127,  DOI: 10.1016/j.ejvs.2019.06.018
    288. 288
      Karpova, T.; de Oliveira, A. A.; Naas, H.; Priviero, F.; Nunes, K. P. Blockade of Toll-like Receptor 4 (TLR4) Reduces Oxidative Stress and Restores Phospho-ERK1/2 Levels in Leydig Cells Exposed to High Glucose. Life Sci. 2020, 245, 117365,  DOI: 10.1016/j.lfs.2020.117365
    289. 289
      Wang, H.; Zhang, Q.; Chai, Y.; Liu, Y.; Li, F.; Wang, B.; Zhu, C.; Cui, J.; Qu, H.; Zhu, M. 1,25(OH)2D3 Downregulates the Toll-like Receptor 4-Mediated Inflammatory Pathway and Ameliorates Liver Injury in Diabetic Rats. J. Endocrinol. Invest. 2015, 38 (10), 10831091,  DOI: 10.1007/s40618-015-0287-6
    290. 290
      Yu, R.; Bo, H.; Villani, V.; Spencer, P. J.; Fu, P. The Inhibitory Effect of Rapamycin on Toll Like Receptor 4 and Interleukin 17 in the Early Stage of Rat Diabetic Nephropathy. Kidney Blood Pressure Res. 2016, 41 (1), 5569,  DOI: 10.1159/000368547
    291. 291
      Lin, M.; Yiu, W. H.; Li, R. X.; Wu, H. J.; Wong, D. W. L.; Chan, L. Y. Y.; Leung, J. C. K.; Lai, K. N.; Tang, S. C. W. The TLR4 Antagonist CRX-526 Protects against Advanced Diabetic Nephropathy. Kidney Int. 2013, 83 (5), 887900,  DOI: 10.1038/ki.2013.11
    292. 292
      Dasu, M. R.; Ramirez, S.; Isseroff, R. R. Toll-like Receptors and Diabetes: A Therapeutic Perspective. Clin. Sci. 2012, 122 (5), 203214,  DOI: 10.1042/CS20110357
    293. 293
      Hayward, J. H.; Lee, S. J. A Decade of Research on TLR2 Discovering Its Pivotal Role in Glial Activation and Neuroinflammation in Neurodegenerative Diseases. Exp. Neurobiol. 2014, 23 (2), 138147,  DOI: 10.5607/en.2014.23.2.138
    294. 294
      Rangasamy, S. B.; Jana, M.; Roy, A.; Corbett, G. T.; Kundu, M.; Chandra, S.; Mondal, S.; Dasarathi, S.; Mufson, E. J.; Mishra, R. K.; Luan, C. H.; Bennett, D. A.; Pahan, K. Selective Disruption of TLR2-MyD88 Interaction Inhibits Inflammation and Attenuates Alzheimer’s Pathology. J. Clin. Invest. 2018, 128 (10), 42974312,  DOI: 10.1172/JCI96209
    295. 295
      Kwon, S.; Iba, M.; Masliah, E.; Kim, C. Targeting Microglial and Neuronal Toll-like Receptor 2 in Synucleinopathies. Exp. Neurobiol. 2019, 28 (5), 547553,  DOI: 10.5607/en.2019.28.5.547
    296. 296
      Fiebich, B. L.; Batista, C. R. A.; Saliba, S. W.; Yousif, N. M.; de Oliveira, A. C. P. Role of Microglia TLRs in Neurodegeneration. Front. Cell. Neurosci. 2018, 12, 329,  DOI: 10.3389/fncel.2018.00329
    297. 297
      Mulfaul, K.; Ozaki, E.; Fernando, N.; Brennan, K.; Chirco, K. R.; Connolly, E.; Greene, C.; Maminishkis, A.; Salomon, R. G.; Linetsky, M.; Natoli, R.; Mullins, R. F.; Campbell, M.; Doyle, S. L. Toll-like Receptor 2 Facilitates Oxidative Damage-Induced Retinal Degeneration. Cell Rep. 2020, 30 (7), 22092224.e5,  DOI: 10.1016/j.celrep.2020.01.064
    298. 298
      Kohno, H.; Chen, Y.; Kevany, B. M.; Pearlman, E.; Miyagi, M.; Maeda, T.; Palczewski, K.; Maeda, A. Photoreceptor Proteins Initiate Microglial Activation via Toll-like Receptor 4 in Retinal Degeneration Mediated by All-Trans-Retinal. J. Biol. Chem. 2013, 288 (21), 1532615341,  DOI: 10.1074/jbc.M112.448712
    299. 299
      Huang, Z.; Zhou, T.; Sun, X.; Zheng, Y.; Cheng, B.; Li, M.; Liu, X.; He, C. Necroptosis in Microglia Contributes to Neuroinflammation and Retinal Degeneration through TLR4 Activation. Cell Death Differ. 2018, 25 (1), 180189,  DOI: 10.1038/cdd.2017.141
    300. 300
      Liao, W. Y.; Tsai, T. H.; Ho, T. Y.; Lin, Y. W.; Cheng, C. Y.; Hsieh, C. L. Neuroprotective Effect of Paeonol Mediates Anti-Inflammation via Suppressing Toll-like Receptor 2 and Toll-like Receptor 4 Signaling Pathways in Cerebral Ischemia-Reperfusion Injured Rats. Evidence-based Complement. Altern. Med. 2016, 2016, 3704647,  DOI: 10.1155/2016/3704647
    301. 301
      Zhao, R.; Zhang, J.; Wang, Y.; Jin, J.; Zhou, H.; Chen, J.; Su, S. B. Activation of Toll-like Receptor 3 Promotes Pathological Corneal Neovascularization by Enhancement of SDF-1-Mediated Endothelial Progenitor Cell Recruitment. Exp. Eye Res. 2019, 178, 177185,  DOI: 10.1016/j.exer.2018.10.005
    302. 302
      Leitner, G. R.; Wenzel, T. J.; Marshall, N.; Gates, E. J.; Klegeris, A. Targeting Toll-like Receptor 4 to Modulate Neuroinflammation in Central Nervous System Disorders. Expert Opin. Ther. Targets 2019, 23 (10), 865882,  DOI: 10.1080/14728222.2019.1676416
    303. 303
      Chavali, V. D.; Agarwal, M.; Vyas, V. K.; Saxena, B. Neuroprotective Effects of Ethyl Pyruvate against Aluminum Chloride-Induced Alzheimer’s Disease in Rats via Inhibiting Toll-Like Receptor 4. J. Mol. Neurosci. 2020, 70, 836850,  DOI: 10.1007/s12031-020-01489-9
    304. 304
      Kamigaki, M.; Hide, I.; Yanase, Y.; Shiraki, H.; Harada, K.; Tanaka, Y.; Seki, T.; Shirafuji, T.; Tanaka, S.; Hide, M.; Sakai, N. The Toll-like Receptor 4-Activated Neuroprotective Microglia Subpopulation Survives via Granulocyte Macrophage Colony-Stimulating Factor and JAK2/STAT5 Signaling. Neurochem. Int. 2016, 93, 8294,  DOI: 10.1016/j.neuint.2016.01.003
    305. 305
      Feng, Y.; Gao, J.; Cui, Y.; Li, M.; Li, R.; Cui, C.; Cui, J. Neuroprotective Effects of Resatorvid Against Traumatic Brain Injury in Rat: Involvement of Neuronal Autophagy and TLR4 Signaling Pathway. Cell. Mol. Neurobiol. 2017, 37 (1), 155168,  DOI: 10.1007/s10571-016-0356-1
    306. 306
      Yang, L.; Zhou, R.; Tong, Y.; Chen, P.; Shen, Y.; Miao, S.; Liu, X. Neuroprotection by Dihydrotestosterone in LPS-Induced Neuroinflammation. Neurobiol. Dis. 2020, 140, 104814,  DOI: 10.1016/j.nbd.2020.104814
    307. 307
      De Paola, M.; Mariani, A.; Bigini, P.; Peviani, M.; Ferrara, G.; Molteni, M.; Gemma, S.; Veglianese, P.; Castellaneta, V.; Boldrin, V.; Rossetti, C.; Chiabrando, C.; Forloni, G.; Mennini, T.; Fanelli, R. Neuroprotective Effects of Toll-like Receptor 4 Antagonism in Spinal Cord Cultures and in a Mouse Model of Motor Neuron Degeneration. Mol. Med. 2012, 18 (6), 971981,  DOI: 10.2119/molmed.2012.00020
    308. 308
      Ikram, M.; Muhammad, T.; Rehman, S. U.; Khan, A.; Jo, M. G.; Ali, T.; Kim, M. O. Hesperetin Confers Neuroprotection by Regulating Nrf2/TLR4/NF-KB Signaling in an Aβ Mouse Model. Mol. Neurobiol. 2019, 56 (9), 62936309,  DOI: 10.1007/s12035-019-1512-7
    309. 309
      Jiwrajka, M.; Phillips, A.; Butler, M.; Rossi, M.; Pocock, J. M. The Plant-Derived Chalcone 2,2′,5′-Trihydroxychalcone Provides Neuroprotection against Toll-Like Receptor 4 Triggered Inflammation in Microglia. Oxid. Med. Cell. Longevity 2016, 2016, 6301712,  DOI: 10.1155/2016/6301712
    310. 310
      Zhu, X.; Liu, J.; Chen, O.; Xue, J.; Huang, S.; Zhu, W.; Wang, Y. Neuroprotective and Anti-Inflammatory Effects of Isoliquiritigenin in Kainic Acid-Induced Epileptic Rats via the TLR4/MYD88 Signaling Pathway. Inflammopharmacology 2019, 27 (6), 11431153,  DOI: 10.1007/s10787-019-00592-7
    311. 311
      Maatouk, L.; Compagnion, A. C.; Sauvage, M. A. C. De; Bemelmans, A. P.; Leclere-Turbant, S.; Cirotteau, V.; Tohme, M.; Beke, A.; Trichet, M.; Bazin, V.; Trawick, B. N.; Ransohoff, R. M.; Tronche, F.; Manoury, B.; Vyas, S. TLR9 Activation via Microglial Glucocorticoid Receptors Contributes to Degeneration of Midbrain Dopamine Neurons. Nat. Commun. 2018, 9, 2450,  DOI: 10.1038/s41467-018-04569-y
    312. 312
      Portou, M. J.; Baker, D.; Abraham, D.; Tsui, J. The Innate Immune System, Toll-like Receptors and Dermal Wound Healing: A Review. Vasc. Pharmacol. 2015, 71, 3136,  DOI: 10.1016/j.vph.2015.02.007
    313. 313
      Yang, H.; Brackett, C. M.; Morales-Tirado, V. M.; Li, Z.; Zhang, Q.; Wilson, M. W.; Benjamin, C.; Harris, W.; Waller, E. K.; Gudkov, A. V.; Burdelya, L. G.; Grossniklaus, H. E. The Toll-like Receptor 5 Agonist Entolimod Suppresses Hepatic Metastases in a Murine Model of Ocular Melanoma via an NK Cell-Dependent Mechanism. Oncotarget 2016, 7 (3), 29362950,  DOI: 10.18632/oncotarget.6500
    314. 314
      Bi, J.; Wang, W.; Du, J.; Chen, K.; Cheng, K. Structure-Activity Relationship Study and Biological Evaluation of SAC-Garlic Acid Conjugates as Novel Anti-Inflammatory Agents. Eur. J. Med. Chem. 2019, 179, 233245,  DOI: 10.1016/j.ejmech.2019.06.059
    315. 315
      Zhang, Y.; Zhang, Y. Pterostilbene, a Novel Natural Plant Conduct, Inhibits High Fat-Induced Atherosclerosis Inflammation via NF-KB Signaling Pathway in Toll-like Receptor 5 (TLR5) Deficient Mice. Biomed. Pharmacother. 2016, 81, 345355,  DOI: 10.1016/j.biopha.2016.04.031
    316. 316
      Anwar, M. A.; Shah, M.; Kim, J.; Choi, S. Recent Clinical Trends in Toll-like Receptor Targeting Therapeutics. Med. Res. Rev. 2019, 39 (3), 10531090,  DOI: 10.1002/med.21553
    317. 317
      Lima, C. X.; Souza, D. G.; Amaral, F. A.; Fagundes, C. T.; Rodrigues, I. P. S.; Alves-Filho, J. C.; Kosco-Vilbois, M.; Ferlin, W.; Shang, L.; Elson, G.; Teixeira, M. M. Therapeutic Effects of Treatment with Anti-TLR2 and Anti-TLR4Monoclonal Antibodies in Polymicrobial Sepsis. PLoS One 2015, 10 (7), e0132336,  DOI: 10.1371/journal.pone.0132336
    318. 318
      Toshchakov, V. Y.; Szmacinski, H.; Couture, L. A.; Lakowicz, J. R.; Vogel, S. N. Targeting TLR4 Signaling by TLR4 Toll/IL-1 Receptor Domain-Derived Decoy Peptides: Identification of the TLR4 Toll/IL-1 Receptor Domain Dimerization Interface. J. Immunol. 2011, 186 (8), 48194827,  DOI: 10.4049/jimmunol.1002424
    319. 319
      Sallenave, J.-M.; Guillot, L. Innate Immune Signaling and Proteolytic Pathways in the Resolution or Exacerbation of SARS-CoV-2 in Covid-19: Key Therapeutic Targets?. Front. Immunol. 2020, 11, 1229,  DOI: 10.3389/fimmu.2020.01229
    320. 320
      Chakraborty, C.; Sharma, A. R.; Bhattacharya, M.; Sharma, G.; Lee, S.-S.; Agoramoorthy, G. Consider TLR5 for New Therapeutic Development against COVID-19. J. Med. Virol. 2020,  DOI: 10.1002/jmv.25997
    321. 321
      Wali, S.; Flores, J. R.; Jaramillo, A. M.; Goldblatt, D. L.; Pantaleón García, J.; Tuvim, M. J.; Dickey, B. F.; Evans, S. E. Immune Modulation to Improve Survival of Respiratory Virus Infections in Mice. bioRxiv 2020, DOI: 10.1101/2020.04.16.045054 .
    322. 322
      Conti, P.; Ronconi, G.; Caraffa, A.; Gallenga, C.; Ross, R.; Frydas, I.; Kritas, S. Induction of Pro-Inflammatory Cytokines (IL-1 and IL-6) and Lung Inflammation by Coronavirus-19 (COVI-19 or SARS-CoV-2): Anti-Inflammatory Strategies. J. Biol. Regul. Homeost. Agents 2020, 34 (2), 1115,  DOI: 10.23812/conti-e

Pair your accounts.

Export articles to Mendeley

Get article recommendations from ACS based on references in your Mendeley library.

Pair your accounts.

Export articles to Mendeley

Get article recommendations from ACS based on references in your Mendeley library.

You’ve supercharged your research process with ACS and Mendeley!

STEP 1:
Click to create an ACS ID

Please note: If you switch to a different device, you may be asked to login again with only your ACS ID.

Please note: If you switch to a different device, you may be asked to login again with only your ACS ID.

Please note: If you switch to a different device, you may be asked to login again with only your ACS ID.

MENDELEY PAIRING EXPIRED
Your Mendeley pairing has expired. Please reconnect

This website uses cookies to improve your user experience. By continuing to use the site, you are accepting our use of cookies. Read the ACS privacy policy.

CONTINUE